BCOR

Summary

BCOR (BCL6 corepressor, HGNC:20893) is a protein-coding gene on chromosome Xp11.4, encoding BCL-6 corepressor (Q6W2J9). Transcriptional corepressor. It is haploinsufficient (ClinGen: sufficient evidence).

The protein encoded by this gene was identified as an interacting corepressor of BCL6, a POZ/zinc finger transcription repressor that is required for germinal center formation and may influence apoptosis. This protein selectively interacts with the POZ domain of BCL6, but not with eight other POZ proteins. Specific class I and II histone deacetylases (HDACs) have been shown to interact with this protein, which suggests a possible link between the two classes of HDACs. Several transcript variants encoding different isoforms have been found for this gene. A pseudogene of this gene is found on chromosome Y.

Source: NCBI Gene 54880 — RefSeq curated summary.

At a glance

• Gene–disease (curated): microphthalmia, syndromic 2 (Definitive, ClinGen) — +1 more curated relationship
• GWAS associations: 4
• Clinical variants (ClinVar): 895 total — 80 pathogenic, 36 likely-pathogenic
• Phenotypes (HPO): 193
• Druggable target: yes
• Cancer driver (intOGen): loss-of-function (tumor-suppressor-like) across 18 cancer types
• Dosage sensitivity (ClinGen): haploinsufficiency sufficient evidence, triplosensitivity no evidence
• MANE Select transcript: NM_001123385

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:20893
Approved symbol	BCOR
Name	BCL6 corepressor
Location	Xp11.4
Locus type	gene with protein product
Status	Approved
Aliases	FLJ20285, KIAA1575
Ensembl gene	ENSG00000183337
Ensembl biotype	protein_coding
OMIM	300485
Entrez	54880

Gene structure

Transcript identifiers

Ensembl transcripts: 30 — 27 protein_coding, 2 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000342274, ENST00000378444, ENST00000378455, ENST00000378463, ENST00000397354, ENST00000406200, ENST00000412952, ENST00000413905, ENST00000427012, ENST00000442018, ENST00000490976, ENST00000615339, ENST00000672265, ENST00000672922, ENST00000673391, ENST00000679513, ENST00000680831, ENST00000907727, ENST00000907728, ENST00000907729, ENST00000937651, ENST00000937652, ENST00000937653, ENST00000937654, ENST00000937655, ENST00000937656, ENST00000937657, ENST00000937658, ENST00000937659, ENST00000937660

RefSeq mRNA: 4 — MANE Select: NM_001123385 NM_001123383, NM_001123384, NM_001123385, NM_017745

CCDS: CCDS14250, CCDS48092, CCDS48093

Canonical transcript exons

ENST00000378444 — 15 exons

Exon	Start	End
ENSE00001290210	40055368	40055513
ENSE00001290580	40053886	40054042
ENSE00001296350	40062139	40062393
ENSE00001308881	40057155	40057321
ENSE00001311651	40054256	40054333
ENSE00001317352	40062746	40063071
ENSE00001477563	40063608	40063952
ENSE00001619092	40072349	40075180
ENSE00001645302	40070973	40071159
ENSE00001778196	40071637	40071690
ENSE00003524627	40077844	40077969
ENSE00003575718	40064336	40064599
ENSE00003683154	40076454	40076532
ENSE00003889721	40097215	40097958
ENSE00003890008	40051251	40052400

Expression profiles

Bgee: expression breadth ubiquitous, 265 present calls, max score 95.97.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 36.2778 / max 527.0606, expressed in 1806 samples.

FANTOM5 promoters (9 alternative TSS)

Promoter ID	TPM avg	Samples expressed
198932	30.6177	1788
198937	1.8822	749
198933	1.4491	836
198929	1.3084	714
198936	0.7103	382
198941	0.1155	37
198928	0.0865	26
198934	0.0787	29
198935	0.0293	10

Top tissues by expression

279 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
buccal mucosa cell	CL:0002336	95.97	gold quality
ganglionic eminence	UBERON:0004023	94.01	gold quality
cortical plate	UBERON:0005343	92.12	gold quality
ventricular zone	UBERON:0003053	91.64	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	89.78	gold quality
tibial artery	UBERON:0007610	89.20	gold quality
popliteal artery	UBERON:0002250	89.17	gold quality
aorta	UBERON:0000947	87.40	gold quality
lower esophagus mucosa	UBERON:0035834	87.14	gold quality
gastrocnemius	UBERON:0001388	86.72	gold quality
hindlimb stylopod muscle	UBERON:0004252	86.60	gold quality
muscle of leg	UBERON:0001383	86.39	gold quality
left ovary	UBERON:0002119	86.38	gold quality
islet of Langerhans	UBERON:0000006	86.36	gold quality
descending thoracic aorta	UBERON:0002345	86.34	gold quality
embryo	UBERON:0000922	86.31	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	86.24	gold quality
ovary	UBERON:0000992	85.99	gold quality
right ovary	UBERON:0002118	85.91	gold quality
right coronary artery	UBERON:0001625	85.66	gold quality
left lobe of thyroid gland	UBERON:0001120	85.54	gold quality
tonsil	UBERON:0002372	85.52	gold quality
adenohypophysis	UBERON:0002196	85.51	gold quality
muscle layer of sigmoid colon	UBERON:0035805	85.49	gold quality
ascending aorta	UBERON:0001496	85.33	gold quality
amniotic fluid	UBERON:0000173	85.29	gold quality
right lobe of thyroid gland	UBERON:0001119	85.24	gold quality
thoracic aorta	UBERON:0001515	85.19	gold quality
sural nerve	UBERON:0015488	85.11	gold quality
thyroid gland	UBERON:0002046	85.06	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	6.01

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

7 targets.

Target	Regulation
ARID3A
BMI1
GLI1
HOXA5	Repression
HOXA7	Repression
HOXA9	Repression
IRF4

Upstream regulators (CollecTRI, top): KDM2A, MBD2, NCOR2

miRNA regulators (miRDB)

157 targeting BCOR, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-30A-5P	100.00	76.31	3233
HSA-MIR-30B-5P	100.00	76.29	3248
HSA-MIR-30C-5P	100.00	76.29	3248
HSA-MIR-30D-5P	100.00	76.32	3233
HSA-MIR-30E-5P	100.00	76.32	3242
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-4768-5P	100.00	69.49	2861
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-10401-5P	99.99	65.79	948
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-485-3P	99.98	70.68	1585
HSA-MIR-539-3P	99.98	70.74	1616
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-548N	99.98	71.94	4170
HSA-MIR-27A-3P	99.98	72.13	2955
HSA-MIR-27B-3P	99.98	72.13	2955
HSA-MIR-9985	99.98	72.11	2939
HSA-MIR-4803	99.98	71.99	3117
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-3658	99.96	73.87	4379
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345

Functional genomics

ClinGen dosage: haploinsufficiency 3 (sufficient evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 40)

• Function:BCoR is a transcriptional corepressor for BCL-6. Nomenclature:BCoR (BCL-6 corepressor) (PMID:10898795)
• The forkhead transcription factor AFX activates apoptosis by induction of the BCL-6 transcriptional repressor. (PMID:11777915)
• role as a key transcriptional regulator during early embryogenesis (PMID:15004558)
• data confirm that BCOR is the causative gene for oculo-facio-cardio-dental syndrome, two small deletions (c.2488_2489delAG and c.3286delG) and a submicroscopic deletion of about 60 kb encompassing at least BCOR exons 2-15. (PMID:15770227)
• BCOR complex components and mono-ubiquitylated H2A localize to BCL6 targets, indicating that the BCOR complex employs Polycomb Group proteins to expand the repertoire of enzymatic activities that can be recruited by BCL6. (PMID:16943429)
• BCOR left-sided embryonic expression is required for vertebrate laterality determination (PMID:17517692)
• The structure of a BCOR corepressor peptide in complex with the BCL6 BTB domain dimer is reported. (PMID:18280243)
• Data show that AP-2alpha was identified as a repressive target of BCOR, and BCOR mutation resulted in abnormal activation of AP-2alpha. (PMID:19578371)
• BCOR is a fusion partner of retinoic acid receptor alpha in a t(X;17)(p11;q12) variant of acute promyelocytic leukemia. BCOR-RARA possesses common features with other RARA fusion proteins. (PMID:20807888)
• Our results for the first time implicate BCOR in normal karyotype acute myeloid leukemia pathogenesis. (PMID:22012066)
• the mutation in BCOR is likely to be the major determinant for the phenotypes in this Oculofaciocardiodental syndrome (OFCD) family. (PMID:22301464)
• A new fusion was observed between BCOR (encoding the BCL6 co-repressor) and CCNB3 (encoding the testis-specific cyclin B3) on the X chromosome. (PMID:22387997)
• FBXL11 inhibited osteo/dentinogenic differentiation potential in MSC cells by associating with BCOR, then increasing histone K4/36 methylation in Epiregulin promoter to repress Epiregulin transcription. (PMID:23074094)
• BCL6 corepressor, BCOR, binds the RING finger- and WD40-associated ubiquitin-like (RAWUL) domain of PCGF1 (NSPC1) and PCGF3 but not of PCGF2 (MEL18) or PCGF4 (BMI1). (PMID:23523425)
• report of the clinical and molecular data of 3 new patients with oculofaciocardiodenta and review the literature for all published patients and their mutations in the BCOR gene (PMID:23557072)
• Data indicate that sequencing of BCOR and related BCORL1 genes in a cohort of 354 myelodysplastic syndromes (MDS) patients identified 4.2% and 0.8% of mutations respectively. (PMID:24047651)
• two components of a transcriptional repressor complex (BCL-6 and BCoR) of wildtype amino acid sequence can independently or jointly induce the formation of nuclear aggregates when overexpressed. (PMID:24146931)
• ZC3H7B-BCOR and MEAF6-PHF1 fusions occurred predominantly in S100 protein-negative and malignant OFMT. (PMID:24285434)
• ZC3H7B-BCOR and MEAF6-PHF1 fusions occurred predominantly in S100 protein-negative and malignant ossifying fibromyxoid tumors. (PMID:24285434)
• The nonsense and frameshift mutations, which introduce premature termination codons, were found to contribute to oculofaciocardiodental syndrome in our two patients. (PMID:24694763)
• Study provides a detailed description of the histologic spectrum, immunohistochemical features, and clinical characteristic of BCOR-CCNB3 sarcoma justifying distinction from Ewing sarcoma with its typical EWS/FUS-ETS translocations. (PMID:24805859)
• This study adds to recent reports on the clinicopathologic spectrum of BCOR-CCNB3 fusion-positive sarcomas, a newly emerging entity within the undifferentiated unclassified sarcoma category (PMID:25360585)
• findings identify the BCL6/BCOR/SIRT1 complex as a potent repressor of the SHH pathway in normal and oncogenic neural development (PMID:25490446)
• study concluded that in pediatric acute myeloid leukemia, BCOR and BCORL1 mutations rarely occur (PMID:25596268)
• Using reported human BCOR mutations in patients with oculofaciocardiodental syndrome, the authors identified nuclear localization signals at two possible sites; at aa1131-1141 (NLS1) and at aa1158-1167(NLS2). (PMID:26054978)
• Data indicate that the internal tandem duplications in the BCOR gene (BCL6 corepressor) affecting the C terminus in 100% (20/20) of clear cell sarcoma of the kidney (CCSK) tumors (PMID:26098867)
• Data suggest the detection of the partial duplication inside exon 15 of proto-oncogene protein BCOR as part of the diagnostic process of pediatric kidney tumors. (PMID:26516930)
• Somatic internal tandem duplications (ITDs) clustering in the C terminus of BCOR were found in 85% of pediatric clear cell sarcoma of the kidney. Mutant BCOR transcripts and proteins are markedly upregulated in ITD-positive tumours. (PMID:26573325)
• The present study further expands the genetic spectrum of small blue round cell tumors, with 2 novel fusions, BCOR-MAML3 and ZC3H7B-BCOR, identified (PMID:26752546)
• Given the high frequency and pattern of aberration, BCOR is likely to play an important role in ENKTL pathogenesis as a tumor suppressor gene (PMID:26773734)
• we report recurrent BCOR exon 16 internal tandem duplications and YWHAE-NUTM2B fusions in half of infantile soft tissue undifferentiated round cell sarcoma and most primitive myxoid mesenchymal tumor of infancy cases, but not in other pediatric sarcomas. (PMID:26945340)
• Report mutually exclusive BCOR internal tandem duplications and YWHAE-NUTM2 fusions in clear cell sarcoma of kidney. (PMID:27000436)
• All small blue round cell tumors (SBRCTs) with BCOR-MAML3 and BCOR-CCNB3 fusions, as well as most with BCOR internal tandem duplications (93%), and all clear cell sarcoma of kidney showed strong and diffuse nuclear BCOR immunoreactivity. (PMID:27428733)
• we find that ESS with ZC3H7B-BCOR fusion constitutes a novel type of high-grade endometrial stromal sarcoma and shares significant morphologic overlap with myxoid leiomyosarcoma (PMID:27631520)
• Case Report: altered BCOR expression and homogeneous coactivation of both the SHH and WNT signaling pathways, and suggest potential novel therapeutic approaches for patients with a high grade neuroepithelial tumor of the central nervous system with BCOR alteration diagnosis. (PMID:27825128)
• BCOR internal tandem duplication and/or nuclear immunoreactivity for BCOR or BCL6 can aid in the diagnosis of primitive myxoid mesenchymal tumor of infancy and help to differentiate it from congenital infantile fibrosarcoma. (PMID:28256570)
• We report the case of a 7-month-old girl with atypical oculo-facio-cardio-dental syndrome (OFCD). A novel de novo pathogenic mutation in the BCL6 interacting co-repressor gene (BCOR) (c.4540C>T; p.Arg1514*), was identified on the X chromosome (PMID:28317252)
• BCOR immunohistochemical staining is a highly sensitive marker for YWHAE-NUTM2 high-grade endometrial stromal sarcoma with both classic and unusual morphology and identifies a subset of high-grade endometrial stromal sarcoma with BCOR alterations, including BCOR rearrangement and internal tandem duplication. (PMID:28621321)
• the frequent BCOR mutations and the absence of alterations in genes regulating the NF-kappaB pathway (triple-negative for KLF2, TNFAIP3 and MYD88 mutations) or the absence of a BRAF mutation appear to delineate a specific genetic pattern of SDRPL, which is distinct from that already identified in SMZL, HCL or HCL-v. (PMID:28751561)
• Case Reports: renal sarcomas with BCOR-CCNB3 gene fusion showing histological overlap with BCOR-related clear cell sarcoma of the kidney. (PMID:28817404)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	bcor	ENSDARG00000017798
mus_musculus	Bcor	ENSMUSG00000040363
rattus_norvegicus	Bcor	ENSRNOG00000034240
drosophila_melanogaster	CG14073	FBGN0036814

Paralogs (1): BCORL1 (ENSG00000085185)

Protein

Protein identifiers

BCL-6 corepressor — Q6W2J9 (reviewed: Q6W2J9)

All UniProt accessions (8): Q6W2J9, A0A5F9ZGX7, A1A564, C9JHP3, H7BYY2, H7BZ37, H7C231, H7C2V9

UniProt curated annotations — full annotation on UniProt →

Function. Transcriptional corepressor. May specifically inhibit gene expression when recruited to promoter regions by sequence-specific DNA-binding proteins such as BCL6 and MLLT3. This repression may be mediated at least in part by histone deacetylase activities which can associate with this corepressor. Involved in the repression of TFAP2A; impairs binding of BCL6 and KDM2B to TFAP2A promoter regions. Via repression of TFAP2A acts as a negative regulator of osteo-dentiogenic capacity in adult stem cells; the function implies inhibition of methylation on histone H3 ‘Lys-4’ (H3K4me3) and ‘Lys-36’ (H3K36me2).

Subunit / interactions. Interacts with BCL6; the interaction is direct. Forms ternary complexes with BCL6 and SMRT/NCOR2 on selected target genes promoters; potently repress expression. Can interact with HDAC1, HDAC3 and HDAC5. Interacts with PCGF1; the interaction is direct. Interacts with KDM2B. Component of an approximately 800 kDa repressive BCOR complex at least composed of BCOR, RYBP, PCGF1, RING1, RNF2/RING2, KDM2B and SKP1. Interacts with CPNE4 (via VWFA domain). Isoform 1 may interact with MLLT3/AF9.

Subcellular location. Nucleus.

Tissue specificity. Ubiquitously expressed.

Disease relevance. Microphthalmia, syndromic, 2 (MCOPS2) [MIM:300166] A very rare multiple congenital anomaly syndrome characterized by eye anomalies (congenital cataract, microphthalmia, or secondary glaucoma), facial abnormalities (long narrow face, high nasal bridge, pointed nose with cartilages separated at the tip, cleft palate, or submucous cleft palate), cardiac anomalies (atrial septal defect, ventricular septal defect, or floppy mitral valve) and dental abnormalities (canine radiculomegaly, delayed dentition, oligodontia, persistent primary teeth, or variable root length). Microphthalmia is a disorder of eye formation, ranging from small size of a single eye to complete bilateral absence of ocular tissues (anophthalmia). In many cases, microphthalmia/anophthalmia occurs in association with syndromes that include non-ocular abnormalities. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the BCOR family.

Isoforms (4)

UniProt ID	Names	Canonical?
Q6W2J9-1	1, Long	yes
Q6W2J9-2	2
Q6W2J9-3	3, Short
Q6W2J9-4	4

RefSeq proteins (4): NP_001116855, NP_001116856, NP_001116857, NP_060215 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002110	Ankyrin_rpt	Repeat
IPR031628	BCOR	Domain
IPR032365	PUFD	Domain
IPR036770	Ankyrin_rpt-contain_sf	Homologous_superfamily
IPR038227	PUFD_som_sf	Homologous_superfamily
IPR047144	BCOR-like	Family

Pfam: PF12796, PF15808, PF16553

UniProt features (71 total): region of interest 11, modified residue 11, compositionally biased region 9, strand 9, helix 6, mutagenesis site 5, cross-link 4, splice variant 4, sequence conflict 4, repeat 3, turn 3, chain 1, sequence variant 1

Structure

Experimental structures (PDB)

5 structures.

PDB	Method	Resolution (Å)
4HPL	X-RAY DIFFRACTION	2
8HCU	X-RAY DIFFRACTION	2.2
3BIM	X-RAY DIFFRACTION	2.6
2N1L	SOLUTION NMR
6B7G	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q6W2J9-F1	39.82	0.07

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (15): 336, 340, 365, 367, 392, 423, 1127, 1139, 1290, 1345, 1410, 786, 872, 1256, 1413

Mutagenesis-validated functional residues (5):

Position	Phenotype
507	abolishes interaction with bcl6 and inhibits bcl6 corepression activity; when associated with a-509 and a-511.
508	diminishes interaction with bcl6.
509	abolishes interaction with bcl6 and inhibits bcl6 corepression activity; when associated with a-507 and a-511.
511	abolishes interaction with bcl6 and inhibits bcl6 corepression activity; when associated with a-507 and a-509.
1706	slightly inhibits interaction with pcgf1.

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 728 (showing top): GSE45365_NK_CELL_VS_CD8_TCELL_DN, RNGTGGGC_UNKNOWN, GOBP_EMBRYO_DEVELOPMENT_ENDING_IN_BIRTH_OR_EGG_HATCHING, GOBP_AXIS_SPECIFICATION, PEREZ_TP63_TARGETS, GOBP_TOOTH_MINERALIZATION, AGGCACT_MIR5153P, NFKB_Q6, GOBP_NEGATIVE_REGULATION_OF_GENE_EXPRESSION_EPIGENETIC, CATRRAGC_UNKNOWN, GOBP_ANIMAL_ORGAN_MORPHOGENESIS, GOBP_NEGATIVE_REGULATION_OF_MULTICELLULAR_ORGANISMAL_PROCESS, ONKEN_UVEAL_MELANOMA_UP, GOBP_IN_UTERO_EMBRYONIC_DEVELOPMENT, RUTELLA_RESPONSE_TO_CSF2RB_AND_IL4_UP

GO Biological Process (11): negative regulation of transcription by RNA polymerase II (GO:0000122), blastocyst hatching (GO:0001835), chromatin remodeling (GO:0006338), heart development (GO:0007507), negative regulation of bone mineralization (GO:0030502), odontogenesis (GO:0042476), negative regulation of DNA-templated transcription (GO:0045892), roof of mouth development (GO:0060021), specification of axis polarity (GO:0065001), negative regulation of tooth mineralization (GO:0070171), chromatin organization (GO:0006325)

GO Molecular Function (8): transcription cis-regulatory region binding (GO:0000976), RNA polymerase II transcription regulatory region sequence-specific DNA binding (GO:0000977), transcription corepressor activity (GO:0003714), heat shock protein binding (GO:0031072), histone deacetylase binding (GO:0042826), DNA-binding transcription factor binding (GO:0140297), ubiquitin-protein transferase activity (GO:0004842), protein binding (GO:0005515)

GO Cellular Component (3): nucleus (GO:0005634), nucleoplasm (GO:0005654), BCOR complex (GO:0140261)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
negative regulation of DNA-templated transcription	2
negative regulation of biomineral tissue development	2
regulation of transcription by RNA polymerase II	1
transcription by RNA polymerase II	1
blastocyst development	1
hatching	1
chromatin organization	1
animal organ development	1
circulatory system development	1
negative regulation of ossification	1
bone mineralization	1
regulation of bone mineralization	1
animal organ morphogenesis	1
DNA-templated transcription	1
regulation of DNA-templated transcription	1
negative regulation of RNA biosynthetic process	1
anatomical structure development	1
pattern specification process	1
axis specification	1
tooth mineralization	1
regulation of tooth mineralization	1
cellular component organization	1
transcription regulatory region nucleic acid binding	1
sequence-specific double-stranded DNA binding	1
transcription cis-regulatory region binding	1
transcription coregulator activity	1
protein binding	1
enzyme binding	1
transcription factor binding	1
ubiquitin-like protein transferase activity	1
binding	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
cellular anatomical structure	1
nuclear ubiquitin ligase complex	1

Protein interactions and networks

STRING

1511 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
BCOR	BCL6	P41182	979
BCOR	KDM2B	Q8NHM5	904
BCOR	PCGF1	Q9BSM1	855
BCOR	MLLT3	P42568	759
BCOR	RYBP	Q8N488	754
BCOR	YAF2	Q8IY57	749
BCOR	RNF2	Q99496	747
BCOR	RING1	Q06587	695
BCOR	MLLT1	Q03111	663
BCOR	SKP1	P34991	550
BCOR	BCORL1	Q5H9F3	535
BCOR	AFF4	Q9UHB7	523
BCOR	AFF1	P51825	502
BCOR	PCGF3	Q3KNV8	487
BCOR	CCNB3	Q8WWL7	479

IntAct

202 interactions, top by confidence:

A	B	Type	Score
CBX8	BMI1	psi-mi:“MI:0914”(association)	0.970
CBX7	BMI1	psi-mi:“MI:0914”(association)	0.940
RYBP	CSNK2A2	psi-mi:“MI:0914”(association)	0.900
PCGF1	BCOR	psi-mi:“MI:0914”(association)	0.880
PCGF1	BCOR	psi-mi:“MI:0915”(physical association)	0.880
RYBP	BMI1	psi-mi:“MI:0914”(association)	0.850
RING1	BCOR	psi-mi:“MI:0914”(association)	0.840
CTBP1	ZEB2	psi-mi:“MI:0914”(association)	0.800
KDM2B	BCOR	psi-mi:“MI:0915”(physical association)	0.770
BCOR	KDM2B	psi-mi:“MI:0914”(association)	0.770
RYBP	E2F6	psi-mi:“MI:0914”(association)	0.740
RING1	CBX4	psi-mi:“MI:0914”(association)	0.730
RNF2	E2F6	psi-mi:“MI:0914”(association)	0.730
BCOR	SKP1	psi-mi:“MI:0914”(association)	0.730
CTBP1	CBX4	psi-mi:“MI:0914”(association)	0.700
NFIC	NFIB	psi-mi:“MI:2364”(proximity)	0.690
BCOR	CBX8	psi-mi:“MI:0915”(physical association)	0.660
CBX8	BCOR	psi-mi:“MI:0915”(physical association)	0.660
CBX8	BCOR	psi-mi:“MI:0914”(association)	0.660
USP7	BCOR	psi-mi:“MI:0914”(association)	0.660
RNF2	CBX4	psi-mi:“MI:0914”(association)	0.660

BioGRID (475): BCOR (Two-hybrid), BCOR (Two-hybrid), PCGF5 (Two-hybrid), BCOR (Affinity Capture-MS), BCOR (Affinity Capture-MS), BCOR (Affinity Capture-Western), BCOR (Affinity Capture-MS), BCOR (Affinity Capture-MS), BCOR (Affinity Capture-MS), BCOR (Affinity Capture-MS), BCOR (Affinity Capture-MS), BCOR (Affinity Capture-MS), BCOR (Affinity Capture-MS), BCOR (Affinity Capture-MS), BCOR (Affinity Capture-MS)

ESM2 similar proteins: A5X7A0, A7XYH5, A7XYJ6, E1BE02, E1BLP6, E2R9X2, E7F888, E9Q2Z1, O08750, O35914, O42477, P31629, P48552, P78312, Q04891, Q08D88, Q14865, Q15652, Q28BT7, Q28EW4, Q32N19, Q3KQW7, Q3U108, Q3UHF7, Q4G0F8, Q568E2, Q5ZJ69, Q5ZKH6, Q69ZK6, Q6IMZ0, Q6PBI4, Q6W2J9, Q6ZPI3, Q76L83, Q7TPM1, Q7YR76, Q8BM75, Q8BZ32, Q8CBD1, Q8CGI1

Diamond homologs: A2AQH4, A2AS55, A6NGH8, A6QR20, O14974, Q2T9W8, Q499M5, Q5H9F3, Q641X1, Q6P6B7, Q6W2J9, Q86WC6, Q8CGN4, Q9BQI6, Q9D119, Q9UU77, Q9XZC0, A4II29, O90760, P53356, Q1RJ94, Q337A0, Q38898, Q4ULZ2, Q5GIG6, Q5U5A6, Q7T3X9, Q7T3Y0, Q7TQP6, Q7Z6K4, Q810B6, Q91ZA8, Q93Z30, Q9CQM6, Q9DBR7, Q9Z1P7, Q9Z2F6, Q8N888

SIGNOR signaling

12 interactions.

A	Effect	B	Mechanism
BCOR	“up-regulates activity”	BCL6	binding
BCOR	“up-regulates activity”	HDAC1	binding
BCOR	“up-regulates activity”	HDAC3	binding
BCOR	“up-regulates activity”	HDAC5	binding
BCOR	“up-regulates activity”	RNF2	binding
BCOR	“form complex”	“Noncanonical PRC1”	binding
BCOR	down-regulates	Differentiation
BCOR	down-regulates	Proliferation
BCOR	“down-regulates quantity by repression”	HOXA5	“transcriptional regulation”
BCOR	“down-regulates quantity by repression”	HOXA7	“transcriptional regulation”
BCOR	“down-regulates quantity by repression”	HOXA9	“transcriptional regulation”
MLL-AF9	“up-regulates activity”	BCOR	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 204 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
RUNX1 interacts with co-factors whose precise effect on RUNX1 targets is not known	12	25.2×	2e-11
SUMOylation of DNA methylation proteins	5	23.5×	2e-04
Transcriptional Regulation by E2F6	7	14.3×	5e-05
Deactivation of the beta-catenin transactivating complex	8	13.0×	3e-05
Regulation of PTEN gene transcription	10	12.5×	2e-06
Differentiation of naive CD4+ T cells to T helper 2 cells (Th2 cells)	11	11.3×	1e-06
SUMOylation of transcription cofactors	6	10.2×	2e-03
SUMOylation of RNA binding proteins	6	10.0×	2e-03

GO biological processes:

GO term	Partners	Fold	FDR
positive regulation of miRNA transcription	8	12.7×	4e-05
regulation of circadian rhythm	7	9.9×	7e-04
positive regulation of DNA repair	5	9.8×	6e-03
cell fate commitment	6	9.7×	2e-03
heterochromatin formation	6	8.4×	4e-03
epidermal growth factor receptor signaling pathway	6	8.1×	5e-03
positive regulation of cell growth	7	7.0×	4e-03
anatomical structure morphogenesis	9	6.8×	7e-04

Disease & clinical

Cancer significance

From intOGen — cancer-driver classification: loss-of-function (tumor-suppressor-like) across 18 cancer types — ACC, AML, CHOL, CLLSLL, COADREAD, GBM, LGGNOS, LUAD, MBL, PAAD, PAST, PGNG…(+6 more).

Clinical variants and AI predictions

ClinVar

895 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	80
Likely pathogenic	36
Uncertain significance	351
Likely benign	151
Benign	73

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1070040	NM_001123385.2(BCOR):c.3090_3093del (p.Arg1031fs)	Pathogenic
1070616	NC_000023.10:g.(?39916388)(39937202_?)del	Pathogenic
1073665	NM_001123385.2(BCOR):c.4497C>A (p.Cys1499Ter)	Pathogenic
10911	NM_001123385.2(BCOR):c.254C>T (p.Pro85Leu)	Pathogenic
10912	NM_001123385.2(BCOR):c.4174-1G>T	Pathogenic
10913	NM_001123385.2(BCOR):c.2926C>T (p.Arg976Ter)	Pathogenic
10914	NM_001123385.2(BCOR):c.3983del (p.Gln1328fs)	Pathogenic
10917	NM_001123385.2(BCOR):c.3286del (p.Glu1096fs)	Pathogenic
10918	NG_008880.1:g.(5324_84863)_?del	Pathogenic
10919	NM_001123385.2(BCOR):c.2613del (p.Phe871fs)	Pathogenic
1184476	NM_001123385.2(BCOR):c.4551del (p.Glu1518fs)	Pathogenic
1299663	NM_001123385.2(BCOR):c.3226del (p.Glu1076fs)	Pathogenic
1324440	NM_001123385.2(BCOR):c.2617C>T (p.Gln873Ter)	Pathogenic
166750	NM_001123385.2(BCOR):c.776C>A (p.Ser259Ter)	Pathogenic
1676781	NM_001123385.2(BCOR):c.1529dup (p.Val511fs)	Pathogenic
1679317	NM_001123385.2(BCOR):c.4328_4329del (p.Thr1443fs)	Pathogenic
1679813	NM_001123385.2(BCOR):c.4751del (p.Asn1584fs)	Pathogenic
1801366	NM_001123385.2(BCOR):c.558T>G (p.Tyr186Ter)	Pathogenic
180243	NC_000023.11:g.(?40051246)(40075180_?)del	Pathogenic
180244	NM_001123385.2(BCOR):c.4742-141_4977-665del	Pathogenic
180245	NM_001123385.2(BCOR):c.4304_4308del (p.Pro1435fs)	Pathogenic
1805189	NM_001123385.2(BCOR):c.3165_3166delinsC (p.Lys1055fs)	Pathogenic
194417	NM_001123385.2(BCOR):c.4862dup (p.Gly1622fs)	Pathogenic
2109251	NM_001123385.2(BCOR):c.1233del (p.Lys412fs)	Pathogenic
2152340	NM_001123385.2(BCOR):c.3153G>A (p.Trp1051Ter)	Pathogenic
217327	NM_001123385.2(BCOR):c.4390_4393del (p.Glu1464fs)	Pathogenic
217354	NM_001123385.2(BCOR):c.1136_1139del (p.Val379fs)	Pathogenic
2426347	NC_000023.10:g.(?39921372)(39923872_?)del	Pathogenic
2574038	NM_001123385.2(BCOR):c.3355C>T (p.Gln1119Ter)	Pathogenic
2574149	NM_001123385.2(BCOR):c.3090_3091del (p.Glu1032fs)	Pathogenic

SpliceAI

4902 predictions. Top by Δscore:

Variant	Effect	Δscore
X:40052396:GTGGC:G	acceptor_gain	1.0000
X:40052397:TGGC:T	acceptor_gain	1.0000
X:40052398:GGC:G	acceptor_gain	1.0000
X:40052399:GC:G	acceptor_gain	1.0000
X:40052400:CC:C	acceptor_gain	1.0000
X:40052400:CCT:C	acceptor_loss	1.0000
X:40052401:C:CC	acceptor_gain	1.0000
X:40052401:CTACA:C	acceptor_loss	1.0000
X:40052404:C:CT	acceptor_gain	1.0000
X:40052409:C:CT	acceptor_gain	1.0000
X:40052410:A:T	acceptor_gain	1.0000
X:40053884:ACC:A	donor_gain	1.0000
X:40053885:CCC:C	donor_gain	1.0000
X:40053958:T:TA	donor_gain	1.0000
X:40053982:T:TA	donor_gain	1.0000
X:40054040:GTTC:G	acceptor_loss	1.0000
X:40054041:TTC:T	acceptor_loss	1.0000
X:40054042:TCT:T	acceptor_loss	1.0000
X:40054043:C:CA	acceptor_loss	1.0000
X:40054043:C:CC	acceptor_gain	1.0000
X:40054046:A:AC	acceptor_gain	1.0000
X:40054252:TTAC:T	donor_loss	1.0000
X:40054253:TACCA:T	donor_loss	1.0000
X:40054254:A:AC	donor_gain	1.0000
X:40054254:A:AT	donor_loss	1.0000
X:40054254:AC:A	donor_gain	1.0000
X:40054255:C:CC	donor_gain	1.0000
X:40054255:CC:C	donor_gain	1.0000
X:40054255:CCA:C	donor_gain	1.0000
X:40054329:ATAAT:A	acceptor_gain	1.0000

AlphaMissense

11487 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
X:40052390:A:G	W1663R	1.000
X:40052390:A:T	W1663R	1.000
X:40055373:A:G	L1579S	1.000
X:40055376:A:G	F1578S	1.000
X:40055460:A:G	L1550P	1.000
X:40055463:A:G	L1549P	1.000
X:40055463:A:T	L1549H	1.000
X:40055466:A:G	L1548P	1.000
X:40055472:A:T	V1546D	1.000
X:40055484:T:G	H1542P	1.000
X:40055487:T:A	D1541V	1.000
X:40055496:A:T	V1538D	1.000
X:40055499:G:T	A1537D	1.000
X:40055500:C:G	A1537P	1.000
X:40055501:A:C	D1536E	1.000
X:40055501:A:T	D1536E	1.000
X:40055502:T:A	D1536V	1.000
X:40055502:T:C	D1536G	1.000
X:40055502:T:G	D1536A	1.000
X:40055503:C:G	D1536H	1.000
X:40055511:G:C	P1533R	1.000
X:40055511:G:T	P1533H	1.000
X:40055512:G:A	P1533S	1.000
X:40055512:G:T	P1533T	1.000
X:40057155:C:A	R1532M	1.000
X:40057161:C:A	G1530V	1.000
X:40057161:C:T	G1530E	1.000
X:40057162:C:G	G1530R	1.000
X:40057162:C:T	G1530R	1.000
X:40057164:T:A	D1529V	1.000

dbSNP variants (sampled 300 via entrez): RS1000002376 (X:40119856 C>G), RS1000039105 (X:40095228 C>G,T), RS1000044703 (X:40051953 G>A), RS1000136130 (X:40168242 C>T), RS1000142143 (X:40077150 G>A), RS1000151666 (X:40108976 G>C,T), RS1000158741 (X:40082438 C>A), RS1000217399 (X:40095897 C>G), RS1000218883 (X:40176761 GCCGCCCCGCGCCACCCCCGC>G), RS1000224243 (X:40126822 T>C), RS1000225096 (X:40142777 G>A), RS1000236330 (X:40162634 G>A), RS1000249622 (X:40090512 A>G,T), RS1000260956 (X:40124421 C>A), RS1000293189 (X:40151013 G>A)

Disease associations

OMIM: gene MIM:300485 | disease phenotypes: MIM:300166, MIM:309800, MIM:601626, MIM:617319, MIM:610805, MIM:213000, MIM:217990

GenCC curated gene-disease

Disease	Classification	Inheritance
microphthalmia, syndromic 2	Definitive	X-linked
microphthalmia, Lenz type	Supportive	X-linked

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
microphthalmia, syndromic 2	Definitive	XL

Mondo (12): microphthalmia, syndromic 2 (MONDO:0010261), microphthalmia, syndromic 1 (MONDO:0010671), acute myeloid leukemia (MONDO:0018874), intellectual disability (MONDO:0001071), anterior segment dysgenesis 8 (MONDO:0015017), glioblastoma (MONDO:0018177), congenital anomaly of kidney and urinary tract (MONDO:0019719), isolated anophthalmia-microphthalmia syndrome (MONDO:0016764), microcephaly (MONDO:0001149), isolated cerebellar hypoplasia/agenesis (MONDO:0008939), corpus callosum, agenesis of (MONDO:0009022), microphthalmia, Lenz type (MONDO:0018924)

Orphanet (13): Oculofaciocardiodental syndrome (Orphanet:2712), Microphthalmia, Lenz type (Orphanet:568), Microphthalmia-ankyloblepharon-intellectual disability syndrome (Orphanet:85275), Acute myeloid leukemia (Orphanet:519), Autosomal recessive anterior segment dysgenesis (Orphanet:519388), Glioblastoma (Orphanet:360), Renal or urinary tract malformation (Orphanet:93545), Isolated microphthalmia-anophthalmia-coloboma (Orphanet:2542), Isolated cerebellar agenesis (Orphanet:1398), Isolated corpus callosum agenesis (Orphanet:200), Cerebellar hypoplasia-tapetoretinal degeneration syndrome (Orphanet:2246), Non-syndromic bicoronal craniosynostosis (Orphanet:35099), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

193 total (30 of 193 shown, HPO-id order):

HPO	Term
HP:0000028	Cryptorchidism
HP:0000047	Hypospadias
HP:0000072	Hydroureter
HP:0000089	Renal hypoplasia
HP:0000126	Hydronephrosis
HP:0000164	Abnormality of the dentition
HP:0000174	Abnormal palate morphology
HP:0000175	Cleft palate
HP:0000176	Submucous cleft hard palate
HP:0000193	Bifid uvula
HP:0000202	Orofacial cleft
HP:0000204	Cleft upper lip
HP:0000212	Gingival overgrowth
HP:0000218	High palate
HP:0000225	Gingival bleeding
HP:0000252	Microcephaly
HP:0000275	Narrow face
HP:0000276	Long face
HP:0000343	Long philtrum
HP:0000358	Posteriorly rotated ears
HP:0000365	Hearing impairment
HP:0000369	Low-set ears
HP:0000377	Abnormal pinna morphology
HP:0000378	Cupped ear
HP:0000384	Preauricular skin tag
HP:0000396	Overfolded helix
HP:0000403	Recurrent otitis media
HP:0000407	Sensorineural hearing impairment
HP:0000421	Epistaxis
HP:0000426	Prominent nasal bridge

GWAS associations

4 associations (top):

Study	Trait	p-value
GCST001897_3	Pit-and-Fissure caries	2.000000e-07
GCST005991_74	Platelet count	9.000000e-11
GCST009097_18	Venous thromboembolism	2.000000e-13
GCST010002_89	Refractive error	4.000000e-14

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0004309	platelet count

MeSH disease descriptors (8)

Descriptor	Name	Tree numbers
D061085	Agenesis of Corpus Callosum	C10.500.034; C16.131.666.034; C23.300.008
D005909	Glioblastoma	C04.557.465.625.600.380.080.335; C04.557.470.670.380.080.335; C04.557.580.625.600.380.080.335
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D015470	Leukemia, Myeloid, Acute	C04.557.337.539.275; C15.378.508.539.275
D008831	Microcephaly	C05.660.207.620; C10.500.507.400.500; C16.131.621.207.620; C16.131.666.507.400.500
C566906	Cakut (supp.)
C562568	Cerebellar Hypoplasia (supp.)
C537464	Microphthalmia, syndromic 1 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL4106125 (PROTEIN-PROTEIN INTERACTION)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

13 potent at pChembl≥5 of 18 total, top 13 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.00	IC50	100	nM	CHEMBL4075278
6.89	IC50	130	nM	CHEMBL4076344
6.89	IC50	130	nM	CHEMBL4076619
6.89	IC50	130	nM	CHEMBL4085850
6.82	IC50	150	nM	CHEMBL4103775
6.66	IC50	220	nM	CHEMBL4069588
6.62	IC50	240	nM	CHEMBL4093597
6.37	IC50	430	nM	CHEMBL4066000
6.14	IC50	720	nM	CHEMBL4075278
5.92	IC50	1200	nM	CHEMBL4076344
5.37	IC50	4300	nM	CHEMBL4092657
5.35	IC50	4500	nM	CHEMBL4063725
5.07	IC50	8600	nM	CHEMBL4084898

PubChem BioAssay actives

13 with measured affinity, of 22 total; 11 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
6-[2-chloro-4-nitro-5-(oxan-4-yloxy)anilino]-3,4-dihydro-1H-quinolin-2-one	1462098: Inhibition of C-terminal biotin-labelled BCoR/wild-type BCL6 BTB domain (unknown origin) protein-protein interaction by ELISA	ic50	0.1000	uM
3-[4-chloro-2-nitro-5-[(2-oxo-1,3-dihydrobenzimidazol-5-yl)amino]anilino]propanoic acid	1462098: Inhibition of C-terminal biotin-labelled BCoR/wild-type BCL6 BTB domain (unknown origin) protein-protein interaction by ELISA	ic50	0.1300	uM
5-[2-chloro-4-nitro-5-(oxan-4-yloxy)anilino]-1,3-dihydroindol-2-one	1462098: Inhibition of C-terminal biotin-labelled BCoR/wild-type BCL6 BTB domain (unknown origin) protein-protein interaction by ELISA	ic50	0.1300	uM
5-[2-chloro-4-nitro-5-(oxan-4-ylamino)anilino]-1,3-dihydrobenzimidazol-2-one	1462098: Inhibition of C-terminal biotin-labelled BCoR/wild-type BCL6 BTB domain (unknown origin) protein-protein interaction by ELISA	ic50	0.1300	uM
5-[2-chloro-4-nitro-5-(pyridin-3-ylmethylamino)anilino]-1,3-dihydrobenzimidazol-2-one	1462098: Inhibition of C-terminal biotin-labelled BCoR/wild-type BCL6 BTB domain (unknown origin) protein-protein interaction by ELISA	ic50	0.1500	uM
5-[2-chloro-4-nitro-5-(oxan-4-yloxy)anilino]-1,3-dihydrobenzimidazol-2-one	1462098: Inhibition of C-terminal biotin-labelled BCoR/wild-type BCL6 BTB domain (unknown origin) protein-protein interaction by ELISA	ic50	0.2200	uM
5-[2-chloro-5-(3-hydroxypropylamino)-4-nitroanilino]-1,3-dihydrobenzimidazol-2-one	1462098: Inhibition of C-terminal biotin-labelled BCoR/wild-type BCL6 BTB domain (unknown origin) protein-protein interaction by ELISA	ic50	0.2400	uM
ethyl 3-[4-chloro-2-nitro-5-[(2-oxo-1,3-dihydrobenzimidazol-5-yl)amino]anilino]propanoate	1462098: Inhibition of C-terminal biotin-labelled BCoR/wild-type BCL6 BTB domain (unknown origin) protein-protein interaction by ELISA	ic50	0.4300	uM
5-nitro-2-[(2-oxo-1,3-dihydrobenzimidazol-5-yl)amino]benzonitrile	1462098: Inhibition of C-terminal biotin-labelled BCoR/wild-type BCL6 BTB domain (unknown origin) protein-protein interaction by ELISA	ic50	4.3000	uM
5-(2-chloro-4-nitroanilino)-1,3-dihydrobenzimidazol-2-one	1462098: Inhibition of C-terminal biotin-labelled BCoR/wild-type BCL6 BTB domain (unknown origin) protein-protein interaction by ELISA	ic50	4.5000	uM
methyl 3-chloro-4-[(2-oxo-1,3-dihydrobenzimidazol-5-yl)amino]benzoate	1462098: Inhibition of C-terminal biotin-labelled BCoR/wild-type BCL6 BTB domain (unknown origin) protein-protein interaction by ELISA	ic50	8.6000	uM

CTD chemical–gene interactions

71 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases methylation, affects cotreatment, decreases expression	6
sodium arsenite	affects expression, affects cotreatment, decreases expression, increases abundance, increases expression	4
bisphenol A	affects cotreatment, increases methylation, decreases expression	2
trichostatin A	affects cotreatment, decreases expression	2
Arsenic	affects cotreatment, decreases expression, increases abundance, increases expression	2
Benzo(a)pyrene	affects methylation	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
Aflatoxin B1	affects methylation, decreases methylation	2
Cadmium Chloride	decreases expression, increases abundance	2
p-Chloromercuribenzoic Acid	affects cotreatment, decreases expression	2
aristolochic acid I	decreases expression	1
3-((6-(2-methoxyphenyl)pyrimidin-4-yl)amino)phenyl)methane sulfonamide	decreases expression	1
FR900359	affects phosphorylation	1
TAK-243	increases sumoylation	1
dicrotophos	increases expression	1
geldanamycin	increases expression	1
2,4,6-tribromophenol	decreases expression	1
methylmercuric chloride	decreases expression	1
triphenyl phosphate	affects expression	1
alpha-pinene	increases abundance, affects cotreatment, increases oxidation	1
titanium dioxide	decreases methylation	1
decabromobiphenyl ether	decreases expression	1
beta-lapachone	increases expression	1
arsenite	affects binding, decreases reaction	1
butyraldehyde	increases expression	1
tetrabromobisphenol A	decreases expression	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
potassium chromate(VI)	decreases expression	1
aflatoxin B2	decreases methylation, increases methylation	1
coumarin	affects phosphorylation	1

ChEMBL screening assays

2 unique, capped per target: 2 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4044889	Binding	Inhibition of C-terminal biotin-labelled BCoR/wild-type BCL6 BTB domain (unknown origin) protein-protein interaction by ELISA	Discovery of a novel B-cell lymphoma 6 (BCL6)-corepressor interaction inhibitor by utilizing structure-based drug design. — Bioorg Med Chem

Cellosaurus cell lines

19 cell lines: 18 cancer cell line, 1 induced pluripotent stem cell

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_1443	SJNB-13	Cancer cell line	Male
CVCL_1806	AMO1	Cancer cell line	Female
CVCL_A792	RMS-YM	Cancer cell line	Male
CVCL_AE87	HPSI0314i-sojd_3	Induced pluripotent stem cell	Female
CVCL_B1L7	Abcam HeLa BCOR KO	Cancer cell line	Female
CVCL_B7KL	BCH-RB31	Cancer cell line	Female
CVCL_B7KM	BCH-RB32	Cancer cell line	Female
CVCL_B7KQ	BCH-RB35	Cancer cell line	Female
CVCL_B7KR	BCH-RB36	Cancer cell line	Male
CVCL_B7KS	BCH-RB37	Cancer cell line	Male

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00199147	PHASE4	UNKNOWN	Efficacy of G-CSF-Priming in Elderly AML Patients
NCT00304447	PHASE4	COMPLETED	Study Evaluating the Effect of Corticosteroids on Mylotarg® Infusion-Related Adverse Events in Patients With Leukemia
NCT00464217	PHASE4	COMPLETED	Treatment of the Acute Myeloblastic Leukaemia in Patients Over 65 Years
NCT00487448	PHASE4	COMPLETED	SMD_FLAG-IDA_98: FLAG-IDA in Induction Treatment of High Risk Myelodysplastic Syndromes or Secondary Acute Myeloblastic Leukemia
NCT00488709	PHASE4	COMPLETED	Fludarabine, Cytarabine, Topotecan in Treating Patients With Relapsed or Refractory Acute Myeloid Leukemia
NCT00686543	PHASE4	COMPLETED	Oral Posaconazole in High Risk Patients With Gastrointestinal Dysfunction (Study P05115)
NCT01041040	PHASE4	COMPLETED	LAM07: Study to Analyze the Efficacy of a Risk Adapted Treatment Strategy, Including Gemtuzumab Ozogamicin (GO) During Consolidation, for Patients With Acute Myeloid Leukemia (AML)
NCT01198054	PHASE4	TERMINATED	LENA-LMA-5:Lenalidomide in Acute Myeloid Leukemia (AML)
NCT01200355	PHASE4	COMPLETED	Posaconazole Versus Micafungin for Prophylaxis Against Invasive Fungal Infections During Neutropenia in Patients Undergoing Chemotherapy for Acute Myelogenous Leukemia, Acute Lymphocytic Leukemia or Myelodysplastic Syndrome
NCT01347996	PHASE4	COMPLETED	Maintenance Therapy With Ceplene® (Histamine) and IL-2 on Immune Response and MRD in Acute Myeloid Leukemia
NCT01587430	PHASE4	UNKNOWN	3 Anthracyclines, 2 Types of Consolidation With Different ARA-C Doses and Maintenance in Adult Acute Myeloid Leukemia
NCT01819792	PHASE4	COMPLETED	Respiratory Viral Infections During Acute Myeloid Leukemia (AML)Chemotherapy Related Aplasia
NCT02024308	PHASE4	UNKNOWN	AML1-ETO Acute Myeloid Leukemia With Fludarabine and Cytarabine Chemotherapy
NCT02027064	PHASE4	UNKNOWN	Interferon for the Intervention of Molecular Relapse in t (8; 21) AML After Allo-HSCT
NCT02277847	PHASE4	UNKNOWN	Idarubicin at Different Dosages as Induction Therapy for Newly Diagnosed Acute Myeloid Leukaemia
NCT02386800	PHASE4	ACTIVE_NOT_RECRUITING	CINC424A2X01B Rollover Protocol
NCT02926586	PHASE4	COMPLETED	Fludarabine and Cytarabine Versus High-dose Cytarabine for CBF-AML
NCT02933333	PHASE4	UNKNOWN	G-CSF Alone or Combination With GM-CSF on Prevention and Treatment of Infection in Children With Malignant Tumor
NCT03026842	PHASE4	UNKNOWN	Decitabine Versus Conventional Chemotherapy for Maintenance Therapy of Acute Myeloid Leukemia With t(8;21)
NCT03150134	PHASE4	UNKNOWN	Early Tapering of Immunosuppressive Agents to Immunomodulation to Improve Survival of AML Patients
NCT05144243	PHASE4	ACTIVE_NOT_RECRUITING	Study to Assess Adverse Events and Change in Disease State of Oral Venetoclax in Combination With Subcutaneous (SC) Azacitidine in Newly Diagnosed Adult Participants With Acute Myeloid Leukemia (AML) Who Are Ineligible for Intensive Chemotherapy in China
NCT06370000	PHASE4	RECRUITING	Oral Azacitidine in Transplant-Eligible Patients With Acute Myeloid Leukemia (AML) Suffering From Health-Inequality
NCT06571825	PHASE4	RECRUITING	RIC Allo-HSCT vs. Venetoclax-Based Consolidation in Elderly AML Patients After First CR
NCT07016165	PHASE4	RECRUITING	Ciprofloxacin vs Ceftazidime for Empirical Treatment of High-Risk Neutropenic Fever in Children With Hematologic Malignancies
NCT07044687	PHASE4	RECRUITING	Study to Assess Adverse Events and Change in Disease Activity of Oral Venetoclax in Combination With Subcutaneous (SC) or Intravenous (IV) Azacitidine in Newly Diagnosed Adult Participants With Acute Myeloid Leukemia (AML) Who Are Ineligible for Standard Induction Therapy in India
NCT07486713	PHASE4	RECRUITING	Olutasidenib DDI Study in Patients With IDH1 Mutation Positive Malignancies
NCT07561892	PHASE4	RECRUITING	Study of the Effectiveness and Safety of Daunorubicin /Idarubicin ± Silibinin in Treating Newly Diagnosed AML (Non-M3).
NCT00000589	PHASE3	COMPLETED	Trial to Reduce Alloimmunization to Platelets (TRAP)
NCT00044486	PHASE3	COMPLETED	Prophylaxis Trial of Posaconazole Versus Standard Azole Therapy for Neutropenic Patients (Study P01899)
NCT00093990	PHASE3	COMPLETED	Tipifarnib Versus Best Supportive Care in the Treatment of Newly Diagnosed Acute Myeloid Leukemia (AML)
NCT00125606	PHASE3	TERMINATED	Phase 3 Trial for AML Patients in CR2 Comparing 8Gy TBI /Fludarabine to Conditioning With TBI 12Gy/Cyclophosphamide
NCT00136084	PHASE3	COMPLETED	Treatment of Patients With Newly Diagnosed Acute Myeloid Leukemia or Myelodysplasia
NCT00146120	PHASE3	COMPLETED	Risk-Adapted Therapy of Acute Myeloid Leukemia of Adults (18-60 Years) According to the Cytogenetic Result
NCT00150878	PHASE3	TERMINATED	Standard vs. Reduced-Intensity Conditioning in Patients With Acute Myeloid Leukemia in First Remission
NCT00151255	PHASE3	COMPLETED	All-Trans Retinoic Acid in Combination With Standard Induction and Consolidation Therapy in Older Patients With Newly Diagnosed Acute Myeloid Leukemia
NCT00152139	PHASE3	COMPLETED	Stem Cell Transplantation for Patients With Hematologic Malignancies
NCT00152594	PHASE3	TERMINATED	Voriconazole or Placebo in the Prophylaxis of Lung Infiltrates in Patients Undergoing Induction Chemotherapy for Acute Myelogenous Leukemia
NCT00186966	PHASE3	COMPLETED	Treatment of Children and Adolescents With Refractory or Relapsed Acute Myeloid Leukemia
NCT00226512	PHASE3	WITHDRAWN	To Determine the Role of Adding Campath-1H or ATG Given In-vivo in Addition to Fludarabine and Low Dose Busulfex on Outcome in Patients Treated With Reduced Intensity Conditioning
NCT00260832	PHASE3	COMPLETED	Trial of Decitabine in Patients With Acute Myeloid Leukemia