BLOC1S6

Summary

BLOC1S6 (biogenesis of lysosomal organelles complex 1 subunit 6, HGNC:8549) is a protein-coding gene on chromosome 15q21.1, encoding Biogenesis of lysosome-related organelles complex 1 subunit 6 (Q9UL45). Component of the BLOC-1 complex, a complex that is required for normal biogenesis of lysosome-related organelles (LRO), such as platelet dense granules and melanosomes.

The protein encoded by this gene may play a role in intracellular vesicle trafficking. It interacts with Syntaxin 13 which mediates intracellular membrane fusion. Mutations in this gene cause symptoms associated with Hermansky-Pudlak syndrome-9. Alternative splicing results in multiple transcript variants. A pseudogene related to this gene is located on the X chromosome.

Source: NCBI Gene 26258 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Hermansky-Pudlak syndrome 9 (Definitive, ClinGen)
• GWAS associations: 1
• Clinical variants (ClinVar): 219 total — 18 pathogenic, 8 likely-pathogenic
• Phenotypes (HPO): 10
• MANE Select transcript: NM_012388

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:8549
Approved symbol	BLOC1S6
Name	biogenesis of lysosomal organelles complex 1 subunit 6
Location	15q21.1
Locus type	gene with protein product
Status	Approved
Aliases	HPS9
Ensembl gene	ENSG00000104164
Ensembl biotype	protein_coding
OMIM	604310
Entrez	26258

Gene structure

Transcript identifiers

Ensembl transcripts: 21 — 10 protein_coding, 5 nonsense_mediated_decay, 4 protein_coding_CDS_not_defined, 2 retained_intron

ENST00000220531, ENST00000562384, ENST00000563000, ENST00000563160, ENST00000564310, ENST00000564765, ENST00000565216, ENST00000565323, ENST00000565409, ENST00000565727, ENST00000566184, ENST00000566753, ENST00000566801, ENST00000567461, ENST00000567523, ENST00000567740, ENST00000568597, ENST00000568816, ENST00000568963, ENST00000569076, ENST00000672455

RefSeq mRNA: 3 — MANE Select: NM_012388 NM_001311255, NM_001311256, NM_012388

CCDS: CCDS10126, CCDS81878

Canonical transcript exons

ENST00000220531 — 5 exons

Exon	Start	End
ENSE00003499060	45605428	45605514
ENSE00003527834	45603100	45603187
ENSE00003620695	45592135	45592276
ENSE00003899778	45606395	45609708
ENSE00003900840	45587379	45587525

Expression profiles

Bgee: expression breadth ubiquitous, 262 present calls, max score 99.59.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 51.9874 / max 545.4373, expressed in 1823 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
146468	22.6375	1806
146469	12.8596	1761
146467	12.7549	1778
146473	1.6045	650
146466	1.0558	657
146471	0.5807	227
146472	0.4944	250

Top tissues by expression

263 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
epithelial cell of pancreas	CL:0000083	99.59	gold quality
colonic epithelium	UBERON:0000397	98.93	gold quality
pancreatic ductal cell	CL:0002079	98.88	gold quality
endothelial cell	CL:0000115	98.84	gold quality
germinal epithelium of ovary	UBERON:0001304	98.74	gold quality
bone marrow cell	CL:0002092	98.38	gold quality
substantia nigra pars compacta	UBERON:0001965	98.17	gold quality
superficial temporal artery	UBERON:0001614	97.92	gold quality
Brodmann (1909) area 23	UBERON:0013554	97.68	gold quality
parietal pleura	UBERON:0002400	97.55	gold quality
lateral globus pallidus	UBERON:0002476	97.49	gold quality
substantia nigra pars reticulata	UBERON:0001966	97.48	gold quality
layer of synovial tissue	UBERON:0007616	97.44	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	97.35	gold quality
visceral pleura	UBERON:0002401	97.34	gold quality
tonsil	UBERON:0002372	97.31	gold quality
calcaneal tendon	UBERON:0003701	97.31	gold quality
synovial joint	UBERON:0002217	97.29	gold quality
lateral nuclear group of thalamus	UBERON:0002736	97.23	gold quality
dorsal root ganglion	UBERON:0000044	97.03	gold quality
cardiac muscle of right atrium	UBERON:0003379	96.88	gold quality
bone marrow	UBERON:0002371	96.61	gold quality
Brodmann (1909) area 46	UBERON:0006483	96.61	gold quality
gingival epithelium	UBERON:0001949	96.39	gold quality
superior vestibular nucleus	UBERON:0007227	96.33	gold quality
monocyte	CL:0000576	96.32	gold quality
bone element	UBERON:0001474	96.31	gold quality
amniotic fluid	UBERON:0000173	96.27	gold quality
left ventricle myocardium	UBERON:0006566	96.20	gold quality
trigeminal ganglion	UBERON:0001675	96.05	gold quality

Single-cell (SCXA)

Detected in 5 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-5061	yes	13.70
E-ANND-3	yes	9.68
E-CURD-97	no	1367.88
E-GEOD-124858	no	948.16
E-ENAD-20	no	577.89

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): SP1

miRNA regulators (miRDB)

164 targeting BLOC1S6, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-181A-5P	99.99	72.96	2995
HSA-MIR-181B-5P	99.99	72.97	2996
HSA-MIR-181C-5P	99.99	72.95	2996
HSA-MIR-181D-5P	99.99	73.04	2997
HSA-MIR-511-3P	99.99	68.85	1467
HSA-MIR-8068	99.98	73.85	2376
HSA-MIR-548P	99.98	72.25	3784
HSA-MIR-548AN	99.97	70.91	2817
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-495-3P	99.96	72.81	4197
HSA-MIR-5688	99.96	73.23	4504
HSA-MIR-23A-3P	99.95	74.24	3163
HSA-MIR-23B-3P	99.95	74.24	3163
HSA-MIR-23C	99.95	73.92	3192
HSA-MIR-3910	99.95	71.13	2227

Literature-anchored findings (GeneRIF, showing 5)

• role in biogenesis of lysosome-related organelles (PMID:12191018)
• no defects in the known components of pallidin-muted complex (BLOC-1)have been identified in 142 patients with HPS, suggesting that BLOC-1 function may be critical in humans. (PMID:12576321)
• Mecp2 regulates the expression of components belonging to the dysbindin interactome (PMID:23750231)
• Results from a study on gene expression variability markers in early-stage human embryos shows that BLOC1S6 (PLDN) is a putative expression variability marker for the 3-day, 8-cell embryo stage. (PMID:26288249)
• PLDN is a direct target of RUNX1 and its dysregulation is a mechanism for platelet dense granule deficiency associated with RUNX1 haplodeficiency (PMID:28075530)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	bloc1s6	ENSDARG00000042933
mus_musculus	Bloc1s6	ENSMUSG00000005804
rattus_norvegicus	Bloc1s6	ENSRNOG00000037160
drosophila_melanogaster	Pldn	FBGN0036192

Protein

Protein identifiers

Biogenesis of lysosome-related organelles complex 1 subunit 6 — Q9UL45 (reviewed: Q9UL45)

Alternative names: Pallid protein homolog, Pallidin, Syntaxin 13-interacting protein

All UniProt accessions (11): A0A5F9ZHH0, H3BML5, H3BMT8, H3BN13, H3BN73, H3BNE3, H3BPR6, H3BR42, H3BRA4, H3BST1, Q9UL45

UniProt curated annotations — full annotation on UniProt →

Function. Component of the BLOC-1 complex, a complex that is required for normal biogenesis of lysosome-related organelles (LRO), such as platelet dense granules and melanosomes. In concert with the AP-3 complex, the BLOC-1 complex is required to target membrane protein cargos into vesicles assembled at cell bodies for delivery into neurites and nerve terminals. The BLOC-1 complex, in association with SNARE proteins, is also proposed to be involved in neurite extension. May play a role in intracellular vesicle trafficking, particularly in the vesicle-docking and fusion process.

Subunit / interactions. Interacts with BLOC1S4 and DTNBP1/BLOC1S7. Homodimer. Component of the biogenesis of lysosome-related organelles complex 1 (BLOC-1) composed of BLOC1S1, BLOC1S2, BLOC1S3, BLOC1S4, BLOC1S5, BLOC1S6, DTNBP1/BLOC1S7 and SNAPIN/BLOC1S8. Octamer composed of one copy each BLOC1S1, BLOC1S2, BLOC1S3, BLOC1S4, BLOC1S5, BLOC1S6, DTNBP1/BLOC1S7 and SNAPIN/BLOC1S8. The BLOC-1 complex associates with the AP-3 protein complex and membrane protein cargos. Interacts with BLOC1S5, F-actin, SNAP25 isoform 1 and isoform 2, SNAP47 and STX12.

Subcellular location. Cytoplasm. Membrane.

Tissue specificity. Widely expressed.

Post-translational modifications. Phosphorylated.

Disease relevance. Hermansky-Pudlak syndrome 9 (HPS9) [MIM:614171] A form of Hermansky-Pudlak syndrome, a genetically heterogeneous autosomal recessive disorder characterized by oculocutaneous albinism, bleeding due to platelet storage pool deficiency, and lysosomal storage defects. This syndrome results from defects of diverse cytoplasmic organelles including melanosomes, platelet dense granules and lysosomes. Ceroid storage in the lungs is associated with pulmonary fibrosis, a common cause of premature death in individuals with HPS. The disease is caused by variants affecting the gene represented in this entry.

Miscellaneous. May be due to a competing acceptor splice site. May be due to exons 2 and 3 skipping.

Similarity. Belongs to the BLOC1S6 family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q9UL45-1	1	yes
Q9UL45-2	2
Q9UL45-3	3

RefSeq proteins (3): NP_001298184, NP_001298185, NP_036520* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR017242	BLOC-1_pallidin	Family
IPR028119	Snapin/Pallidin/Snn1	Family

Pfam: PF14712

UniProt features (8 total): region of interest 2, splice variant 2, chain 1, coiled-coil region 1, compositionally biased region 1, sequence variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9UL45-F1	84.10	0.64

Function

Pathways and Gene Ontology

Reactome pathways

4 pathways

ID	Pathway
R-HSA-432722	Golgi Associated Vesicle Biogenesis
R-HSA-199991	Membrane Trafficking
R-HSA-199992	trans-Golgi Network Vesicle Budding
R-HSA-5653656	Vesicle-mediated transport

MSigDB gene sets: 379 (showing top): GOBP_CIRCADIAN_RHYTHM, WAMUNYOKOLI_OVARIAN_CANCER_LMP_DN, GOBP_MEMORY, GOBP_REGULATION_OF_CELL_ACTIVATION, GOBP_SYNAPTIC_VESICLE_LOCALIZATION, GOBP_DENTATE_GYRUS_DEVELOPMENT, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_PHOSPHOLIPID_METABOLIC_PROCESS, ACTACCT_MIR196A_MIR196B, GOBP_ACTIN_FILAMENT_BUNDLE_ORGANIZATION, GOBP_RESPIRATORY_GASEOUS_EXCHANGE_BY_RESPIRATORY_SYSTEM, GOBP_COGNITION, GOBP_PIGMENT_GRANULE_LOCALIZATION, GOBP_AXO_DENDRITIC_TRANSPORT

GO Biological Process (46): kidney development (GO:0001822), bradykinin biosynthetic process (GO:0002936), respiratory system process (GO:0003016), endothelium development (GO:0003158), glutamate metabolic process (GO:0006536), L-glutamine metabolic process (GO:0006541), protein targeting (GO:0006605), phospholipid metabolic process (GO:0006644), blood coagulation (GO:0007596), memory (GO:0007613), anterograde axonal transport (GO:0008089), response to xenobiotic stimulus (GO:0009410), gene expression (GO:0010467), response to activity (GO:0014823), obsolete synaptic vesicle docking (GO:0016081), dentate gyrus development (GO:0021542), hypothalamus development (GO:0021854), melanocyte differentiation (GO:0030318), neuron projection development (GO:0031175), melanosome transport (GO:0032402), melanosome organization (GO:0032438), positive regulation of natural killer cell activation (GO:0032816), secretion of lysosomal enzymes (GO:0033299), intracellular nitric oxide homeostasis (GO:0033484), multicellular organism growth (GO:0035264), endosome to melanosome transport (GO:0035646), vasodilation (GO:0042311), circadian sleep/wake cycle (GO:0042745), ATP metabolic process (GO:0046034), adenosine metabolic process (GO:0046085), lung alveolus development (GO:0048286), anterograde synaptic vesicle transport (GO:0048490), homeostasis of number of cells (GO:0048872), positive regulation of pigment cell differentiation (GO:0050942), actin filament bundle assembly (GO:0051017), lipid homeostasis (GO:0055088), cilium assembly (GO:0060271), membrane fusion (GO:0061025), cellular response to epidermal growth factor stimulus (GO:0071364), protein transmembrane transport (GO:0071806)

GO Molecular Function (6): syntaxin binding (GO:0019905), identical protein binding (GO:0042802), protein homodimerization activity (GO:0042803), actin filament binding (GO:0051015), molecular adaptor activity (GO:0060090), protein binding (GO:0005515)

GO Cellular Component (16): stress fiber (GO:0001725), ruffle (GO:0001726), cytoplasm (GO:0005737), endosome (GO:0005768), cytosol (GO:0005829), focal adhesion (GO:0005925), membrane (GO:0016020), transport vesicle (GO:0030133), BLOC-1 complex (GO:0031083), filamentous actin (GO:0031941), cell-cell contact zone (GO:0044291), contractile ring (GO:0070938), presynapse (GO:0098793), axon cytoplasm (GO:1904115), microvesicle (GO:1990742), cytoplasmic vesicle (GO:0031410)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
trans-Golgi Network Vesicle Budding	1
Vesicle-mediated transport	1
Membrane Trafficking	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	5
anatomical structure development	2
binding	2
endomembrane system	2
cytoplasmic vesicle	2
cytoplasm	2
animal organ development	1
renal system development	1
peptide biosynthetic process	1
system process	1
respiratory gaseous exchange by respiratory system	1
epithelium development	1
amino acid metabolic process	1
dicarboxylic acid metabolic process	1
L-amino acid metabolic process	1
proteinogenic amino acid metabolic process	1
establishment of protein localization	1
lipid metabolic process	1
organophosphate metabolic process	1
hemostasis	1
wound healing	1
coagulation	1
learning or memory	1
axonal transport	1
axon cytoplasm	1
response to chemical	1
macromolecule biosynthetic process	1
response to stimulus	1
hippocampus development	1
diencephalon development	1
limbic system development	1
pigment cell differentiation	1
neuron development	1
plasma membrane bounded cell projection organization	1
melanosome localization	1
establishment of melanosome localization	1
pigment granule transport	1
SNARE binding	1
protein binding	1
identical protein binding	1

Protein interactions and networks

STRING

908 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
BLOC1S6	SNAPIN	O95295	999
BLOC1S6	BLOC1S2	Q6QNY1	999
BLOC1S6	BLOC1S3	Q6QNY0	999
BLOC1S6	BLOC1S1	P78537	999
BLOC1S6	DTNBP1	Q96EV8	997
BLOC1S6	BLOC1S5	Q8TDH9	988
BLOC1S6	BLOC1S4	Q9NUP1	974
BLOC1S6	HPS6	Q86YV9	954
BLOC1S6	HPS5	Q9UPZ3	953
BLOC1S6	HPS3	Q969F9	939
BLOC1S6	HPS4	Q9NQG7	877
BLOC1S6	STX12	Q86Y82	858
BLOC1S6	AP3B1	O00203	724
BLOC1S6	ZYX	Q15942	724
BLOC1S6	SNAP25	P13795	623

IntAct

190 interactions, top by confidence:

A	B	Type	Score
DTNBP1	SNAPIN	psi-mi:“MI:0914”(association)	0.900
BLOC1S1	BLOC1S6	psi-mi:“MI:0915”(physical association)	0.890
BLOC1S6	BLOC1S1	psi-mi:“MI:0915”(physical association)	0.890
BLOC1S6	BLOC1S1	psi-mi:“MI:0914”(association)	0.890
BLOC1S6	SKA1	psi-mi:“MI:0915”(physical association)	0.870
SKA1	BLOC1S6	psi-mi:“MI:0915”(physical association)	0.870
DTNBP1	BLOC1S6	psi-mi:“MI:0915”(physical association)	0.860
BLOC1S6	DTNBP1	psi-mi:“MI:0915”(physical association)	0.860
BLOC1S2	SNAPIN	psi-mi:“MI:0914”(association)	0.830
BLOC1S1	SNAPIN	psi-mi:“MI:0915”(physical association)	0.810
BLOC1S6	WASHC3	psi-mi:“MI:0915”(physical association)	0.800
STX11	BLOC1S6	psi-mi:“MI:0915”(physical association)	0.720
NUP62	BLOC1S6	psi-mi:“MI:0915”(physical association)	0.720
BLOC1S6	SMN1	psi-mi:“MI:0915”(physical association)	0.720
BLOC1S6	STX11	psi-mi:“MI:0915”(physical association)	0.720

BioGRID (129): BLOC1S6 (Two-hybrid), BLOC1S6 (Two-hybrid), BLOC1S6 (Two-hybrid), BLOC1S6 (Two-hybrid), BLOC1S6 (Two-hybrid), BLOC1S6 (Two-hybrid), BLOC1S6 (Two-hybrid), BLOC1S6 (Two-hybrid), BLOC1S6 (Two-hybrid), BLOC1S6 (Two-hybrid), RABGEF1 (Two-hybrid), CCHCR1 (Two-hybrid), CCDC136 (Two-hybrid), CORO6 (Two-hybrid), HAUS1 (Two-hybrid)

ESM2 similar proteins: A2AFR3, A6QLZ5, O08838, O94888, O95983, P0C6S7, P21580, P49418, P50478, Q05B58, Q08DU8, Q14161, Q14CM0, Q1RMZ1, Q32KN2, Q3KR37, Q3ZK22, Q497H0, Q5E948, Q5RD48, Q5REE1, Q5REY7, Q5RFL7, Q5U2M7, Q5UAK0, Q5ZIA0, Q5ZKA4, Q60769, Q66H91, Q6DC60, Q6ZPY2, Q7TQF7, Q7Z6G8, Q8BIZ1, Q8BR63, Q8BXK4, Q8IW50, Q8N108, Q8N128, Q8R3V6

Diamond homologs: Q08DU8, Q4V8A6, Q9R0C0, Q9UL45

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
BLOC1S6	“form complex”	BLOC-1	binding

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 57 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
trans-Golgi Network Vesicle Budding	6	37.1×	3e-06
Golgi Associated Vesicle Biogenesis	6	29.3×	5e-06

GO biological processes:

GO term	Partners	Fold	FDR
anterograde synaptic vesicle transport	7	130.9×	2e-11
melanosome organization	7	85.6×	3e-10
anterograde axonal transport	7	76.8×	5e-10
platelet dense granule organization	5	63.6×	2e-06
neuron projection development	7	16.1×	2e-05
exocytosis	5	14.3×	1e-03
protein transport	7	5.8×	7e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

219 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	18
Likely pathogenic	8
Uncertain significance	80
Likely benign	89
Benign	14

Top pathogenic / likely-pathogenic (26)

Variant ID	HGVS	Classification
1947585	NM_012388.4(BLOC1S6):c.261dup (p.Glu88fs)	Pathogenic
1952947	NM_012388.4(BLOC1S6):c.89del (p.Ser30fs)	Pathogenic
2742147	NM_012388.4(BLOC1S6):c.88del (p.Ser30fs)	Pathogenic
2744373	NM_012388.4(BLOC1S6):c.157del (p.Ala53fs)	Pathogenic
2748432	NM_012388.4(BLOC1S6):c.296T>A (p.Leu99Ter)	Pathogenic
2828478	NM_012388.4(BLOC1S6):c.33_34del (p.Ala12fs)	Pathogenic
2828875	NM_012388.4(BLOC1S6):c.245T>A (p.Leu82Ter)	Pathogenic
2875941	NM_012388.4(BLOC1S6):c.7_22dup (p.Ser8fs)	Pathogenic
2990226	NM_012388.4(BLOC1S6):c.203_207del (p.Lys68fs)	Pathogenic
30412	NM_012388.4(BLOC1S6):c.232C>T (p.Gln78Ter)	Pathogenic
3243821	NC_000015.9:g.(?45884313)(45898712_?)del	Pathogenic
3335910	NM_012388.4(BLOC1S6):c.285_286dup (p.His96fs)	Pathogenic
3335913	NM_012388.4(BLOC1S6):c.148G>T (p.Glu50Ter)	Pathogenic
3335914	NM_012388.4(BLOC1S6):c.351dup (p.Ile118fs)	Pathogenic
3643922	NC_000015.10:g.45592135del	Pathogenic
4073708	NM_012388.4(BLOC1S6):c.205C>T (p.Gln69Ter)	Pathogenic
4077108	NM_012388.4(BLOC1S6):c.224+1G>A	Pathogenic
996272	NM_012388.4(BLOC1S6):c.335dup (p.His112fs)	Pathogenic
1933969	NM_012388.4(BLOC1S6):c.312+1G>T	Likely pathogenic
2415699	NM_012388.4(BLOC1S6):c.82+1G>T	Likely pathogenic
2584834	NM_012388.4(BLOC1S6):c.32_34delinsA (p.Gly11fs)	Likely pathogenic
2708479	NM_012388.4(BLOC1S6):c.82+1_82+8del	Likely pathogenic
2719871	NM_012388.4(BLOC1S6):c.313-1G>A	Likely pathogenic
2791183	NM_012388.4(BLOC1S6):c.82+1G>A	Likely pathogenic
3577240	NM_012388.4(BLOC1S6):c.83-1G>A	Likely pathogenic
827679	NM_012388.4(BLOC1S6):c.319_320delinsAT (p.Glu107Met)	Likely pathogenic

SpliceAI

941 predictions. Top by Δscore:

Variant	Effect	Δscore
15:45587521:GCCTG:G	donor_gain	1.0000
15:45587524:TGG:T	donor_loss	1.0000
15:45587525:GGT:G	donor_loss	1.0000
15:45587526:G:GC	donor_loss	1.0000
15:45587526:G:GG	donor_gain	1.0000
15:45587527:T:A	donor_loss	1.0000
15:45605420:A:AG	acceptor_gain	1.0000
15:45605420:AT:A	acceptor_gain	1.0000
15:45605421:T:G	acceptor_gain	1.0000
15:45605421:T:TA	acceptor_gain	1.0000
15:45605426:A:AG	acceptor_gain	1.0000
15:45605427:G:GA	acceptor_gain	1.0000
15:45605427:G:GG	acceptor_gain	1.0000
15:45605511:AAAAG:A	donor_loss	1.0000
15:45605514:AG:A	donor_loss	1.0000
15:45605515:G:GG	donor_gain	1.0000
15:45605516:TGA:T	donor_loss	1.0000
15:45605517:GAGT:G	donor_loss	1.0000
15:45605518:AGT:A	donor_loss	1.0000
15:45605519:G:C	donor_loss	1.0000
15:45606485:T:G	donor_gain	1.0000
15:45606508:G:GT	donor_gain	1.0000
15:45606508:G:T	donor_gain	1.0000
15:45606518:GTTGT:G	donor_gain	1.0000
15:45606519:T:G	donor_gain	1.0000
15:45587522:CCTG:C	donor_gain	0.9900
15:45587523:CTG:C	donor_gain	0.9900
15:45587524:TG:T	donor_gain	0.9900
15:45587525:GG:G	donor_gain	0.9900
15:45603098:A:AG	acceptor_gain	0.9900

AlphaMissense

1119 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
15:45592273:T:C	L74P	0.996
15:45605437:G:C	A108P	0.996
15:45605471:G:T	R119I	0.995
15:45603129:T:C	L85P	0.994
15:45605438:C:A	A108D	0.994
15:45605468:T:A	I118K	0.993
15:45606411:T:C	L139P	0.993
15:45605480:T:G	M122R	0.992
15:45592243:T:C	L64P	0.991
15:45592264:T:C	L71P	0.991
15:45605480:T:C	M122T	0.991
15:45605510:T:C	L132S	0.991
15:45605514:A:C	K133N	0.991
15:45605514:A:T	K133N	0.991
15:45606400:A:C	R135S	0.990
15:45606400:A:T	R135S	0.990
15:45605459:T:G	L115W	0.988
15:45605480:T:A	M122K	0.988
15:45605489:T:C	L125P	0.988
15:45606405:T:C	L137P	0.988
15:45605457:G:C	K114N	0.987
15:45605457:G:T	K114N	0.987
15:45605459:T:C	L115S	0.987
15:45605468:T:G	I118R	0.986
15:45605481:G:A	M122I	0.986
15:45605481:G:C	M122I	0.986
15:45605481:G:T	M122I	0.986
15:45606401:G:C	A136P	0.986
15:45606486:T:C	L164S	0.986
15:45603138:A:T	E88V	0.985

dbSNP variants (sampled 300 via entrez): RS1000014775 (15:45598343 C>G,T), RS1000081628 (15:45601227 G>A), RS1000127294 (15:45586754 T>C), RS1000189706 (15:45587323 C>A,T), RS1000329867 (15:45589913 G>C), RS1000491013 (15:45600127 A>G), RS1000545998 (15:45604641 A>C), RS1000584424 (15:45609988 C>G,T), RS1000658378 (15:45609644 G>A), RS1000760693 (15:45608556 TGTTTTTAAAGTTTCCCCCA>T), RS1000796219 (15:45594689 T>G), RS1000807029 (15:45589422 G>A,C), RS1000889260 (15:45594870 C>T), RS1001121186 (15:45590447 G>A), RS1001152708 (15:45602907 A>G)

Disease associations

OMIM: gene MIM:604310 | disease phenotypes: MIM:614171, MIM:203300

GenCC curated gene-disease

Disease	Classification	Inheritance
Hermansky-Pudlak syndrome 9	Strong	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
Hermansky-Pudlak syndrome 9	Definitive	AR

Mondo (3): Hermansky-Pudlak syndrome 9 (MONDO:0013606), autoinflammatory syndrome (MONDO:0019751), Hermansky-Pudlak syndrome (MONDO:0019312)

Orphanet (3): Hermansky-Pudlak syndrome type 9 (Orphanet:280663), Hermansky-Pudlak syndrome (Orphanet:79430), Autoinflammatory syndrome (Orphanet:93665)

HPO phenotypes

10 total (10 of 10 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000639	Nystagmus
HP:0001010	Hypopigmentation of the skin
HP:0001107	Ocular albinism
HP:0001263	Global developmental delay
HP:0001581	Recurrent skin infections
HP:0001873	Thrombocytopenia
HP:0001882	Decreased total leukocyte count
HP:0007894	Fundus hypopigmentation
HP:0030402	Abnormal platelet aggregation

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST009391_2040	Metabolite levels	5.000000e-06

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D022861	Hermanski-Pudlak Syndrome	C11.270.040.545.400; C15.378.100.100.515; C15.378.100.685.400; C15.378.140.735.400; C15.378.463.735.400; C16.320.099.515; C16.320.290.040.100.400; C16.320.565.100.102.100.400; C16.320.850.080.100.400; C17.800.621.440.102.100.400; C17.800.827.080.100.400; C18.452.648.100.102.100.400

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

25 total (human), top 25 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	increases abundance, increases expression	2
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression, increases expression	2
Cadmium Chloride	increases expression	2
dicrotophos	decreases expression	1
triphenyl phosphate	affects expression	1
sodium arsenate	increases expression	1
benzo(e)pyrene	decreases methylation	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	increases expression	1
Air Pollutants	decreases expression, increases abundance	1
Arsenic	increases abundance, increases expression	1
Benzo(a)pyrene	affects methylation	1
Coumestrol	decreases expression	1
Heroin	decreases expression	1
Enzyme Inhibitors	decreases activity, increases O-linked glycosylation	1
Ethyl Methanesulfonate	increases expression	1
Lead	affects splicing	1
Methapyrilene	decreases methylation	1
Phenobarbital	affects expression	1
Polychlorinated Biphenyls	affects expression	1
Testosterone	decreases expression	1
Tretinoin	decreases expression	1
Aflatoxin B1	decreases methylation	1
Antirheumatic Agents	decreases expression	1
Copper Sulfate	increases expression	1
Particulate Matter	decreases expression, increases abundance	1

Clinical trials (associated diseases)

10 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00442182	PHASE2	UNKNOWN	The Efficacy and Safety of ITF2357 in AIS
NCT04193592	PHASE2	UNKNOWN	Efficacy and Safety of Pirfenidone Treatment in HPS-ILD
NCT00887939	Not specified	COMPLETED	Pathogenesis of Physical Induced Urticarial Syndromes
NCT03510442	Not specified	RECRUITING	Natural History, Genetics, and Pathophysiology of Systemic Juvenile Idiopathic Arthritis, Adult-Onset Still’s Disease, and Related Conditions
NCT06248957	Not specified	RECRUITING	SYSTEMS-LEVEL ANALYSES OF IMMUNE DYSREGULATION
NCT00467831	PHASE1/PHASE2	TERMINATED	Pilot Study of a Multi-Drug Regimen for Severe Pulmonary Fibrosis in Hermansky-Pudlak Syndrome
NCT00001456	Not specified	RECRUITING	Clinical and Basic Investigations Into Hermansky-Pudlak Syndrome
NCT00084305	Not specified	ACTIVE_NOT_RECRUITING	Analysis of Specimens From Individuals With Pulmonary Fibrosis
NCT01417520	Not specified	COMPLETED	Clinical and Pathophysiological Investigations Into Erdheim Chester Disease
NCT02368340	Not specified	COMPLETED	A Longitudinal Study of Hermansky-Pudlak Syndrome Pulmonary Fibrosis