BLCAP

Summary

BLCAP (BLCAP apoptosis inducing factor, HGNC:1055) is a protein-coding gene on chromosome 20q11.23, encoding Apoptosis inducing factor BLCAP (P62952). Acts as a tumor suppressor; induces growth arrest at G(1)/S checkpoint and apoptosis via RB1-dependent and p53/TP53- and NF-kappa-B-independent mechanisms.

This gene encodes a protein that reduces cell growth by stimulating apoptosis. Alternative splicing and the use of alternative promoters result in multiple transcript variants encoding the same protein. This gene is imprinted in brain where different transcript variants are expressed from each parental allele. Transcript variants initiating from the upstream promoter are expressed preferentially from the maternal allele, while transcript variants initiating downstream of the interspersed NNAT gene (GeneID:4826) are expressed from the paternal allele. Transcripts at this locus may also undergo A to I editing, resulting in amino acid changes at three positions in the N-terminus of the protein.

Source: NCBI Gene 10904 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 22 total
• GTEx eGene: eQTL in 14 tissues, sQTL in 4 (q < 0.05)
• Constraint (gnomAD): pLI 0.72 (intermediate), LOEUF 0.81 (unconstrained)
• MANE Select transcript: NM_006698

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:1055
Approved symbol	BLCAP
Name	BLCAP apoptosis inducing factor
Location	20q11.23
Locus type	gene with protein product
Status	Approved
Aliases	BC10
Ensembl gene	ENSG00000166619
Ensembl biotype	protein_coding
OMIM	613110
Entrez	10904

Gene structure

Transcript identifiers

Ensembl transcripts: 31 — 27 protein_coding, 4 protein_coding_CDS_not_defined

MANE Select: ENST00000373537

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 2, TSL 3: 6, TSL 4: 5

ENST00000373537, ENST00000397131, ENST00000397134, ENST00000397135, ENST00000397137, ENST00000411780, ENST00000414080, ENST00000414542, ENST00000432507, ENST00000445723, ENST00000447625, ENST00000456058, ENST00000467603, ENST00000613961, ENST00000894262, ENST00000894263, ENST00000894264, ENST00000894265, ENST00000894266, ENST00000894267, ENST00000917217, ENST00000917218, ENST00000917219, ENST00000917220, ENST00000963567, ENST00000963568, ENST00000963569, ENST00000963570, ENST00000963571, ENST00000963572, ENST00001134331

RefSeq mRNA: 7 — MANE Select: NM_006698 NM_001167820, NM_001167821, NM_001167822, NM_001167823, NM_001317074, NM_001317075, NM_006698

CCDS: CCDS13295

Canonical transcript exons

ENST00000373537 — 2 exons

Exon	Start	End
ENSE00001527437	37517417	37519350
ENSE00003842570	37527793	37527876

Expression profiles

Bgee: expression breadth ubiquitous, 294 present calls, max score 99.74.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 65.0875 / max 665.6993, expressed in 1822 samples.

Highest expression (Bgee): secondary oocyte, oocyte, nucleus accumbens, middle frontal gyrus, tibialis anterior.

Genetic regulation across tissues (GTEx eQTL / sQTL)

BLCAP is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 14 tissues and its splicing (sQTL) in 4 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

18 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Esophagus Mucosa	eqtl	4.3e-24	-0.31	20:37529088:A:C
Artery Tibial	eqtl	5.3e-08	-0.21	20:37473881:G:A
Nerve Tibial	eqtl	8.5e-05	+0.18	20:37466486:C:T
Brain Caudate basal ganglia	eqtl	6.4e-04	+0.09	20:37454878:T:C
Cells Cultured fibroblasts	eqtl	7.8e-04	+0.09	20:37443705:G:GC
Heart Atrial Appendage	sqtl	8.8e-04	+0.44	20:37513430:T:A
Skin Not Sun Exposed Suprapubic	eqtl	9.9e-04	+0.15	20:37473881:G:A
Artery Aorta	eqtl	2.9e-03	-0.20	20:37469522:T:C
Skin Sun Exposed Lower leg	sqtl	4.5e-03	+0.33	20:37555717:T:G
Thyroid	eqtl	6.8e-03	-0.51	20:38311010:C:T
Skin Not Sun Exposed Suprapubic	sqtl	7.0e-03	+0.31	20:37567180:C:T
Pancreas	eqtl	8.6e-03	+0.25	20:37466486:C:T
Skin Sun Exposed Lower leg	eqtl	1.1e-02	+0.10	20:37505832:A:G
Testis	eqtl	1.3e-02	+0.16	20:37562294:T:C
Stomach	eqtl	1.4e-02	-0.35	20:37264022:C:T
Colon Sigmoid	sqtl	1.9e-02	+0.72	20:38389167:G:C
Adipose Subcutaneous	eqtl	2.3e-02	+0.27	20:37612831:CTGGGATCATCCCAGTTTGG:C
Brain Cortex	eqtl	4.7e-02	-0.21	20:37886262:G:A

FANTOM5 promoters

7 alternative TSS:

Promoter ID	TPM avg	Samples expressed
187200	52.7137	1821
187199	9.0444	1690
187201	2.9019	1530
187196	0.2951	45
187198	0.0531	12
187197	0.0529	21
187195	0.0264	10

Top tissues by expression

showing 100 of 295 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
secondary oocyte	CL:0000655	99.74	gold quality
oocyte	CL:0000023	99.34	gold quality
nucleus accumbens	UBERON:0001882	99.10	gold quality
middle frontal gyrus	UBERON:0002702	99.05	gold quality
tibialis anterior	UBERON:0001385	99.02	gold quality
gluteal muscle	UBERON:0002000	99.00	gold quality
gastrocnemius	UBERON:0001388	98.98	gold quality
right uterine tube	UBERON:0001302	98.93	gold quality
deltoid	UBERON:0001476	98.81	gold quality
adenohypophysis	UBERON:0002196	98.69	gold quality
Brodmann (1909) area 23	UBERON:0013554	98.68	gold quality
pituitary gland	UBERON:0000007	98.66	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	98.63	gold quality
frontal pole	UBERON:0002795	98.55	gold quality
caudate nucleus	UBERON:0001873	98.53	gold quality
muscle of leg	UBERON:0001383	98.52	gold quality
hindlimb stylopod muscle	UBERON:0004252	98.50	gold quality
triceps brachii	UBERON:0001509	98.48	gold quality
superior vestibular nucleus	UBERON:0007227	98.45	gold quality
muscle organ	UBERON:0001630	98.43	gold quality
middle temporal gyrus	UBERON:0002771	98.42	gold quality
vastus lateralis	UBERON:0001379	98.41	gold quality
hypothalamus	UBERON:0001898	98.39	gold quality
putamen	UBERON:0001874	98.35	gold quality
quadriceps femoris	UBERON:0001377	98.22	gold quality
skeletal muscle tissue	UBERON:0001134	98.20	gold quality
lateral nuclear group of thalamus	UBERON:0002736	98.10	gold quality
superior frontal gyrus	UBERON:0002661	98.08	gold quality
pons	UBERON:0000988	98.00	gold quality
forebrain	UBERON:0001890	97.96	gold quality
Brodmann (1909) area 9	UBERON:0013540	97.95	gold quality
substantia nigra pars compacta	UBERON:0001965	97.94	gold quality
amygdala	UBERON:0001876	97.92	gold quality
prefrontal cortex	UBERON:0000451	97.89	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	97.89	gold quality
telencephalon	UBERON:0001893	97.88	gold quality
cingulate cortex	UBERON:0003027	97.88	gold quality
temporal lobe	UBERON:0001871	97.87	gold quality
anterior cingulate cortex	UBERON:0009835	97.86	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	97.83	gold quality
primary visual cortex	UBERON:0002436	97.81	gold quality
paraflocculus	UBERON:0005351	97.79	gold quality
Brodmann (1909) area 46	UBERON:0006483	97.78	gold quality
parietal lobe	UBERON:0001872	97.77	gold quality
nipple	UBERON:0002030	97.76	gold quality
frontal cortex	UBERON:0001870	97.75	gold quality
postcentral gyrus	UBERON:0002581	97.75	gold quality
cerebral cortex	UBERON:0000956	97.74	gold quality
biceps brachii	UBERON:0001507	97.74	gold quality
entorhinal cortex	UBERON:0002728	97.74	gold quality
neocortex	UBERON:0001950	97.72	gold quality
lateral globus pallidus	UBERON:0002476	97.72	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	97.72	gold quality
brain	UBERON:0000955	97.71	gold quality
ventral tegmental area	UBERON:0002691	97.70	gold quality
Ammon’s horn	UBERON:0001954	97.68	gold quality
occipital lobe	UBERON:0002021	97.68	gold quality
right frontal lobe	UBERON:0002810	97.66	gold quality
diaphragm	UBERON:0001103	97.64	gold quality
central nervous system	UBERON:0001017	97.63	gold quality
medulla oblongata	UBERON:0001896	97.62	gold quality
cortical plate	UBERON:0005343	97.60	gold quality
Brodmann (1909) area 10	UBERON:0013541	97.59	gold quality
body of tongue	UBERON:0011876	97.51	gold quality
substantia nigra pars reticulata	UBERON:0001966	97.44	gold quality
medial globus pallidus	UBERON:0002477	97.40	gold quality
choroid plexus epithelium	UBERON:0003911	97.37	gold quality
muscle tissue	UBERON:0002385	97.36	gold quality
pharyngeal mucosa	UBERON:0000355	97.35	gold quality
globus pallidus	UBERON:0001875	97.22	gold quality
skin of leg	UBERON:0001511	97.16	gold quality
CA1 field of hippocampus	UBERON:0003881	97.16	gold quality
renal medulla	UBERON:0000362	97.15	gold quality
tongue squamous epithelium	UBERON:0006919	97.14	gold quality
skin of abdomen	UBERON:0001416	97.10	gold quality
esophagus squamous epithelium	UBERON:0006920	97.06	gold quality
endothelial cell	CL:0000115	97.03	gold quality
tongue	UBERON:0001723	97.01	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	97.00	gold quality
midbrain	UBERON:0001891	96.99	gold quality
orbitofrontal cortex	UBERON:0004167	96.96	gold quality
substantia nigra	UBERON:0002038	96.93	gold quality
cerebellar hemisphere	UBERON:0002245	96.87	gold quality
cerebellar cortex	UBERON:0002129	96.85	gold quality
esophagus mucosa	UBERON:0002469	96.83	gold quality
inferior olivary complex	UBERON:0002127	96.78	gold quality
cerebellum	UBERON:0002037	96.77	gold quality
zone of skin	UBERON:0000014	96.76	gold quality
right hemisphere of cerebellum	UBERON:0014890	96.73	gold quality
buccal mucosa cell	CL:0002336	96.65	gold quality
epithelium of nasopharynx	UBERON:0001951	96.64	gold quality
epithelium of esophagus	UBERON:0001976	96.56	gold quality
apex of heart	UBERON:0002098	96.56	gold quality
vagina	UBERON:0000996	96.48	gold quality
gingival epithelium	UBERON:0001949	96.37	gold quality
squamous epithelium	UBERON:0006914	96.33	gold quality
penis	UBERON:0000989	96.32	gold quality
lower esophagus mucosa	UBERON:0035834	96.31	gold quality
fallopian tube	UBERON:0003889	96.24	gold quality
prostate gland	UBERON:0002367	96.22	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-GEOD-93593	yes	1521.68
E-HCAD-5	yes	641.19
E-ANND-3	yes	16.72

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 76 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM
Basal ganglia	tissue	1196.4
Septum	tissue	1092.6
Ventral forebrain	tissue	969.4
Hypothalamus	tissue	932.5
Putamen	tissue	842.4
Hippocampal formation	tissue	835.0
Thalamus	tissue	730.5
Amygdala	tissue	718.3
Prefrontal cortex	tissue	696.9
Cerebral cortex	tissue	696.9
Pons	tissue	690.6
Motor cortex	tissue	689.2
Somatosensory cortex	tissue	653.1
Retrosplenial and cingulate cortex	tissue	652.7
Substantia nigra	tissue	630.5
Retrosplenial cortex	tissue	626.2
Midbrain	tissue	607.9
Entorhinal cortex	tissue	587.7
Periaqueductal gray	tissue	584.4
Superior colliculi	tissue	583.2
Temporal cortex	tissue	579.2
Insular cortex	tissue	579.1
Occipital cortex	tissue	577.6
Medulla oblongata	tissue	480.4
Cerebellum	tissue	416.4
Spinal cord	tissue	372.0
Olfactory bulb	tissue	366.9
Skeletal muscle	tissue	316.5
Nucleus accumbens	tissue	280.0
Corpus callosum	tissue	254.0
Choroid plexus	tissue	219.7
Locus coeruleus	tissue	192.1
Postcentral gyrus	tissue	156.6
Hippocampus	tissue	147.3
Pituitary gland	tissue	145.4
Fallopian tube	tissue	132.7
Tongue	tissue	112.2
Skin 1	tissue	83.4
Caudate putamen	tissue	82.1
Frontal cortex	tissue	72.4
Placenta	tissue	71.4
Liver	tissue	66.1
Retina	tissue	65.7
Heart muscle	tissue	65.6
Vagina	tissue	58.9
Kidney	tissue	55.8
Adipose tissue	tissue	53.4
Seminal vesicle	tissue	53.1
Urinary bladder	tissue	52.6
Tonsil	tissue	49.7
Epididymis	tissue	49.5
Rectum	tissue	49.0
Prostate	tissue	49.0
Esophagus	tissue	48.8
Salivary gland	tissue	48.4
Duodenum	tissue	48.1
Parathyroid gland	tissue	47.8
Small intestine	tissue	43.7
Adrenal gland	tissue	43.4
Breast	tissue	42.7

Brain sub-regions (HPA Brain Atlas): detected in 189; highest nTPM — Ventral hippocampus (835.0), Subiculum (752.2), Dorsal hippocampus (702.4), Dorsal spinal cord (372.0), Ventral spinal cord (323.9).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): GATA3

miRNA regulators (miRDB)

Targeting BLCAP by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 147 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-3925-3P	100.00	69.95	1237
HSA-MIR-513B-5P	99.99	69.96	2150
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-19A-3P	99.98	75.33	2762
HSA-MIR-19B-3P	99.98	75.44	2754
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-9-3P	99.96	70.88	2068
HSA-MIR-302E	99.96	70.74	2669
HSA-MIR-6778-3P	99.96	67.29	2693
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-23A-3P	99.95	74.24	3163
HSA-MIR-23B-3P	99.95	74.24	3163
HSA-MIR-23C	99.95	73.92	3192
HSA-MIR-6755-5P	99.95	65.59	464
HSA-MIR-651-3P	99.94	73.48	5177
HSA-MIR-548J-3P	99.94	72.61	4881
HSA-MIR-539-5P	99.93	70.30	2855
HSA-MIR-548AE-3P	99.93	72.66	4867
HSA-MIR-548AH-3P	99.93	72.54	4872
HSA-MIR-548AM-3P	99.93	72.54	4872

Functional genomics

gnomAD constraint: pLI 0.719, LOEUF 0.81, missense Z 1.59 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000373537 — one region, missense o/e 0.61.

Literature-anchored findings (GeneRIF, showing 12)

• might be a potential tumor suppressor gene in cervical carcinoma. (PMID:16675915)
• BLCAP may play a role not only in regulating cell proliferation but also in coordinating apoptosis and cell cycle via a novel way independent of p53 and NF-kappaB. (PMID:17031575)
• Blcap is imprinted in mouse and human brain, but not in other mouse tissues. (PMID:18836209)
• Data show that loss of BLCAP expression is associated with tumor progression. (PMID:19783793)
• observed a general decrease in BLCAP-editing level in astrocytomas, bladder cancer and colorectal cancer when compared with the related normal tissues (PMID:19908260)
• Immunoexpression analysis and prognostic value of BLCAP in breast cancer (PMID:23049907)
• Data show that the RNA-edited bladder cancer associated protein (BLCAP) gene may stably promote cell proliferation. (PMID:25499081)
• the functional association of BLCAP and Rb1 might play important roles in proliferation and apoptosis of HeLa cells. (PMID:26986503)
• Upregulated miR-9-3p has a positive role in human MTC progression by regulating the growth and apoptosis of cancer cells via targeting BLCAP. (PMID:27938505)
• Our findings reveal that A-to-I RNA editing events alter the genetically coded amino acid in BLCAP YXXQ motif, which drive the progression of cervical carcinogenesis through regulating STAT3 signaling pathway. (PMID:28455960)
• data indicates that Blcap is a novel Stat3 interaction partner and suggests a role for Blcap in the Stat3-mediated progression of precancerous lesions to invasive tumors of the bladder (PMID:29190807)
• MALAT1 regulates BLCAP mRNA expression through binding to miR-339-5p. (PMID:30683807)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	blcap	ENSDARG00000052073
mus_musculus	Blcap	ENSMUSG00000067787
rattus_norvegicus	Blcap	ENSRNOG00000024437
drosophila_melanogaster	bc10	FBGN0040239
caenorhabditis_elegans	Y73E7A.6	WBGENE00022273

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1858907) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 2 distinct phenotype terms.

Mouse phenotype (MP)	Records
decreased circulating alkaline phosphatase level	1
increased fasting circulating glucose level	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Felis catus	P62953	100.0%	Diamond
Bos taurus	P62954	100.0%	Diamond
Xenopus laevis	Q5EAT6	100.0%	Diamond
Xenopus tropicalis	Q5M8I8	100.0%	Diamond
Pongo abelii	Q5R692	100.0%	Diamond
Macaca fascicularis	Q4R504	98.9%	Diamond
Carassius auratus	Q90WT7	98.9%	Diamond
Didelphis virginiana	Q4G2S9	94.3%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
LINC00489	ncRNA	100861522
NNAT	protein-coding	4826
MANBAL	protein-coding	63905
SRC	protein-coding	6714
LINC01746	ncRNA	105372608

Protein

Protein identifiers

Apoptosis inducing factor BLCAP — P62952 (reviewed: P62952)

Alternative names: Bladder cancer 10 kDa protein, Bladder cancer-associated protein

All UniProt accessions (4): A0A1Y8ELN7, A2A2K8, A2A2K9, P62952

UniProt curated annotations — full annotation on UniProt →

Function. Acts as a tumor suppressor; induces growth arrest at G(1)/S checkpoint and apoptosis via RB1-dependent and p53/TP53- and NF-kappa-B-independent mechanisms. Modulates expression of genes involved in the regulation of proliferation, cell cycle and apoptosis.

Subunit / interactions. Interacts with RB1 (phosphorylated and unphosphorylated). Interacts with STAT3; the interaction is promoted by cell stimulation with IL6 and phosphorylation of STAT3.

Subcellular location. Cytoplasm. Nucleus. Membrane.

Tissue specificity. Cervical tissues (at protein level). Urothelium (at protein level). Endothelial cells of urinary bladder vessels (at protein level). Urinary bladder stromal cells (at protein level). Cervical tissues. Kidney. Ubiquitous.

Miscellaneous. Down-regulated in cervical carcinoma tissues. Expression in stage III-IV cervical carcinomas is significantly lower compared to stage I-II. Down-regulated in bladder carcinoma. Down-regulated in renal cell carcinoma. Down-regulated in colorectal cancerous tissues.

Similarity. Belongs to the BLCAP family.

RefSeq proteins (7): NP_001161292, NP_001161293, NP_001161294, NP_001161295, NP_001304003, NP_001304004, NP_006689* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR009598	BCALP	Family

Pfam: PF06726

UniProt features (9 total): sequence variant 3, mutagenesis site 3, transmembrane region 2, chain 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P62952-F1	63.24	0.00

Human Protein Atlas

Protein class: Predicted intracellular proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): nucleoli

Antibody reliability (HPA): IF approved

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Mutagenesis-validated functional residues (3)

Position	Phenotype
16–19	no significant effect on activity.
74	reduces activity.
78	no significant effect on activity.

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 0; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

MSigDB gene sets: 266 (showing top): CREL_01, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, GGTGTGT_MIR329, TGCACTT_MIR519C_MIR519B_MIR519A, ENK_UV_RESPONSE_KERATINOCYTE_UP, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GENTILE_RESPONSE_CLUSTER_D3, TGACCTY_ERR1_Q2, GGAMTNNNNNTCCY_UNKNOWN, CAIRO_HEPATOBLASTOMA_CLASSES_DN, MCBRYAN_PUBERTAL_BREAST_4_5WK_DN, CCTGTGA_MIR513, GATA1_01, KINSEY_TARGETS_OF_EWSR1_FLII_FUSION_DN, ACATTCC_MIR1_MIR206

GO Biological Process (2): apoptotic nuclear changes (GO:0030262), apoptotic process (GO:0006915)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (3): nucleus (GO:0005634), cytoplasm (GO:0005737), membrane (GO:0016020)

GO top-level categories

8 GO namespaces:

Category	Terms
cellular anatomical structure	2
cellular component disassembly involved in execution phase of apoptosis	1
programmed cell death	1
apoptotic signaling pathway	1
execution phase of apoptosis	1
binding	1
intracellular membrane-bounded organelle	1
intracellular anatomical structure	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 1 of 6 annotations. The rest are phylogenetic / computational / electronic (IEA).

1 experimentally-supported GO terms:

GO term	NS	Evidence
apoptotic nuclear changes	BP	direct assay

Protein interactions and networks

STRING

showing 15 of 506 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
BLCAP	NNAT	Q16517	966
BLCAP	COG3	Q96JB2	660
BLCAP	AZIN1	O14977	613
BLCAP	CYFIP2	Q96F07	582
BLCAP	CSNK2A1	P19138	551
BLCAP	ADAR	P55265	541
BLCAP	RBBP9	O75884	510
BLCAP	ASB4	Q9Y574	502
BLCAP	CHMP2A	O43633	497
BLCAP	CSNK2A2	P19784	490
BLCAP	GRB10	Q13322	486
BLCAP	NAP1L5	Q96NT1	466
BLCAP	PLAGL1	Q9UM63	462
BLCAP	KCNK9	Q9NPC2	452
BLCAP	SGCE	O43556	431

IntAct

Human interaction partners of BLCAP in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

17 partners by confidence:

Partner	Interaction type	MIscore	Records
NOTCH2NLA	physical association	0.670	4
ASGR1	physical association	0.560	3
CLDND2	physical association	0.560	3
CYSRT1	physical association	0.560	3
FAM241B	physical association	0.560	3
GIMAP1	physical association	0.560	3
GJA5	physical association	0.560	3
GOSR2	physical association	0.560	3
HOXA1	physical association	0.560	3
LEMD1	physical association	0.560	3
LRAT	physical association	0.560	3
MFSD5	physical association	0.560	3
SKAP1	physical association	0.560	3
SSMEM1	physical association	0.560	3
TMEM14B	physical association	0.560	3
TMEM237	physical association	0.560	3
ESR1	direct interaction	0.530	2

BioGRID (24 interactions; top human partners by supporting records): AGO2 (Affinity Capture-RNA), ASGR1 (Two-hybrid), C10orf35 (Two-hybrid), CLDND2 (Two-hybrid), CYSRT1 (Two-hybrid), DDX58 (Affinity Capture-RNA), ELAVL1 (Affinity Capture-RNA), GIMAP1 (Two-hybrid), GJA5 (Two-hybrid), GOSR2 (Two-hybrid), HNRNPH1 (Affinity Capture-RNA), HOXA1 (Two-hybrid), LEMD1 (Two-hybrid), LRAT (Two-hybrid), MFSD5 (Two-hybrid)

Disease & clinical

Genetic variants

Variant evidence for BLCAP: 22 ClinVar records (0 pathogenic / likely pathogenic); 1 GWAS association.

ClinVar

22 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	16
Likely benign	0
Benign	0

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 21 predictions of 242):

Position(s)	Effect	Δscore	Sites
20:37527791–37527792	donor_loss	0.9900	6
20:37526855	donor_gain	0.9800
20:37527793	donor_loss	0.9500
20:37527140	donor_gain	0.9400
20:37527793	donor_loss	0.9400
20:37527795	donor_gain	0.8900
20:37523636–37523637	donor_gain	0.8500	2
20:37519351–37519352	acceptor_loss	0.8300	6
20:37519366	acceptor_loss	0.7900
20:37527136	donor_gain	0.7900

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Disease associations

OMIM: gene MIM:613110 | disease phenotypes:

GWAS associations

1 associations:

Study	Trait	p-value
GCST007843_28	Rheumatoid arthritis	4e-13

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

40 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, increases expression	3
aristolochic acid I	increases expression, decreases reaction, decreases expression	2
trichostatin A	affects cotreatment, decreases expression	2
sodium arsenite	affects expression, affects cotreatment, decreases expression, increases abundance	2
Arsenic	affects methylation, affects cotreatment, decreases expression, increases abundance	2
Cisplatin	increases expression, affects cotreatment	2
methylmercuric chloride	decreases expression	1
triphenyl phosphate	affects expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
ochratoxin A	decreases expression	1
resorcinol	increases expression	1
azoxystrobin	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
jinfukang	affects cotreatment, increases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Temozolomide	decreases expression	1
Decitabine	decreases expression, decreases reaction	1
Vorinostat	decreases expression	1
Leflunomide	decreases expression	1
Vehicle Emissions	decreases expression, increases abundance	1
Doxorubicin	increases expression	1
Ethyl Methanesulfonate	increases expression	1
Formaldehyde	increases expression	1
Manganese	affects cotreatment, decreases expression, increases abundance	1
Methyl Methanesulfonate	increases expression	1
Phenobarbital	affects expression	1
Plant Extracts	affects cotreatment, decreases expression	1
Rotenone	decreases expression	1

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.