BET1

Summary

BET1 (Bet1 golgi vesicular membrane trafficking protein, HGNC:14562) is a protein-coding gene on chromosome 7q21.3, encoding BET1 homolog (O15155). Required for vesicular transport from the ER to the Golgi complex. It is a selective cancer dependency (DepMap: 29.3% of cell lines).

This gene encodes a golgi-associated membrane protein that participates in vesicular transport from the endoplasmic reticulum (ER) to the Golgi complex. The encoded protein functions as a soluble N-ethylaleimide-sensitive factor attachment protein receptor and may be involved in the docking of ER-derived vesicles with the cis-Golgi membrane. Alternative splicing results in multiple transcript variants.

Source: NCBI Gene 10282 — RefSeq curated summary.

At a glance

• Gene–disease (curated): muscular dystrophy, congenital, with rapid progression (Moderate, GenCC)
• GWAS associations: 5
• Clinical variants (ClinVar): 24 total — 2 likely-pathogenic
• Phenotypes (HPO): 4
• Druggable target: yes
• Cancer dependency (DepMap): dependent in 29.3% of screened cell lines
• MANE Select transcript: NM_005868

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:14562
Approved symbol	BET1
Name	Bet1 golgi vesicular membrane trafficking protein
Location	7q21.3
Locus type	gene with protein product
Status	Approved
Aliases	hbet1
Ensembl gene	ENSG00000105829
Ensembl biotype	protein_coding
OMIM	605456
Entrez	10282

Gene structure

Transcript identifiers

Ensembl transcripts: 8 — 4 protein_coding, 2 nonsense_mediated_decay, 2 protein_coding_CDS_not_defined

ENST00000222547, ENST00000357520, ENST00000424151, ENST00000425626, ENST00000433727, ENST00000457139, ENST00000471446, ENST00000650276

RefSeq mRNA: 2 — MANE Select: NM_005868 NM_001317739, NM_005868

CCDS: CCDS5635, CCDS83203

Canonical transcript exons

ENST00000222547 — 4 exons

Exon	Start	End
ENSE00000877332	93999170	93999294
ENSE00001031680	93993245	93994385
ENSE00001681690	94004198	94004355
ENSE00003687222	93996265	93996321

Expression profiles

Bgee: expression breadth ubiquitous, 289 present calls, max score 94.22.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 36.9572 / max 686.9537, expressed in 1817 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
84894	26.8634	1809
84893	7.3825	1715
84895	2.3112	1343
204526	0.4002	197

Top tissues by expression

299 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
body of pancreas	UBERON:0001150	94.22	gold quality
adrenal tissue	UBERON:0018303	93.46	gold quality
calcaneal tendon	UBERON:0003701	92.84	gold quality
placenta	UBERON:0001987	92.79	gold quality
pancreas	UBERON:0001264	92.16	gold quality
endometrium	UBERON:0001295	92.05	gold quality
corpus epididymis	UBERON:0004359	91.90	gold quality
adenohypophysis	UBERON:0002196	91.75	gold quality
monocyte	CL:0000576	91.69	gold quality
right adrenal gland	UBERON:0001233	91.64	gold quality
pituitary gland	UBERON:0000007	91.53	gold quality
right adrenal gland cortex	UBERON:0035827	91.40	gold quality
left adrenal gland	UBERON:0001234	91.38	gold quality
left adrenal gland cortex	UBERON:0035825	91.30	gold quality
stromal cell of endometrium	CL:0002255	91.21	gold quality
adrenal gland	UBERON:0002369	91.13	gold quality
mononuclear cell	CL:0000842	91.12	gold quality
rectum	UBERON:0001052	90.94	gold quality
adrenal cortex	UBERON:0001235	90.88	gold quality
leukocyte	CL:0000738	90.85	gold quality
jejunal mucosa	UBERON:0000399	90.50	gold quality
palpebral conjunctiva	UBERON:0001812	90.49	gold quality
islet of Langerhans	UBERON:0000006	90.46	gold quality
duodenum	UBERON:0002114	90.17	gold quality
eye	UBERON:0000970	90.15	gold quality
right lobe of liver	UBERON:0001114	90.12	gold quality
gall bladder	UBERON:0002110	90.08	gold quality
germinal epithelium of ovary	UBERON:0001304	89.94	gold quality
caput epididymis	UBERON:0004358	89.64	gold quality
ovary	UBERON:0000992	89.58	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

78 targeting BET1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-4673	100.00	66.64	1490
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-186-5P	99.99	70.83	3707
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-4645-5P	99.98	65.81	1284
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-548AT-5P	99.96	70.83	2666
HSA-MIR-3658	99.96	73.87	4379
HSA-MIR-23A-3P	99.95	74.24	3163
HSA-MIR-23B-3P	99.95	74.24	3163
HSA-MIR-23C	99.95	73.92	3192
HSA-MIR-1-3P	99.93	72.35	1914
HSA-MIR-206	99.93	72.50	1893
HSA-MIR-4760-3P	99.93	70.50	2385
HSA-MIR-552-5P	99.93	68.56	1583
HSA-MIR-6835-3P	99.93	70.49	2904
HSA-MIR-338-5P	99.92	72.34	2951
HSA-MIR-10527-5P	99.91	72.28	3754
HSA-MIR-613	99.91	71.50	1710
HSA-MIR-7-1-3P	99.91	71.53	4384
HSA-MIR-7-2-3P	99.91	71.40	4394
HSA-MIR-3529-3P	99.90	73.55	3045
HSA-MIR-345-3P	99.89	70.23	1421
HSA-MIR-182-5P	99.87	74.03	2589
HSA-MIR-2052	99.79	69.37	2031
HSA-MIR-4694-3P	99.79	69.53	2640

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 29.3% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 4)

• The results suggest the recruitment of Bet1 at an early stage after Membrane type 1-matrix metalloproteinase (MT1-MMP) expression promotes the exit of MT1-MMP from the endoplasmic reticulum (ER) and its efficient transport to invadopodia. (PMID:31519727)
• BET1 variants establish impaired vesicular transport as a cause for muscular dystrophy with epilepsy. (PMID:34779586)
• Large-scale genetic screens identify BET-1 as a cytoskeleton regulator promoting actin function and life span. (PMID:36404134)
• The distinct localizations of rsec22 and rbet1 may reflect their participation in opposite directions of membrane flow between the endoplasmic reticulum and Golgi apparatus. (PMID:8621431)

Cross-species orthologs

0 orthologs

Protein

Protein identifiers

BET1 homolog — O15155 (reviewed: O15155)

Alternative names: Golgi vesicular membrane-trafficking protein p18

All UniProt accessions (6): O15155, A0A3B3IU16, C9JTT8, H7C1N3, Q53XK0, Q68DU7

UniProt curated annotations — full annotation on UniProt →

Function. Required for vesicular transport from the ER to the Golgi complex. Functions as a SNARE involved in the docking process of ER-derived vesicles with the cis-Golgi membrane.

Subunit / interactions. Interacts with SNARE complex members GOSR2, SEC22B and STX5. Interacts with LMAN1/ERGIC53. Interacts with STX17.

Subcellular location. Endoplasmic reticulum membrane. Golgi apparatus. cis-Golgi network membrane. Golgi apparatus membrane.

Tissue specificity. Expressed in muscle.

Disease relevance. Muscular dystrophy, congenital, with rapid progression (MDRP) [MIM:254100] An autosomal recessive congenital disease that manifests with severely progressive muscular dystrophy, and results in death in infancy or early childhood. Clinical features include hypotonia and poor feeding, delayed motor development, progressive weakness and lethargy, and respiratory insufficiency. Some patients may have refractory epilepsy and cataracts. The disease may be caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the BET1 family.

Isoforms (2)

UniProt ID	Names	Canonical?
O15155-1	1	yes
O15155-2	2

RefSeq proteins (2): NP_001304668, NP_005859* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000727	T_SNARE_dom	Domain
IPR039899	BET1_SNARE	Domain

UniProt features (9 total): topological domain 2, sequence variant 2, chain 1, transmembrane region 1, domain 1, modified residue 1, splice variant 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
3EGX	X-RAY DIFFRACTION	3.3

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O15155-F1	83.80	0.58

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 50

Function

Pathways and Gene Ontology

Reactome pathways

9 pathways

ID	Pathway
R-HSA-204005	COPII-mediated vesicle transport
R-HSA-6807878	COPI-mediated anterograde transport
R-HSA-199977	ER to Golgi Anterograde Transport
R-HSA-199991	Membrane Trafficking
R-HSA-392499	Metabolism of proteins
R-HSA-446203	Asparagine N-linked glycosylation
R-HSA-5653656	Vesicle-mediated transport
R-HSA-597592	Post-translational protein modification
R-HSA-948021	Transport to the Golgi and subsequent modification

MSigDB gene sets: 227 (showing top): BORCZUK_MALIGNANT_MESOTHELIOMA_UP, GOBP_VESICLE_ORGANIZATION, GOBP_MEMBRANE_FUSION, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_DN, GOBP_VESICLE_MEDIATED_TRANSPORT, REACTOME_MEMBRANE_TRAFFICKING, PUJANA_CHEK2_PCC_NETWORK, GOBP_ENDOPLASMIC_RETICULUM_TO_GOLGI_VESICLE_MEDIATED_TRANSPORT, RUTELLA_RESPONSE_TO_CSF2RB_AND_IL4_UP, GOBP_ORGANELLE_MEMBRANE_FUSION, HESS_TARGETS_OF_HOXA9_AND_MEIS1_UP, RUTELLA_RESPONSE_TO_HGF_VS_CSF2RB_AND_IL4_DN, ACATTCC_MIR1_MIR206, GOBP_ENDOMEMBRANE_SYSTEM_ORGANIZATION

GO Biological Process (4): endoplasmic reticulum to Golgi vesicle-mediated transport (GO:0006888), protein transport (GO:0015031), vesicle fusion with Golgi apparatus (GO:0048280), vesicle-mediated transport (GO:0016192)

GO Molecular Function (2): SNAP receptor activity (GO:0005484), protein binding (GO:0005515)

GO Cellular Component (10): Golgi membrane (GO:0000139), endoplasmic reticulum (GO:0005783), endoplasmic reticulum membrane (GO:0005789), cis-Golgi network (GO:0005801), membrane (GO:0016020), transport vesicle (GO:0030133), SNARE complex (GO:0031201), endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116), Golgi apparatus (GO:0005794), endomembrane system (GO:0012505)

Reactome top-level categories

Rollup of top-7 pathways:

Category	Pathways
ER to Golgi Anterograde Transport	2
Membrane Trafficking	1
Transport to the Golgi and subsequent modification	1
Vesicle-mediated transport	1
Post-translational protein modification	1
Metabolism of proteins	1
Asparagine N-linked glycosylation	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cytoplasm	4
endomembrane system	3
intracellular membrane-bounded organelle	3
Golgi vesicle transport	2
transport	2
Golgi apparatus	2
bounding membrane of organelle	2
cellular anatomical structure	2
intercellular transport	1
intracellular transport	1
intracellular protein localization	1
establishment of protein localization	1
vesicle fusion	1
Golgi organization	1
cellular process	1
protein-macromolecule adaptor activity	1
membrane fusion	1
fusogenic activity	1
binding	1
organelle membrane	1
nuclear outer membrane-endoplasmic reticulum membrane network	1
endoplasmic reticulum subcompartment	1
cytoplasmic vesicle	1
membrane protein complex	1
endoplasmic reticulum-Golgi intermediate compartment	1
vacuole	1
plasma membrane	1

Protein interactions and networks

STRING

1362 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
BET1	STX5	Q13190	999
BET1	GOSR2	O14653	998
BET1	SEC22B	O75396	996
BET1	SCFD1	Q8WVM8	981
BET1	GOSR1	O95249	969
BET1	SEC22A	Q96IW7	953
BET1	VAMP7	P51809	952
BET1	VTI1B	Q9UEU0	945
BET1	VTI1A	Q96AJ9	908
BET1	YKT6	O15498	881
BET1	SEC22C	Q9BRL7	871
BET1	SEC24B	O95487	854
BET1	STX6	O43752	797
BET1	STX7	O15400	758
BET1	TRAPPC3	O43617	754

IntAct

212 interactions, top by confidence:

A	B	Type	Score
GOSR2	BET1	psi-mi:“MI:0915”(physical association)	0.810
GOSR2	BET1	psi-mi:“MI:0914”(association)	0.810
NAPA	SNAP23	psi-mi:“MI:0914”(association)	0.780
BET1	STX4	psi-mi:“MI:0915”(physical association)	0.720
STX4	BET1	psi-mi:“MI:0915”(physical association)	0.720
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
TRDN	TMEM223	psi-mi:“MI:0914”(association)	0.640
BET1	NSF	psi-mi:“MI:0914”(association)	0.570
BET1	MAGEA6	psi-mi:“MI:0915”(physical association)	0.560
MAGEA6	BET1	psi-mi:“MI:0915”(physical association)	0.560
BET1	CGRRF1	psi-mi:“MI:0915”(physical association)	0.560
BET1	KCNJ6	psi-mi:“MI:0915”(physical association)	0.560
BET1	FAM210B	psi-mi:“MI:0915”(physical association)	0.560
BET1	CYB561	psi-mi:“MI:0915”(physical association)	0.560
BET1	AQP6	psi-mi:“MI:0915”(physical association)	0.560
BET1	MGST3	psi-mi:“MI:0915”(physical association)	0.560
BET1	CYBC1	psi-mi:“MI:0915”(physical association)	0.560
BET1	ANKS6	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (487): BET1 (Two-hybrid), BET1 (Two-hybrid), BCL2L13 (Two-hybrid), CCDC155 (Two-hybrid), FAM9B (Two-hybrid), BET1 (Affinity Capture-MS), USHBP1 (Two-hybrid), BET1 (Co-fractionation), BET1 (Co-fractionation), BET1 (Co-fractionation), USHBP1 (Affinity Capture-Western), BET1 (Proximity Label-MS), BET1 (Proximity Label-MS), BET1 (Proximity Label-MS), BET1 (Proximity Label-MS)

ESM2 similar proteins: O02495, O15155, O23429, O35623, O94651, O95183, P13701, P18489, P23763, P32867, P34351, P35589, P47192, P47193, P47194, P63024, P63025, P63026, P63027, P63044, P63045, P78768, P93654, Q04338, Q09730, Q0V7N0, Q15836, Q20574, Q27236, Q2KJD2, Q4R8T0, Q54GB3, Q5RBX2, Q60WU2, Q62442, Q62896, Q63666, Q6TMJ9, Q7XIE2, Q8VXX9

Diamond homologs: O13932, O15155, O35623, P22804, Q62896, O35152, O35153, Q3MHP8, Q5RBX2, Q68EL3, Q9M2J9, Q9NYM9, Q553P5

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 98 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
COPII-mediated vesicle transport	5	15.7×	2e-03
COPI-dependent Golgi-to-ER retrograde traffic	6	12.8×	2e-03
Golgi-to-ER retrograde transport	5	12.8×	3e-03
Intra-Golgi and retrograde Golgi-to-ER traffic	5	10.1×	5e-03

GO biological processes:

GO term	Partners	Fold	FDR
exocytosis	8	14.5×	2e-05
response to endoplasmic reticulum stress	5	9.9×	7e-03
intracellular protein transport	9	6.9×	6e-04
cilium assembly	7	6.1×	7e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

24 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	2
Uncertain significance	17
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (2)

Variant ID	HGVS	Classification
148490	GRCh38/hg38 7q21.2-21.3(chr7:92945146-94512098)x1	Likely pathogenic
4849350	NM_005868.6(BET1):c.213dup (p.Asp72Ter)	Likely pathogenic

SpliceAI

392 predictions. Top by Δscore:

Variant	Effect	Δscore
7:93999164:ACTT:A	donor_loss	1.0000
7:93999166:TTACA:T	donor_loss	1.0000
7:93999167:TA:T	donor_loss	1.0000
7:93999168:A:AC	donor_gain	1.0000
7:93999168:A:C	donor_loss	1.0000
7:93999169:C:A	donor_loss	1.0000
7:93999169:C:CA	donor_gain	1.0000
7:93999169:CA:C	donor_gain	1.0000
7:93999169:CAG:C	donor_gain	1.0000
7:93999169:CAGA:C	donor_gain	1.0000
7:93999169:CAGAT:C	donor_gain	1.0000
7:93996320:AGC:A	acceptor_loss	0.9900
7:93996322:C:CC	acceptor_gain	0.9900
7:93999183:G:C	donor_gain	0.9900
7:93999292:CAC:C	acceptor_gain	0.9900
7:93999295:C:CC	acceptor_gain	0.9900
7:93999295:CTG:C	acceptor_loss	0.9900
7:93999296:T:A	acceptor_loss	0.9900
7:94004200:AGG:A	donor_gain	0.9900
7:93996317:GAAAG:G	acceptor_gain	0.9800
7:93996319:AAG:A	acceptor_gain	0.9800
7:93996320:AG:A	acceptor_gain	0.9800
7:93996321:GCTAT:G	acceptor_gain	0.9800
7:93999162:ATACT:A	donor_loss	0.9800
7:93999163:TACTT:T	donor_loss	0.9800
7:93996318:AAAG:A	acceptor_gain	0.9700
7:93996324:A:C	acceptor_gain	0.9700
7:94004196:A:AC	donor_gain	0.9700
7:94004197:C:CC	donor_gain	0.9700
7:93994383:ATCCT:A	acceptor_loss	0.9600

AlphaMissense

771 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
7:93999198:A:G	L39P	0.999
7:93999173:T:A	K47N	0.998
7:93999173:T:G	K47N	0.998
7:93999174:T:A	K47I	0.998
7:93994333:A:G	L85P	0.997
7:93999177:A:T	I46K	0.997
7:93999181:C:G	A45P	0.997
7:93996318:A:G	S50P	0.996
7:93996320:A:G	L49P	0.996
7:93999189:T:A	K42I	0.996
7:93994267:A:T	V107D	0.995
7:93996308:A:T	I53K	0.995
7:93996317:G:A	S50F	0.995
7:93999175:T:C	K47E	0.995
7:93999177:A:C	I46R	0.995
7:93994354:A:G	L78P	0.994
7:93996308:A:C	I53R	0.994
7:93999198:A:T	L39Q	0.994
7:93999210:A:G	L35P	0.994
7:93996305:C:A	G54V	0.993
7:93996317:G:T	S50Y	0.993
7:93999172:A:G	S48P	0.993
7:93996275:A:G	L64S	0.992
7:93996296:A:T	V57D	0.992
7:93999198:A:C	L39R	0.992
7:93994285:A:T	M101K	0.991
7:93994354:A:T	L78Q	0.991
7:93994278:A:C	F103L	0.990
7:93994278:A:T	F103L	0.990
7:93994280:A:G	F103L	0.990

dbSNP variants (sampled 300 via entrez): RS1000086272 (7:94000034 T>G), RS1000090132 (7:93962927 C>A,T), RS1000331236 (7:93990618 T>C), RS1000376574 (7:93988392 G>A), RS1000438265 (7:93965961 C>T), RS1000476962 (7:93996763 G>A), RS1000478256 (7:93997450 C>T), RS1000490656 (7:93990128 C>T), RS1000602234 (7:93983307 C>T), RS1000697052 (7:93978040 T>C), RS1000698751 (7:93998339 G>A), RS1000703110 (7:93990837 T>C,G), RS1000709133 (7:93989668 G>A,T), RS1000741519 (7:93984265 A>G), RS1000959072 (7:93969522 ATAGATGCTGGACTTTTCCCC>A)

Disease associations

OMIM: gene MIM:605456 | disease phenotypes: MIM:254100

GenCC curated gene-disease

Disease	Classification	Inheritance
muscular dystrophy, congenital, with rapid progression	Moderate	Autosomal recessive

Mondo (1): muscular dystrophy, congenital, with rapid progression (MONDO:0009682)

Orphanet (0):

HPO phenotypes

4 total (4 of 4 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0001324	Muscle weakness
HP:0003560	Muscular dystrophy
HP:0003678	Rapidly progressive

GWAS associations

5 associations (top):

Study	Trait	p-value
GCST001599_6	Aging	6.000000e-07
GCST001762_557	Obesity-related traits	2.000000e-06
GCST002915_6	Asparaginase hypersensitivity in acute lymphoblastic leukemia	5.000000e-06
GCST003458_3	World class endurance athleticism	3.000000e-06
GCST006719_4	BRCA1/2-negative high-risk breast cancer	1.000000e-06

EFO canonical traits (5, from GWAS)

EFO ID	Trait name
EFO:0022597	aging
EFO:0004736	aspartate aminotransferase measurement
EFO:0004881	asparaginase hypersensitivity
EFO:0007818	athletic endurance measurement
EFO:0009443	BRCAX breast cancer

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
C564983	Muscular Dystrophy, Congenital, with Rapid Progression (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5291676 (PROTEIN-PROTEIN INTERACTION)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

1 potent at pChembl≥5 of 1 total, top 1 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
6.37	EC50	430	nM	CHEMBL5287110

PubChem BioAssay actives

1 with measured affinity, of 2 total; 1 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
[2-(2,6-dioxopiperidin-3-yl)-1,3-dioxoisoindol-4-yl] N-[4-[[2-[(9S)-7-(4-chlorophenyl)-4,5,13-trimethyl-3-thia-1,8,11,12-tetrazatricyclo[8.3.0.02,6]trideca-2(6),4,7,10,12-pentaen-9-yl]acetyl]amino]butyl]carbamate	1928089: PROTAC activity at dBET1/CRBN in human SUM149 cells measured after 18 hrs	ec50	0.4300	uM

CTD chemical–gene interactions

36 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Cyclosporine	increases expression	4
Valproic Acid	decreases methylation, increases expression	2
Cadmium Chloride	decreases expression, increases abundance, increases expression	2
Particulate Matter	decreases expression, increases abundance	2
FR900359	decreases phosphorylation	1
dicrotophos	decreases expression	1
triphenyl phosphate	affects expression	1
pirinixic acid	increases activity, increases expression, affects binding	1
bisphenol A	increases expression	1
arsenite	affects binding, increases reaction	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
sodium arsenite	decreases expression, increases abundance	1
di-n-butylphosphoric acid	affects expression	1
perfluorooctane sulfonic acid	increases expression	1
4-methoxycinnamate methyl ester	affects cotreatment, decreases expression	1
CGP 52608	affects binding, increases reaction	1
Resveratrol	increases expression	1
Sunitinib	increases expression	1
Acetaminophen	decreases expression	1
Air Pollutants	decreases expression, increases abundance	1
Arsenic	decreases expression, increases abundance	1
Cadmium	increases abundance, increases expression	1
Diuron	decreases expression	1
Estradiol	decreases expression	1
Ethyl Methanesulfonate	increases expression	1
Ivermectin	decreases expression	1
Methyl Methanesulfonate	increases expression	1
Progesterone	increases expression	1
Rotenone	increases expression	1
Tobacco Smoke Pollution	increases expression	1

ChEMBL screening assays

2 unique, capped per target: 2 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5231273	Binding	PROTAC activity at dBET1/CRBN in human SUM149 cells measured after 18 hrs	Recent advances in epigenetic proteolysis targeting chimeras (Epi-PROTACs). — Eur J Med Chem

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.