BCL11B

Summary

BCL11B (BCL11 transcription factor B, HGNC:13222) is a protein-coding gene on chromosome 14q32.2, encoding B-cell lymphoma/leukemia 11B (Q9C0K0). Key regulator of both differentiation and survival of T-lymphocytes during thymocyte development in mammals.

This gene encodes a C2H2-type zinc finger protein and is closely related to BCL11A, a gene whose translocation may be associated with B-cell malignancies. Although the specific function of this gene has not been determined, the encoded protein is known to be a transcriptional repressor, and is regulated by the NURD nucleosome remodeling and histone deacetylase complex. Four alternatively spliced transcript variants encoding distinct isoforms have been found for this gene.

Source: NCBI Gene 64919 — RefSeq curated summary.

At a glance

• Gene–disease (curated): intellectual developmental disorder with speech delay, dysmorphic facies, and t-cell abnormalities (Definitive, ClinGen) — +1 more curated relationship
• GWAS associations: 26
• Clinical variants (ClinVar): 949 total — 36 pathogenic, 30 likely-pathogenic
• Phenotypes (HPO): 54
• Cancer driver (intOGen): activating (oncogene-like) across 3 cancer types
• Transcription factor: yes — 29 downstream targets (CollecTRI)
• MANE Select transcript: NM_138576

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:13222
Approved symbol	BCL11B
Name	BCL11 transcription factor B
Location	14q32.2
Locus type	gene with protein product
Status	Approved
Aliases	CTIP-2, CTIP2, hRIT1-alpha, SMARCM2
Ensembl gene	ENSG00000127152
Ensembl biotype	protein_coding
OMIM	606558
Entrez	64919

Gene structure

Transcript identifiers

Ensembl transcripts: 3 — 3 protein_coding

ENST00000345514, ENST00000357195, ENST00000443726

RefSeq mRNA: 4 — MANE Select: NM_138576 NM_001282237, NM_001282238, NM_022898, NM_138576

CCDS: CCDS9949, CCDS9950

Canonical transcript exons

ENST00000357195 — 4 exons

Exon	Start	End
ENSE00000870344	99257471	99257839
ENSE00001311164	99169287	99176195
ENSE00001738246	99271161	99272197
ENSE00002087282	99231345	99231557

Expression profiles

Bgee: expression breadth ubiquitous, 211 present calls, max score 96.58.

FANTOM5 (CAGE): breadth broad, TPM avg 17.9388 / max 1295.9254, expressed in 683 samples.

FANTOM5 promoters (9 alternative TSS)

Promoter ID	TPM avg	Samples expressed
144870	15.9948	657
144868	0.7095	152
144869	0.3552	125
144866	0.3240	98
144864	0.2132	82
144863	0.1362	56
144849	0.0813	45
144865	0.0812	47
144867	0.0435	30

Top tissues by expression

272 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
thymus	UBERON:0002370	96.58	gold quality
upper leg skin	UBERON:0004262	95.70	gold quality
cortical plate	UBERON:0005343	95.56	gold quality
nipple	UBERON:0002030	94.67	gold quality
skin of hip	UBERON:0001554	92.21	gold quality
mammalian vulva	UBERON:0000997	91.69	gold quality
buccal mucosa cell	CL:0002336	90.81	gold quality
secondary oocyte	CL:0000655	89.76	gold quality
upper arm skin	UBERON:0004263	89.44	gold quality
ganglionic eminence	UBERON:0004023	89.32	gold quality
gingiva	UBERON:0001828	88.89	gold quality
gingival epithelium	UBERON:0001949	87.63	gold quality
CA1 field of hippocampus	UBERON:0003881	87.59	gold quality
jejunal mucosa	UBERON:0000399	87.21	gold quality
penis	UBERON:0000989	87.16	gold quality
oral cavity	UBERON:0000167	84.54	gold quality
ileal mucosa	UBERON:0000331	83.52	gold quality
granulocyte	CL:0000094	83.41	gold quality
blood	UBERON:0000178	82.78	gold quality
nucleus accumbens	UBERON:0001882	81.90	gold quality
superficial temporal artery	UBERON:0001614	81.61	gold quality
epithelium of nasopharynx	UBERON:0001951	81.47	gold quality
zone of skin	UBERON:0000014	81.40	gold quality
esophagus squamous epithelium	UBERON:0006920	80.83	gold quality
squamous epithelium	UBERON:0006914	80.82	gold quality
lymph node	UBERON:0000029	80.38	gold quality
putamen	UBERON:0001874	80.38	gold quality
skin of abdomen	UBERON:0001416	80.19	gold quality
epithelium of esophagus	UBERON:0001976	80.15	gold quality
skin of leg	UBERON:0001511	79.23	gold quality

Single-cell (SCXA)

Detected in 13 experiment(s), a significant marker in 11.

Experiment	Marker?	Max mean expression
E-GEOD-75140	yes	1484.25
E-MTAB-8894	yes	1299.12
E-MTAB-9221	yes	592.94
E-HCAD-4	yes	382.81
E-GEOD-93593	yes	335.55
E-HCAD-5	yes	52.33
E-CURD-122	yes	43.29
E-HCAD-1	yes	36.18
E-HCAD-10	yes	24.31
E-ANND-3	yes	13.54
E-CURD-112	yes	8.46
E-GEOD-150728	no	621.82
E-MTAB-8911	no	173.33

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

29 targets.

Target	Regulation
BCL11B
BTK
CD8A
CDKN1A	Repression
CDKN1C	Activation
CEL
CHUK
CTNNB1
EGFR	Activation
FOXP3
GNAS
IL10	Activation
IL2	Unknown
KRT8	Repression
LGALS3
MAP3K8
MDM2
MYH7
NOTCH1	Activation
PRKACA
SIRT1
SNAI1	Repression
SNAI2	Repression
TAT
TGFA	Repression
TGFB1	Repression
TGFB2	Repression
TRIB3
TSLP	Repression

Upstream regulators (CollecTRI, top): BCL11B, NOTCH1, SATB2, TCF3

miRNA regulators (miRDB)

257 targeting BCL11B, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-30A-5P	100.00	76.31	3233
HSA-MIR-30B-5P	100.00	76.29	3248
HSA-MIR-30C-5P	100.00	76.29	3248
HSA-MIR-30D-5P	100.00	76.32	3233
HSA-MIR-30E-5P	100.00	76.32	3242
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-126-5P	100.00	72.71	3180
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-513B-5P	99.99	69.96	2150
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-4531	99.99	69.70	3181
HSA-MIR-371A-3P	99.99	66.77	91
HSA-MIR-4534	99.99	66.58	1907
HSA-MIR-32-5P	99.98	75.21	1964

Literature-anchored findings (GeneRIF, showing 40)

• CTIP2 mediates transcriptional repression with SIRT1 in mammmalian cells (PMID:12930829)
• To our knowledge, this is the first report implicating BCL11B in hematological malignancies. (PMID:15104287)
• BCL11B is involved in hematological neoplasms of T-cells but not acute myeloid leukemia. (PMID:15325104)
• BCL11B appears to play a key role in T-cell differentiation, BCL11B disruption and disturbed expression may contribute to the development of T-cell malignancies in man. (PMID:15668700)
• transcriptional repression fuction is mediated by NuRD complex (PMID:16091750)
• CTIP2 recruits histone deacetylase (HDAC)1 and HDAC2 to promote local histone H3 deacetylation at the HIV-1 promoter region. (PMID:17245431)
• Data document homeobox gene dysregulation by a novel regulatory region at 3’-BCL11B responsive to histone deacetylase inhibition and highlight a novel class of potential therapeutic target amid noncoding DNA. (PMID:17308084)
• Bcl11b has a role in response to DNA replication stress and damages (PMID:17369851)
• We propose that sequestration and/or decreased expression of Bcl11b in HD is responsible, at least in part, for the dysregulation of striatal gene expression observed in HD and may contribute to the specificity of pathology observed in this disease. (PMID:18595722)
• The authors provide evidence that the transcription factor BCL11B represses expression from the HIV-1 long terminal repeat (LTR) in T lymphocytes through direct association with the HIV-1 long terminal repeat. (PMID:18768194)
• CTIP2 expression could be linked to disease progression and/or maintenance in human atopic dermatitis and allergic contact dermatitis (PMID:19366371)
• A statistically significant increase in the expression of CTIP2 was detected in poorly differentiated samples of head and neck tumors. (PMID:19399189)
• CTIP2 is a constitutive p21 gene suppressor that cooperates with SUV39H1 and histone methylation to silence the p21 gene transcription. (PMID:19581932)
• Increased expression of bcl11b leads to chemoresistance and G1 arrest. (PMID:20824091)
• This study proposed that the expression of CTIP2 in the anterior neocortex may mark the early location of the human motor cortex, including its corticospinal projection neurons, allowing further study of their early differentiation. (PMID:21060114)
• BCL11B might play a role in anti-apoptosis in T-ALL cells through up-regulation of its downstream genes BCL2L1 and CREBBP. (PMID:21080944)
• BCL11B is a haploinsufficient tumor suppressor that collaborates with all major T-ALL oncogenic lesions in human thymocyte transformation. (PMID:21878675)
• Common genetic variation in a locus in the BCL11B gene desert that is thought to harbor 1 or more gene enhancers is associated with higher CFPWV and increased risk for cardiovascular disease. (PMID:22068335)
• BCL11B directly interacts with P2 promoter region of HDM2 and inhibits HDM2 promoter activity in a p53-dependent manner. (PMID:22245141)
• REVIEW: describes phenotypes given by loss of Bcl11b and roles of Bcl11b in cell proliferation, differentiation and apoptosis, taking tissue development and lymphomagenesis into consideration (PMID:22450536)
• Bcl11b phospho-deSUMO switch was identified, the basis of which was phosphorylation-dependent recruitment of the SUMO hydrolase SENP1 to phospho-Bcl11b, coupled to hydrolysis of SUMO-Bcl11b (PMID:22700985)
• BLC11B is an oncogene in T-ALL pathogenesis. (PMID:23040356)
• BCL11B gene silencing alone does not affect hematopoietic stem/progenitor cell proliferation and differentiation in vitro. (PMID:23168072)
• a reduction in the level of the BCL11B protein is a key event in the multistep progression of ATLL leukemogenesis (PMID:23383087)
• BCL11B is up-regulated by EWS/FLI and contributes to the transformed phenotype in Ewing sarcoma. (PMID:23527175)
• overexpressed in mycosis fungoides lesions (PMID:23682716)
• CTIP2 controls P-TEFb function in physiological and pathological conditions. (PMID:23852730)
• Integrated genome-wide genotyping and gene expression profiling reveals BCL11B as a putative oncogene in acute myeloid leukemia with 14q32 aberrations. (PMID:24441149)
• low BCL11b expression was associated with poor prognosis; particularly in the standard risk group of thymic T-cell acute lymphoblastic leukemia (PMID:25023966)
• a comprehensive review of the roles of Bcl11b in progenitors, effector T cells, regulatory T cells, and invariant NKT cells, as well as its impact on immune diseases. (PMID:25128552)
• Tax is responsible for suppressing BCL11B protein expression in HTLV-1-infected T-cells; Tax-mediated repression of BCL11B is another mechanism that Tax uses to promote oncogenesis of HTLV-1-infected T-cells. (PMID:25613934)
• BCL11B introduction in human cell lines downregulated transcription of beta-catenin target genes, whereas Bcl11b attenuation in Lgr5(+) crypt base columnar cells increased expression of beta-catenin targets including c-Myc and cyclin D1. (PMID:25827435)
• this is the first study to show that the inhibition of Bcl11b suppresses glioma cell growth by regulating the expression of the cell cycle regulator p21 and stemness-associated genes (Sox-2/Bmi-1). (PMID:26096706)
• Findings identify BCL11B Ser2 phosphorylation as a new mandatory step in the interconnected posttranslational modifications converting BCL11B from a transcriptional repressor to an activator. (PMID:27161321)
• In this present work, the authors identify and characterize a transcription factor i.e. HIC1, which physically interacts with both Bcl11b/CTIP2 and HMGA1 to co-regulate specific subsets of cellular genes and the HIV-1 tat gene. (PMID:27725726)
• studies show BCL11B is a key regulator of the initial stages of human T-cell differentiation and delineate the BCL11B transcriptional program, enabling the dissection of the underpinnings of normal T-cell differentiation and providing a resource for understanding dysregulations in T-ALL (PMID:28232744)
• BCL11B showed increased but varied expression in advanced tumor stage. Analysis of four patients receiving SAHA treatment suggested a positive correlation between BCL11B expression and favorable response to SAHA treatment. In conclusion, BCL11B may serve as a therapeutic target and a useful marker for improving HDACi efficacy in advanced CTCL. (PMID:28288848)
• Human T-cell leukemia virus type 1 (HTLV-1) Tax directly binds to BCL11B. Tax enhances BCL11B degradation through proteasome pathway. Loss of BCL11B enhances cell growth in HTLV-1-infected cells. (PMID:28669733)
• Decreased transcript and increased promoter methylation levels of BCL11B gene were identified in ankylosing spondylitis patients. (PMID:28794504)
• These results suggest that the upregulation of miR-650 contributes to the development of acute renal allograft rejection by suppression of BCL11B, which leads to apoptosis and inflammatory responses. Thus, miR-650 and BCL11B may represent potential therapeutic targets for the prevention of acute renal allograft rejection. (PMID:29039465)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	bcl11ba	ENSDARG00000062510
mus_musculus	Bcl11b	ENSMUSG00000048251
rattus_norvegicus	Bcl11b	ENSRNOG00000005776

Paralogs (14): HIVEP2 (ENSG00000010818), HIVEP1 (ENSG00000095951), SALL4 (ENSG00000101115), ZNF516 (ENSG00000101493), SALL1 (ENSG00000103449), BCL11A (ENSG00000119866), ZNF831 (ENSG00000124203), RREB1 (ENSG00000124782), HIVEP3 (ENSG00000127124), ZNF219 (ENSG00000165804), SALL2 (ENSG00000165821), ZNF217 (ENSG00000171940), ZNF536 (ENSG00000198597), SALL3 (ENSG00000256463)

Protein

Protein identifiers

B-cell lymphoma/leukemia 11B — Q9C0K0 (reviewed: Q9C0K0)

Alternative names: B-cell CLL/lymphoma 11B, COUP-TF-interacting protein 2, Radiation-induced tumor suppressor gene 1 protein

All UniProt accessions (4): Q9C0K0, D3YTK1, L8B567, L8B7P7

UniProt curated annotations — full annotation on UniProt →

Function. Key regulator of both differentiation and survival of T-lymphocytes during thymocyte development in mammals. Essential in controlling the responsiveness of hematopoietic stem cells to chemotactic signals by modulating the expression of the receptors CCR7 and CCR9, which direct the movement of progenitor cells from the bone marrow to the thymus. Is a regulator of IL2 promoter and enhances IL2 expression in activated CD4(+) T-lymphocytes. Tumor-suppressor that represses transcription through direct, TFCOUP2-independent binding to a GC-rich response element. May also function in the P53-signaling pathway.

Subunit / interactions. Interacts with TFCOUP1, SIRT1, ARP1 and EAR2. Interacts with EP300; the interaction is detected in activated T-lymphocytes, but not under resting conditions.

Subcellular location. Nucleus.

Tissue specificity. Highly expressed in brain and in malignant T-cell lines derived from patients with adult T-cell leukemia/lymphoma.

Post-translational modifications. Sumoylated with SUMO1.

Disease relevance. Immunodeficiency 49, severe combined (IMD49) [MIM:617237] A form of severe combined immunodeficiency characterized by severe T-cell lymphopenia, no detectable T-cell receptor excision circles, no naive helper CD4+ T-cells, and impaired T-cell proliferative response. In addition to primary immunodeficiency, affected individuals manifest multiple abnormal systemic features, including severe delayed psychomotor development, intellectual disability, spastic quadriplegia, and craniofacial abnormalities. The disease is caused by variants affecting the gene represented in this entry. Intellectual developmental disorder with speech delay, dysmorphic facies, and T-cell abnormalities (IDDSFTA) [MIM:618092] An autosomal dominant developmental disorder with onset in first months of life, and characterized by delayed psychomotor development with intellectual disability and speech delay. Additional features include autistic features, attention deficit-hyperactivity disorder, anxiety, and other behavioral abnormalities. Some patients suffer from recurrent infections, asthma and allergies. The disease is caused by variants affecting the gene represented in this entry.

Miscellaneous. May be due to exon skipping.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9C0K0-1	1, Alpha	yes
Q9C0K0-2	2

RefSeq proteins (4): NP_001269166, NP_001269167, NP_075049, NP_612808* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR013087	Znf_C2H2_type	Domain
IPR036236	Znf_C2H2_sf	Homologous_superfamily
IPR051497	Dev/Hematopoietic_TF	Family
IPR056438	Znf-C2H2_CTCF	Domain
IPR057448	BCL-11A_Znf_CCHC	Domain

Pfam: PF00096, PF23611, PF25491

UniProt features (57 total): modified residue 25, compositionally biased region 7, cross-link 7, zinc finger region 6, sequence variant 6, region of interest 4, chain 1, splice variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9C0K0-F1	51.76	0.01

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (32): 97, 110, 120, 129, 256, 260, 277, 293, 322, 358, 376, 381, 398, 401, 406, 417, 483, 488, 496, 497 …

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-9933946	Formation of the embryonic stem cell BAF (esBAF) complex
R-HSA-9934037	Formation of neuronal progenitor and neuronal BAF (npBAF and nBAF)

MSigDB gene sets: 619 (showing top): GSE18804_SPLEEN_MACROPHAGE_VS_BRAIN_TUMORAL_MACROPHAGE_UP, TGGTGCT_MIR29A_MIR29B_MIR29C, AGGAAGC_MIR5163P, RRAGTTGT_UNKNOWN, GOBP_EPITHELIUM_DEVELOPMENT, FREAC2_01, TAATAAT_MIR126, WALLACE_PROSTATE_CANCER_RACE_UP, WANG_CLIM2_TARGETS_UP, HNF3ALPHA_Q6, STAEGE_EWING_FAMILY_TUMOR, GOBP_EPITHELIAL_CELL_DEVELOPMENT, JAEGER_METASTASIS_DN, LFA1_Q6, GOBP_KERATINOCYTE_PROLIFERATION

GO Biological Process (31): keratinocyte development (GO:0003334), epithelial cell morphogenesis (GO:0003382), transcription by RNA polymerase II (GO:0006366), negative regulation of cell population proliferation (GO:0008285), regulation of keratinocyte proliferation (GO:0010837), regulation of lipid metabolic process (GO:0019216), striatal medium spiny neuron differentiation (GO:0021773), commitment of neuronal cell to specific neuron type in forebrain (GO:0021902), post-embryonic camera-type eye development (GO:0031077), T cell differentiation in thymus (GO:0033077), T cell receptor V(D)J recombination (GO:0033153), hematopoietic stem cell migration (GO:0035701), odontogenesis of dentin-containing tooth (GO:0042475), positive T cell selection (GO:0043368), regulation of neuron differentiation (GO:0045664), positive regulation of transcription by RNA polymerase II (GO:0045944), alpha-beta T cell differentiation (GO:0046632), thymus development (GO:0048538), thymocyte apoptotic process (GO:0070242), negative regulation of thymocyte apoptotic process (GO:0070244), olfactory bulb axon guidance (GO:0071678), lymphoid lineage cell migration into thymus (GO:0097535), regulation of transcription by RNA polymerase II (GO:0006357), apoptotic process (GO:0006915), axonogenesis (GO:0007409), post-embryonic development (GO:0009791), regulation of gene expression (GO:0010468), central nervous system neuron differentiation (GO:0021953), skin development (GO:0043588), T cell apoptotic process (GO:0070231), negative regulation of T cell apoptotic process (GO:0070233)

GO Molecular Function (8): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription activator activity, RNA polymerase II-specific (GO:0001228), DNA-binding transcription factor activity (GO:0003700), zinc ion binding (GO:0008270), sequence-specific double-stranded DNA binding (GO:1990837), protein binding (GO:0005515), sequence-specific DNA binding (GO:0043565), metal ion binding (GO:0046872)

GO Cellular Component (4): nucleus (GO:0005634), nucleoplasm (GO:0005654), SWI/SNF complex (GO:0016514), neuron projection (GO:0043005)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
SWI/SNF chromatin remodelers	2

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
epithelial cell development	2
T cell differentiation	2
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
keratinocyte differentiation	1
cell morphogenesis	1
DNA-templated transcription	1
cell population proliferation	1
regulation of cell population proliferation	1
negative regulation of cellular process	1
keratinocyte proliferation	1
regulation of epithelial cell proliferation	1
lipid metabolic process	1
regulation of primary metabolic process	1
striatum development	1
forebrain neuron differentiation	1
GABAergic neuron differentiation	1
forebrain neuron fate commitment	1
post-embryonic development	1
camera-type eye development	1
somatic recombination of T cell receptor gene segments	1
V(D)J recombination	1
cell migration	1
odontogenesis	1
T cell selection	1
neuron differentiation	1
regulation of cell differentiation	1
regulation of transcription by RNA polymerase II	1
transcription by RNA polymerase II	1
positive regulation of DNA-templated transcription	1
alpha-beta T cell activation	1
hematopoietic or lymphoid organ development	1
gland development	1
T cell apoptotic process	1
negative regulation of T cell apoptotic process	1
thymocyte apoptotic process	1
regulation of thymocyte apoptotic process	1
cis-regulatory region sequence-specific DNA binding	1
DNA-binding transcription factor activity, RNA polymerase II-specific	1
DNA-binding transcription activator activity	1
positive regulation of transcription by RNA polymerase II	1

Protein interactions and networks

STRING

2370 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
BCL11B	NR2F1	P10589	982
BCL11B	SUV39H1	O43463	924
BCL11B	HEXIM1	O94992	918
BCL11B	NR2F2	P24468	897
BCL11B	TBR1	Q16650	883
BCL11B	SATB2	Q9UPW6	843
BCL11B	HDAC1	Q13547	836
BCL11B	CUX1	P39880	819
BCL11B	TLX3	O43711	812
BCL11B	RANBP17	Q9H2T7	754
BCL11B	EOMES	O95936	741
BCL11B	LYL1	P12980	727
BCL11B	HDAC2	Q92769	721
BCL11B	PAX6	P26367	703
BCL11B	ARID2	Q68CP9	695

IntAct

24 interactions, top by confidence:

A	B	Type	Score
RBBP4	CDK2AP1	psi-mi:“MI:0914”(association)	0.790
HDAC1	BCL11B	psi-mi:“MI:0915”(physical association)	0.700
HDAC2	BCL11B	psi-mi:“MI:0915”(physical association)	0.700
BCL11B	HDAC2	psi-mi:“MI:0403”(colocalization)	0.700
HDAC1	BCL11B	psi-mi:“MI:0403”(colocalization)	0.700
TAL1	KDM1A	psi-mi:“MI:0914”(association)	0.560
BCL11B	SUV39H1	psi-mi:“MI:0915”(physical association)	0.560
SUV39H1	BCL11B	psi-mi:“MI:0915”(physical association)	0.560
BCL11B	SUV39H1	psi-mi:“MI:0403”(colocalization)	0.560
RBBP4	TNRC18	psi-mi:“MI:0914”(association)	0.530
NOTCH1	RBBP4	psi-mi:“MI:0914”(association)	0.460
BCL11B	HDAC3	psi-mi:“MI:0915”(physical association)	0.400
NOTCH1	CNOT1	psi-mi:“MI:0914”(association)	0.350
NEK4	E2F8	psi-mi:“MI:0914”(association)	0.350
BCL11B	MTA2	psi-mi:“MI:0914”(association)	0.350
BCL11B	CDK2AP1	psi-mi:“MI:0914”(association)	0.350
	PHF20L1	psi-mi:“MI:0914”(association)	0.350
HDAC1	KPNA3	psi-mi:“MI:0914”(association)	0.350
HDAC2	IPO5	psi-mi:“MI:0914”(association)	0.350
HDAC6	SEC16A	psi-mi:“MI:0914”(association)	0.350
AIM2	DDX39A	psi-mi:“MI:0914”(association)	0.350
SOX7	NFIB	psi-mi:“MI:2364”(proximity)	0.270
FHIP1B	MED19	psi-mi:“MI:2364”(proximity)	0.270

BioGRID (129): BCL11B (Affinity Capture-MS), BCL11B (Affinity Capture-MS), BCL11B (Affinity Capture-MS), BCL11B (Affinity Capture-MS), BCL11B (Affinity Capture-MS), BCL11B (Affinity Capture-Western), BCL11B (Affinity Capture-MS), BCL11B (Affinity Capture-MS), BCL11B (Co-localization), BCL11B (FRET), DDB1 (Affinity Capture-Western), VPRBP (Affinity Capture-Western), BCL11B (Affinity Capture-Western), BCL11B (Affinity Capture-MS), BCL11B (Affinity Capture-MS)

ESM2 similar proteins: A0PJY2, A1YPR0, A2A935, B0K011, B0X9H6, B7ZRU9, O13089, O15090, O15156, O75626, O88939, O93567, O95365, P14404, P25932, P41183, P56260, Q03112, Q08DS3, Q0IHB8, Q1L8W0, Q2VWH6, Q32NK7, Q3T135, Q5XJQ7, Q60636, Q64321, Q6AY34, Q6DBW0, Q6F2E4, Q802Y8, Q8I7Z8, Q8K083, Q8N9L1, Q8NAP8, Q8TBJ5, Q8VCZ7, Q8VDL9, Q98T94, Q99PV8

Diamond homologs: A0A1V6NWD3, A0A2H1A5W4, A1L2U9, B0XS89, B1WAZ8, B1WBU4, P53243, P56270, P56670, P56671, P78871, Q00453, Q0IH98, Q0VCJ6, Q12132, Q4WXK4, Q6P882, Q96BR9, Q99PV8, Q9C0K0, Q9CWH1, Q9H165, Q9QYE3, Q9UPG8, Q9US36, Q9UTS5, A2A884, A2ANX9, A7Y7X5, B0X9H6, B0YDH7, E9PW05, E9PZZ1, G5EBU4, O15391, O60315, O62836, O75362, O77459, O95863

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
NOTCH1	“up-regulates quantity by expression”	BCL11B	“transcriptional regulation”
SATB2	“down-regulates quantity”	BCL11B	“transcriptional regulation”

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 25 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Notch-HLH transcription pathway	5	92.7×	9e-08
NOTCH1 Intracellular Domain Regulates Transcription	5	54.1×	9e-07
Regulation of PTEN gene transcription	6	48.7×	9e-08
Differentiation of naive CD4+ T cells to T helper 2 cells (Th2 cells)	7	46.6×	1e-08
Constitutive Signaling by NOTCH1 PEST Domain Mutants	5	44.8×	2e-06
Constitutive Signaling by NOTCH1 HD+PEST Domain Mutants	5	44.8×	2e-06
HDACs deacetylate histones	6	32.8×	8e-07
NuRD complex assembly	5	32.0×	6e-06

Disease & clinical

Cancer significance

From intOGen — cancer-driver classification: activating (oncogene-like) across 3 cancer types — DLBCLNOS, GBM, VULVA.

Clinical variants and AI predictions

ClinVar

949 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	36
Likely pathogenic	30
Uncertain significance	420
Likely benign	371
Benign	36

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1177342	NM_138576.4(BCL11B):c.211del (p.Leu71fs)	Pathogenic
1184944	NM_138576.4(BCL11B):c.1916_1917dup (p.Gly640fs)	Pathogenic
1275761	NM_138576.4(BCL11B):c.1887_1893del (p.Gly630fs)	Pathogenic
1292046	NM_138576.4(BCL11B):c.427+1G>A	Pathogenic
1292051	NM_138576.4(BCL11B):c.2448_2461dup (p.Glu821fs)	Pathogenic
1342021	NM_138576.4(BCL11B):c.1662_1668del (p.Ser555fs)	Pathogenic
1698957	NM_138576.4(BCL11B):c.1272_1278del (p.Lys425fs)	Pathogenic
1708342	NM_138576.4(BCL11B):c.1380C>A (p.Cys460Ter)	Pathogenic
1801832	NM_138576.4(BCL11B):c.2605del (p.Leu869fs)	Pathogenic
1804880	NM_138576.4(BCL11B):c.2443del (p.Arg815fs)	Pathogenic
2430038	NM_138576.4(BCL11B):c.784_820del (p.Arg262fs)	Pathogenic
2442366	NM_138576.4(BCL11B):c.1216_1219dup (p.Pro407fs)	Pathogenic
254673	NM_138576.4(BCL11B):c.1323T>G (p.Asn441Lys)	Pathogenic
2663815	NM_138576.4(BCL11B):c.1852C>T (p.Gln618Ter)	Pathogenic
3346986	NM_138576.4(BCL11B):c.756_765del (p.Gly253fs)	Pathogenic
3764131	NM_138576.4(BCL11B):c.2476T>C (p.Cys826Arg)	Pathogenic
3897620	NM_138576.4(BCL11B):c.2224_2227dup (p.His743fs)	Pathogenic
4531491	NM_138576.4(BCL11B):c.658_706del (p.Ser220fs)	Pathogenic
520552	NM_138576.4(BCL11B):c.721C>T (p.Gln241Ter)	Pathogenic
520816	NM_138576.4(BCL11B):c.238C>T (p.Gln80Ter)	Pathogenic
521135	NM_138576.4(BCL11B):c.1192_1196dup (p.Lys400fs)	Pathogenic
560175	NM_138576.4(BCL11B):c.2449_2456dup (p.Gly820fs)	Pathogenic
560176	NM_138576.4(BCL11B):c.2671del (p.Ala891fs)	Pathogenic
560177	NM_138576.4(BCL11B):c.242del (p.Cys81fs)	Pathogenic
560178	NM_138576.4(BCL11B):c.1495G>T (p.Glu499Ter)	Pathogenic
57812	GRCh38/hg38 14q32.2(chr14:96920270-100178956)x1	Pathogenic
807549	NM_138576.4(BCL11B):c.2048del (p.Ser683fs)	Pathogenic
807550	NM_138576.4(BCL11B):c.1500dup (p.Gly501fs)	Pathogenic
817183	NM_138576.4(BCL11B):c.81dup (p.Ala28fs)	Pathogenic
817648	NM_138576.4(BCL11B):c.1743_1746del (p.Gly582fs)	Pathogenic

SpliceAI

1873 predictions. Top by Δscore:

Variant	Effect	Δscore
14:99257465:CCATA:C	donor_loss	1.0000
14:99257466:CATA:C	donor_loss	1.0000
14:99257467:ATAC:A	donor_loss	1.0000
14:99257468:TACCT:T	donor_loss	1.0000
14:99257469:AC:A	donor_loss	1.0000
14:99257470:CCTGC:C	donor_loss	1.0000
14:99271159:A:AC	donor_gain	1.0000
14:99271160:C:CA	donor_gain	1.0000
14:99271160:CG:C	donor_gain	1.0000
14:99271160:CGG:C	donor_gain	1.0000
14:99176193:TACCT:T	acceptor_loss	0.9900
14:99176194:ACC:A	acceptor_loss	0.9900
14:99176195:CCT:C	acceptor_loss	0.9900
14:99176196:CTG:C	acceptor_loss	0.9900
14:99176197:T:A	acceptor_loss	0.9900
14:99196250:TGTA:T	donor_gain	0.9900
14:99257835:CTCTG:C	acceptor_gain	0.9900
14:99257837:CTG:C	acceptor_gain	0.9900
14:99257847:C:CT	acceptor_gain	0.9900
14:99257848:A:T	acceptor_gain	0.9900
14:99271157:TTA:T	donor_loss	0.9900
14:99271158:TACG:T	donor_loss	0.9900
14:99271159:ACGGG:A	donor_loss	0.9900
14:99271160:C:A	donor_loss	0.9900
14:99271160:CGGG:C	donor_gain	0.9900
14:99271160:CGGGT:C	donor_gain	0.9900
14:99257836:TCTGC:T	acceptor_gain	0.9800
14:99257838:TG:T	acceptor_gain	0.9800
14:99257840:C:CC	acceptor_gain	0.9800
14:99271173:C:CA	donor_gain	0.9800

AlphaMissense

5857 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
14:99174208:C:A	W876C	1.000
14:99174208:C:G	W876C	1.000
14:99174210:A:G	W876R	1.000
14:99174210:A:T	W876R	1.000
14:99174220:G:C	H872Q	1.000
14:99174220:G:T	H872Q	1.000
14:99174221:T:C	H872R	1.000
14:99174221:T:G	H872P	1.000
14:99174222:G:C	H872D	1.000
14:99174222:G:T	H872N	1.000
14:99174230:A:G	L869P	1.000
14:99174247:G:C	F863L	1.000
14:99174247:G:T	F863L	1.000
14:99174248:A:C	F863C	1.000
14:99174248:A:G	F863S	1.000
14:99174249:A:G	F863L	1.000
14:99174249:A:T	F863I	1.000
14:99174259:G:C	C859W	1.000
14:99174260:C:A	C859F	1.000
14:99174260:C:G	C859S	1.000
14:99174260:C:T	C859Y	1.000
14:99174261:A:G	C859R	1.000
14:99174261:A:T	C859S	1.000
14:99174268:G:C	C856W	1.000
14:99174269:C:A	C856F	1.000
14:99174269:C:G	C856S	1.000
14:99174269:C:T	C856Y	1.000
14:99174270:A:G	C856R	1.000
14:99174270:A:T	C856S	1.000
14:99174276:A:C	Y854D	1.000

dbSNP variants (sampled 300 via entrez): RS1000005471 (14:99250592 A>C), RS1000012904 (14:99259498 T>C), RS1000038879 (14:99175602 T>C,G), RS1000057178 (14:99180276 C>G), RS1000075262 (14:99244183 C>G,T), RS1000129771 (14:99171313 C>T), RS1000196459 (14:99216814 C>T), RS1000235076 (14:99178522 C>T), RS1000277050 (14:99182576 T>A,C), RS1000277562 (14:99269952 A>G), RS1000285159 (14:99183588 C>T), RS1000321747 (14:99221566 A>C), RS1000327463 (14:99271305 TGCCGCCGCTGCCGCCGCCGCCGCCGCCGCC>T,TGCC,TGCCGCC,TGCCGCCGCTGCCGCCGCCGCCGCCGCCGCCGCTGCCGCCGCCGCCGCCGCCGCC), RS1000336263 (14:99222144 T>A), RS1000345562 (14:99262007 C>A,T)

Disease associations

OMIM: gene MIM:606558 | disease phenotypes: MIM:617237, MIM:618092, MIM:620931

GenCC curated gene-disease

Disease	Classification	Inheritance
intellectual developmental disorder with speech delay, dysmorphic facies, and t-cell abnormalities	Definitive	Autosomal dominant
immunodeficiency 49	Strong	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
intellectual developmental disorder with speech delay, dysmorphic facies, and t-cell abnormalities	Definitive	AD

Mondo (7): immunodeficiency 49 (MONDO:0014981), intellectual developmental disorder with speech delay, dysmorphic facies, and t-cell abnormalities (MONDO:0060763), microcephaly (MONDO:0001149), autism spectrum disorder (MONDO:0005258), combined immunodeficiency (MONDO:0015131), intellectual disability (MONDO:0001071), immunodeficiency 126, susceptibility to (MONDO:0975761)

Orphanet (4): Intellectual disability-speech delay-dysmorphic features-T cell abnormalities syndrome (Orphanet:662829), Combined T and B cell immunodeficiency (Orphanet:101972), NON RARE IN EUROPE: Autism (Orphanet:106), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

54 total (30 of 54 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000160	Narrow mouth
HP:0000219	Thin upper lip vermilion
HP:0000286	Epicanthus
HP:0000316	Hypertelorism
HP:0000322	Short philtrum
HP:0000343	Long philtrum
HP:0000347	Micrognathia
HP:0000358	Posteriorly rotated ears
HP:0000448	Prominent nose
HP:0000540	Hypermetropia
HP:0000545	Myopia
HP:0000582	Upslanted palpebral fissure
HP:0000668	Hypodontia
HP:0000677	Oligodontia
HP:0000691	Microdontia
HP:0000695	Natal tooth
HP:0000729	Autistic behavior
HP:0000739	Anxiety
HP:0000750	Delayed speech and language development
HP:0000973	Cutis laxa
HP:0001007	Hirsutism
HP:0001249	Intellectual disability
HP:0001250	Seizure
HP:0001252	Hypotonia
HP:0001257	Spasticity
HP:0001263	Global developmental delay
HP:0001270	Motor delay
HP:0001274	Agenesis of corpus callosum
HP:0001290	Generalized hypotonia

GWAS associations

26 associations (top):

Study	Trait	p-value
GCST001317_1	Aortic stiffness	3.000000e-15
GCST001680_7	Corneal curvature	7.000000e-06
GCST002440_4	Staphylococcus aureus infection	8.000000e-07
GCST002539_22	Schizophrenia	5.000000e-09
GCST002794_19	Airway wall thickness	6.000000e-06
GCST004946_104	Schizophrenia	2.000000e-08
GCST006273_1	Diastolic blood pressure night-to-day ratio in hypertension	2.000000e-06
GCST006274_1	Systolic blood pressure night-to-day ratio in hypertension	1.000000e-08
GCST006803_37	Schizophrenia	2.000000e-08
GCST007201_189	Schizophrenia	5.000000e-08
GCST007201_323	Schizophrenia	3.000000e-08
GCST007324_79	Adventurousness	4.000000e-09
GCST008103_33	Bipolar disorder	5.000000e-08
GCST009391_1687	Metabolite levels	5.000000e-06
GCST009600_64	Anorexia nervosa, attention-deficit/hyperactivity disorder, autism spectrum disorder, bipolar disorder, major depression, obsessive-compulsive disorder, schizophrenia, or Tourette syndrome (pleiotropy)	3.000000e-10
GCST010703_239	Brain morphology (MOSTest)	4.000000e-12
GCST010988_545	Adult body size	4.000000e-08
GCST011742_66	Triglyceride levels in HIV infection	7.000000e-06
GCST012004_3	Posterior thalamic nuclei volume	2.000000e-10
GCST012010_3	Medial thalamic nuclei volume	3.000000e-09
GCST012052_7	Waist circumference	7.000000e-08
GCST012206_3	Proximal colorectal cancer	9.000000e-11
GCST012465_29	Bipolar disorder	2.000000e-08
GCST90002383_263	Hematocrit	4.000000e-13
GCST90002384_372	Hemoglobin	3.000000e-12
GCST90002403_518	Red blood cell count	3.000000e-14

EFO canonical traits (13, from GWAS)

EFO ID	Trait name
EFO:0004724	carotid-femoral pulse wave velocity
EFO:0004345	corneal topography
EFO:0006898	airway wall thickness measurement
EFO:0006945	diastolic blood pressure change measurement
EFO:0006944	systolic blood pressure change measurement
EFO:0008579	risk-taking behaviour
EFO:0010343	cholesteryl ester 18:0 measurement
EFO:0004346	neuroimaging measurement
EFO:0004530	triglyceride measurement
EFO:0006935	thalamus volume
EFO:0004348	hematocrit
EFO:0004509	hemoglobin measurement
EFO:0004305	erythrocyte count

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D008831	Microcephaly	C05.660.207.620; C10.500.507.400.500; C16.131.621.207.620; C16.131.666.507.400.500

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

26 total (human), top 26 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases expression, affects expression, increases methylation, affects cotreatment	6
Benzo(a)pyrene	increases expression, increases methylation, affects methylation	3
Silicon Dioxide	decreases expression	2
triphenyl phosphate	affects expression	1
bisphenol A	decreases methylation	1
trichostatin A	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
sodium arsenite	affects methylation	1
ethylene dichloride	increases expression	1
benzo(e)pyrene	increases methylation	1
ferrous chloride	decreases expression	1
aflatoxin B2	increases methylation	1
hydroquinone	decreases expression	1
monomethylarsonous acid	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
Air Pollutants	increases abundance, increases expression	1
Calcitriol	decreases expression	1
Ethyl Methanesulfonate	decreases expression	1
Methapyrilene	increases methylation	1
Methyl Methanesulfonate	decreases expression	1
Rotenone	decreases expression	1
Tobacco Smoke Pollution	decreases expression	1
Antirheumatic Agents	decreases expression	1
Okadaic Acid	increases expression	1
Particulate Matter	increases abundance, increases expression	1

Cellosaurus cell lines

127 cell lines: 126 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_0138	ACH-2	Cancer cell line	Female
CVCL_0207	CCRF-CEM	Cancer cell line	Female
CVCL_0R18	CEM-TART clone 1A2	Cancer cell line	Female
CVCL_0U11	CEM/MX1	Cancer cell line	Female
CVCL_1B35	CEM/VM-1	Cancer cell line	Female
CVCL_1E04	Rev-CEM	Cancer cell line	Female
CVCL_1G53	CEM-GFP	Cancer cell line	Female
CVCL_1G54	EGFP-CEM-NKr	Cancer cell line	Female
CVCL_2022	DND-41	Cancer cell line	Male
CVCL_2265	1301	Cancer cell line	Female

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00391261	PHASE4	COMPLETED	An Open-label Trial of Metformin for Weight Control of Pediatric Patients on Antipsychotic Medications.
NCT01028820	PHASE4	COMPLETED	FMRI Brain Activation of Aripiprazole Treatment in Autism Spectrum Disorders
NCT01333865	PHASE4	COMPLETED	A Study of Memantine Hydrochloride (Namenda®) for Cognitive and Behavioral Impairment in Adults With Autism Spectrum Disorders
NCT01337700	PHASE4	COMPLETED	Milnacipran in Autism and the Functional Locus Coeruleus and Noradrenergic Model of Autism
NCT01695200	PHASE4	COMPLETED	Omega-3 Fatty Acids in Autism Spectrum Disorders
NCT02096952	PHASE4	COMPLETED	Methylphenidate ER Liquid Formulation in Adults With ASD and ADHD
NCT02235467	PHASE4	COMPLETED	Multisite Study: Parental Training Using Video Modelling to Develop Social Skills in Children With Autism
NCT02940574	PHASE4	COMPLETED	Neural and Behavioral Effects of Oxytocin in Autism Spectrum Disorders
NCT03333629	PHASE4	COMPLETED	Promoting Positive Outcomes for Individuals With ASD: Linking Early Detection, Treatment, and Long-term Outcomes
NCT03337646	PHASE4	COMPLETED	Evaluation of the Effect and Safety of Lisdexamfetamine in Children Aged 6-12 With ADHD and Autism
NCT03538431	PHASE4	COMPLETED	Improving Driving in Young People With Autism Spectrum Disorders
NCT03757585	PHASE4	COMPLETED	Natural Treatments for the Management of Emotional Dysregulation in Youth With Non-verbal Learning Disability (NVLD) and/or Autism Spectrum Disorders (ASD)
NCT04903353	PHASE4	COMPLETED	Pragmatic Trial Comparing Weight Gain in Children With Autism Taking Risperidone Versus Aripiprazole
NCT05063656	PHASE4	COMPLETED	Biomarker-Driven Pharmacological Treatment of Adolescents With Autism Spectrum Disorder With Gabapentin
NCT05146245	PHASE4	UNKNOWN	Safety and Pharmacokinetics of Antipsychotics in Children 2: Studying TDM in an RCT
NCT05916339	PHASE4	RECRUITING	AWARE: Management of ADHD in Autism Spectrum Disorder
NCT05954052	PHASE4	TERMINATED	A Study of Glutathione in Children With Autism Spectrum Disorder
NCT06853665	PHASE4	RECRUITING	The TEAM Study - Treatment Efficacy for Autism/Attention Using Mixed Amphetamine
NCT07054697	PHASE4	COMPLETED	Pilot-RCT With Individualized Homeopathic Treatment in the Children With Autism Spectrum Disorder
NCT07161804	PHASE4	COMPLETED	Pilot RCT Using Homeopathic Medicines in ASD
NCT07439042	PHASE4	NOT_YET_RECRUITING	Buspirone for Anxiety in Autistic Youth
NCT01302964	PHASE3	COMPLETED	Mirtazapine Treatment of Anxiety in Children and Adolescents With Pervasive Developmental Disorders
NCT01706523	PHASE3	TERMINATED	Open Label Extension Study of STX209 (Arbaclofen) in Autism Spectrum Disorders
NCT01825798	PHASE3	COMPLETED	Treatment of Overweight Induced by Antipsychotic Medication in Young People With Autism Spectrum Disorders (ASD)
NCT01972074	PHASE3	COMPLETED	Behavioral and Neural Response to Memantine in Adolescents With Autism Spectrum Disorder
NCT02985749	PHASE3	COMPLETED	A Study of Oxytocin for the Treatment of Social Impairment in Individuals With High Functioning Autism Spectrum Disorder
NCT03197922	PHASE3	COMPLETED	Treatment of Encopresis in Children With Autism Spectrum Disorders
NCT03504917	PHASE3	TERMINATED	A Study of Balovaptan in Adults With Autism Spectrum Disorder With a 2-Year Open-Label Extension
NCT03553875	PHASE3	TERMINATED	Memantine for the Treatment of Social Deficits in Youth With Disorders of Impaired Social Interactions
NCT03640156	PHASE3	COMPLETED	Modulating Socially Adaptive Mirror System Functioning in Autism by Oxytocin
NCT03715153	PHASE3	TERMINATED	Efficacy and Safety of Bumetanide Oral Liquid Formulation in Children Aged From 2 to Less Than 7 Years Old With Autism Spectrum Disorder.
NCT03715166	PHASE3	TERMINATED	Efficacy and Safety of Bumetanide Oral Liquid Formulation in Children and Adolescents Aged From 7 to Less Than 18 Years Old With Autism Spectrum Disorder
NCT04233502	PHASE3	WITHDRAWN	Efficacy and Safety of Slenyto for Insomnia in Children With ASD
NCT04578756	PHASE3	COMPLETED	Open-Label, Flexible-dose Study to Evaluate the Long-Term Safety and Tolerability of Cariprazine in the Treatment of Pediatric Participants With Schizophrenia, Bipolar I Disorder, or Autism Spectrum Disorder
NCT04623398	PHASE3	COMPLETED	Effect of Lithium in Patients With Autism Spectrum Disorder and Phelan-McDermid Syndrome (SHANK3 Haploinsufficiency)
NCT04725383	PHASE3	TERMINATED	Amitriptyline for Repetitive Behaviors in Autism Spectrum Disorders
NCT05212493	PHASE3	COMPLETED	The Effects of Medical Cannabis in Children With Autistic Spectrum Disorder
NCT05361707	PHASE3	UNKNOWN	Evaluating the Effects of Tasimelteon in Individuals With Autism Spectrum Disorder (ASD) and Sleep Disturbances
NCT05439616	PHASE3	COMPLETED	Study of Cariprazine Oral Capsules or Solution to Assess Adverse Events and Change in Irritability Due to Autism Spectrum Disorder (ASD) in Participants Aged 5-17 Years With ASD
NCT06229210	PHASE3	RECRUITING	Safety and Tolerability Trial of Lumateperone in Pediatric Patients With Schizophrenia, Bipolar Disorder or Autism Spectrum Disorder