BEAN1

Summary

BEAN1 (brain expressed associated with NEDD4 1, HGNC:24160) is a protein-coding gene on chromosome 16q21, encoding Protein BEAN1 (Q3B7T3).

The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 146227 — RefSeq curated summary.

At a glance

• Gene–disease (curated): spinocerebellar ataxia type 31 (Strong, GenCC)
• Clinical variants (ClinVar): 99 total — 2 pathogenic
• Phenotypes (HPO): 17
• MANE Select transcript: NM_001178020

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:24160
Approved symbol	BEAN1
Name	brain expressed associated with NEDD4 1
Location	16q21
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000166546
Ensembl biotype	protein_coding
OMIM	612051
Entrez	146227

Gene structure

Transcript identifiers

Ensembl transcripts: 9 — 3 protein_coding_CDS_not_defined, 2 protein_coding, 2 nonsense_mediated_decay, 1 retained_intron, 1 non_stop_decay

ENST00000299694, ENST00000536005, ENST00000561796, ENST00000562146, ENST00000562849, ENST00000563075, ENST00000564819, ENST00000569272, ENST00000618932

RefSeq mRNA: 3 — MANE Select: NM_001178020 NM_001136106, NM_001178020, NM_001197224

CCDS: CCDS54015, CCDS58469

Canonical transcript exons

ENST00000536005 — 5 exons

Exon	Start	End
ENSE00002253126	66437595	66437701
ENSE00002593703	66480586	66482833
ENSE00003674870	66477560	66477710
ENSE00003683104	66469602	66469865
ENSE00003847521	66427295	66427431

Expression profiles

Bgee: expression breadth ubiquitous, 180 present calls, max score 82.67.

FANTOM5 (CAGE): breadth broad, TPM avg 0.6266 / max 34.0711, expressed in 291 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
154508	0.4960	234
154507	0.1306	52

Top tissues by expression

291 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
oocyte	CL:0000023	82.67	gold quality
secondary oocyte	CL:0000655	80.38	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	75.67	gold quality
sural nerve	UBERON:0015488	75.43	gold quality
right frontal lobe	UBERON:0002810	75.22	gold quality
right hemisphere of cerebellum	UBERON:0014890	73.51	gold quality
cerebellar hemisphere	UBERON:0002245	73.26	gold quality
cerebellar cortex	UBERON:0002129	73.22	gold quality
prefrontal cortex	UBERON:0000451	72.86	gold quality
cingulate cortex	UBERON:0003027	72.56	gold quality
anterior cingulate cortex	UBERON:0009835	72.39	gold quality
cortical plate	UBERON:0005343	72.04	gold quality
Brodmann (1909) area 9	UBERON:0013540	71.55	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	71.17	gold quality
descending thoracic aorta	UBERON:0002345	71.16	gold quality
hair follicle	UBERON:0002073	70.70	silver quality
cerebellum	UBERON:0002037	70.54	gold quality
left testis	UBERON:0004533	70.31	gold quality
neocortex	UBERON:0001950	70.13	gold quality
frontal cortex	UBERON:0001870	69.73	gold quality
right testis	UBERON:0004534	69.20	gold quality
primary visual cortex	UBERON:0002436	68.27	gold quality
cerebral cortex	UBERON:0000956	68.20	gold quality
right coronary artery	UBERON:0001625	68.08	gold quality
apex of heart	UBERON:0002098	68.01	gold quality
thoracic aorta	UBERON:0001515	68.00	gold quality
testis	UBERON:0000473	67.94	gold quality
ascending aorta	UBERON:0001496	67.83	gold quality
right uterine tube	UBERON:0001302	67.49	gold quality
mucosa of stomach	UBERON:0001199	67.37	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-GEOD-124858	no	9.92
E-ANND-3	no	2.22

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

106 targeting BEAN1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-30A-5P	100.00	76.31	3233
HSA-MIR-30B-5P	100.00	76.29	3248
HSA-MIR-30C-5P	100.00	76.29	3248
HSA-MIR-30D-5P	100.00	76.32	3233
HSA-MIR-30E-5P	100.00	76.32	3242
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-548AN	99.97	70.91	2817
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-9983-3P	99.94	71.48	3631
HSA-MIR-101-3P	99.94	75.03	2230
HSA-MIR-141-3P	99.94	72.79	2421
HSA-MIR-200A-3P	99.94	72.68	2420
HSA-MIR-381-3P	99.93	71.87	2854
HSA-MIR-300	99.92	71.76	2856
HSA-MIR-4697-3P	99.89	67.09	1123
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-129-5P	99.88	70.26	3273
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-221-3P	99.86	71.56	1329
HSA-MIR-222-3P	99.86	71.35	1337
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-765	99.84	68.24	2442
HSA-MIR-5010-3P	99.83	70.60	2357
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-205-5P	99.81	70.05	1557
HSA-MIR-6817-3P	99.79	68.35	2126
HSA-MIR-11181-3P	99.75	66.38	2205

Literature-anchored findings (GeneRIF, showing 5)

• SCA31 is associated with “inserted” pentanucleotide repeats containing (TGGAA)n. (PMID:19878914)
• Our data indicate that SCA31 is absent or rare in the Chinese population on Taiwan. (PMID:21163552)
• This study describes the structure of SCA31 pentanucleotide repeat sequences in a cohort of Caucasian patients with spinocerebellar ataxia. (PMID:22049201)
• we conclude that the RNA foci containing BEAN1-direction transcript (UGGAA)n are associated with Purkinje cell degeneration in Spinocerebellar ataxia type 31 (PMID:23607545)
• this study reveals a regulation mechanism of NEDD4-1 stability by O-GlcNAcylation. (PMID:26876577)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Bean1	ENSMUSG00000031872
rattus_norvegicus	Bean1	ENSRNOG00000066314

Protein

Protein identifiers

Protein BEAN1 — Q3B7T3 (reviewed: Q3B7T3)

Alternative names: Brain-expressed protein associating with Nedd4 homolog

All UniProt accessions (3): A0A087WTF9, H3BRW1, Q3B7T3

UniProt curated annotations — full annotation on UniProt →

Subunit / interactions. Interacts with NEDD4.

Subcellular location. Membrane.

Disease relevance. Spinocerebellar ataxia 31 (SCA31) [MIM:117210] A form of spinocerebellar ataxia, a clinically and genetically heterogeneous group of cerebellar disorders. Patients show progressive incoordination of gait and often poor coordination of hands, speech and eye movements, due to degeneration of the cerebellum with variable involvement of the brainstem and spinal cord. SCA31 belongs to the autosomal dominant cerebellar ataxias type III (ADCA III) which are characterized by pure cerebellar ataxia without additional signs. The disease is caused by variants affecting the gene represented in this entry.

Isoforms (3)

UniProt ID	Names	Canonical?
Q3B7T3-1	1	yes
Q3B7T3-2	2
Q3B7T3-3	3

RefSeq proteins (2): NP_001129578, NP_001171491* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR039352	BEAN1	Family

UniProt features (9 total): compositionally biased region 3, region of interest 2, splice variant 2, chain 1, transmembrane region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q3B7T3-F1	58.44	0.06

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 81 (showing top): GRAESSMANN_APOPTOSIS_BY_SERUM_DEPRIVATION_UP, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, chr16q21, CHICAS_RB1_TARGETS_SENESCENT, NFKBIA_TARGET_GENES, SUPT16H_TARGET_GENES, ZNF239_TARGET_GENES, ZNF436_TARGET_GENES, ZNF768_TARGET_GENES, MIR6867_5P, MIR9983_3P, MIR300, MIR101_3P, MIR381_3P, MIR129_5P

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (1): membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	1

Protein interactions and networks

STRING

438 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
BEAN1	PLEKHG4	Q58EX7	788
BEAN1	SRSF9	Q13242	760
BEAN1	CALB1	P05937	688
BEAN1	ATXN10	Q9UBB4	598
BEAN1	COQ8A	Q8NI60	559
BEAN1	SYP	P08247	541
BEAN1	PYURF	Q96I23	532
BEAN1	UBB	P02248	496
BEAN1	MRPL55	Q7Z7F7	475
BEAN1	SRSF1	Q07955	466
BEAN1	TTBK2	Q6IQ55	464
BEAN1	NOP56	O00567	464
BEAN1	CACNA1A	P78510	462
BEAN1	ZNF608	Q9ULD9	460
BEAN1	TUBGCP4	Q9UGJ1	456

IntAct

3 interactions, top by confidence:

A	B	Type	Score
YAP1	BEAN1	psi-mi:“MI:0407”(direct interaction)	0.440
BEAN1	PKM	psi-mi:“MI:0217”(phosphorylation reaction)	0.440

BioGRID (5): BEAN1 (Affinity Capture-RNA), BEAN1 (Protein-peptide), BEAN1 (Biochemical Activity), BEAN1 (Reconstituted Complex), BEAN1 (Affinity Capture-Luminescence)

ESM2 similar proteins: A2AR95, A4GWX9, A4IHY6, B9F4Q9, D2KUZ7, D3Z1Q2, O15165, O35181, P0C1G7, P0C6T3, P56975, Q0VA20, Q0VBF2, Q0VFM5, Q3B7T3, Q3UH99, Q3V0I2, Q4KL18, Q4KMG9, Q58DS4, Q5FWP4, Q5R8E0, Q5XG16, Q68FU0, Q6A098, Q6K0P5, Q6PAQ9, Q6UXU6, Q6ZSJ9, Q86YD5, Q8AVJ1, Q8BGE4, Q8BGW2, Q8BWJ4, Q8TB68, Q8WUU8, Q8WVE6, Q90VY2, Q92537, Q93YV5

Diamond homologs: Q3B7T3, Q9EQG5

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

99 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	0
Uncertain significance	62
Likely benign	16
Benign	15

Top pathogenic / likely-pathogenic (2)

Variant ID	HGVS	Classification
3774413	GRCh37/hg19 16q11.2-24.3(chr16:46432879-90294753)x3	Pathogenic
733	NG_021403.2:g.68486_68487insN[2500_3800]	Pathogenic

SpliceAI

2178 predictions. Top by Δscore:

Variant	Effect	Δscore
16:66427427:GCCGA:G	donor_gain	1.0000
16:66427428:CCGAG:C	donor_loss	1.0000
16:66427429:CGAG:C	donor_loss	1.0000
16:66427430:GA:G	donor_gain	1.0000
16:66427430:GAGT:G	donor_loss	1.0000
16:66427431:AGTAA:A	donor_loss	1.0000
16:66427432:G:GG	donor_gain	1.0000
16:66427433:T:G	donor_loss	1.0000
16:66469600:A:AG	acceptor_gain	1.0000
16:66469601:G:GA	acceptor_gain	1.0000
16:66469601:GT:G	acceptor_gain	1.0000
16:66469601:GTA:G	acceptor_gain	1.0000
16:66469601:GTAGC:G	acceptor_gain	1.0000
16:66477709:GG:G	donor_gain	1.0000
16:66477710:GG:G	donor_gain	1.0000
16:66427428:CCGA:C	donor_gain	0.9900
16:66427429:CGA:C	donor_gain	0.9900
16:66427430:GAG:G	donor_gain	0.9900
16:66427438:G:T	donor_gain	0.9900
16:66437702:G:GG	donor_gain	0.9900
16:66447547:G:GT	donor_gain	0.9900
16:66469596:CCACA:C	acceptor_loss	0.9900
16:66469597:CACAG:C	acceptor_loss	0.9900
16:66469599:CAG:C	acceptor_loss	0.9900
16:66469601:G:C	acceptor_loss	0.9900
16:66477558:A:AG	acceptor_gain	0.9900
16:66477559:G:GG	acceptor_gain	0.9900
16:66477711:G:GG	donor_gain	0.9900
16:66477945:T:TA	donor_gain	0.9900
16:66480584:A:AG	acceptor_gain	0.9900

AlphaMissense

1659 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
16:66469694:A:C	S40R	0.999
16:66469696:T:A	S40R	0.999
16:66469696:T:G	S40R	0.999
16:66469727:T:C	C51R	0.998
16:66469706:G:C	G44R	0.997
16:66469707:G:A	G44D	0.997
16:66469704:T:A	I43K	0.996
16:66469713:T:A	V46D	0.996
16:66469692:C:A	A39E	0.994
16:66469698:C:A	A41D	0.994
16:66469701:T:A	V42D	0.994
16:66469728:G:A	C51Y	0.990
16:66469697:G:C	A41P	0.989
16:66469722:T:A	L49H	0.989
16:66469737:T:A	I54N	0.989
16:66469704:T:G	I43R	0.988
16:66469725:C:A	S50Y	0.987
16:66469737:T:C	I54T	0.987
16:66469680:C:G	P35R	0.985
16:66469737:T:G	I54S	0.985
16:66469680:C:A	P35H	0.984
16:66469695:G:A	S40N	0.984
16:66480596:T:C	C151R	0.984
16:66469748:A:C	S58R	0.983
16:66469750:C:A	S58R	0.983
16:66469750:C:G	S58R	0.983
16:66469722:T:G	L49R	0.982
16:66469722:T:C	L49P	0.981
16:66469734:C:A	T53N	0.981
16:66469746:G:A	G57D	0.981

dbSNP variants (sampled 300 via entrez): RS1000060942 (16:66484827 C>G,T), RS1000097500 (16:66458993 C>T), RS1000174711 (16:66483441 G>A), RS1000209837 (16:66435170 G>T), RS1000223966 (16:66434206 CCCCCGACCCCGACCCCAA>C,CCCCCGACCCCGACCCCAACCCCGACCCCGACCCCAA), RS1000265795 (16:66478615 T>A,G), RS1000267658 (16:66495398 CTTCCTTCCTTCT>C), RS1000268176 (16:66490826 C>T), RS1000302680 (16:66452638 G>A), RS1000308027 (16:66438664 T>A,G), RS1000362565 (16:66466165 C>T), RS1000406990 (16:66459299 AG>A), RS1000424079 (16:66472856 C>A), RS1000493533 (16:66445200 G>A), RS1000540851 (16:66437147 A>G)

Disease associations

OMIM: gene MIM:612051 | disease phenotypes: MIM:117210

GenCC curated gene-disease

Disease	Classification	Inheritance
spinocerebellar ataxia type 31	Strong	Autosomal dominant

Mondo (2): spinocerebellar ataxia type 31 (MONDO:0007296), partial trisomy of the long arm of chromosome 16 (MONDO:0016966)

Orphanet (2): Spinocerebellar ataxia type 31 (Orphanet:217012), Partial duplication of the long arm of chromosome 16 syndrome (Orphanet:262959)

HPO phenotypes

17 total (17 of 17 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000365	Hearing impairment
HP:0000407	Sensorineural hearing impairment
HP:0000639	Nystagmus
HP:0001251	Ataxia
HP:0001257	Spasticity
HP:0001260	Dysarthria
HP:0001265	Hyporeflexia
HP:0001272	Cerebellar atrophy
HP:0001337	Tremor
HP:0001347	Hyperreflexia
HP:0002066	Gait ataxia
HP:0002070	Limb ataxia
HP:0002495	Impaired vibratory sensation
HP:0003584	Late onset
HP:0006801	Hyperactive deep tendon reflexes
HP:0007979	Gaze-evoked horizontal nystagmus

GWAS associations

0 associations (top):

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
C538042	Chromosome 16, trisomy 16q (supp.)
C566146	Spinocerebellar Ataxia 31 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

25 total (human), top 25 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
trichostatin A	affects cotreatment, increases expression, decreases expression	2
triphenyl phosphate	affects expression	1
bisphenol A	affects cotreatment, decreases methylation	1
tris(2-butoxyethyl) phosphate	affects expression	1
sodium arsenite	affects methylation	1
S-(1,2-dichlorovinyl)cysteine	decreases expression, affects response to substance, increases expression, affects cotreatment	1
2-palmitoylglycerol	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, increases expression	1
jinfukang	increases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Fulvestrant	decreases methylation, affects cotreatment	1
Benzo(a)pyrene	affects methylation, increases methylation	1
Fluorouracil	affects response to substance, increases expression	1
Lead	affects expression	1
Lipopolysaccharides	affects response to substance, increases expression, affects cotreatment, decreases expression	1
Naled	affects expression	1
Nickel	decreases expression	1
Plant Extracts	affects cotreatment, decreases expression	1
Silicon Dioxide	increases expression	1
Valproic Acid	decreases methylation	1
Isotretinoin	decreases expression	1
Cyclosporine	increases expression	1
Aflatoxin B1	decreases methylation	1

Clinical trials (associated diseases)

1 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT01793168	Not specified	RECRUITING	Rare Disease Patient Registry & Natural History Study - Coordination of Rare Diseases at Sanford