BLVRA

Summary

BLVRA (biliverdin reductase A, HGNC:1062) is a protein-coding gene on chromosome 7p13, encoding Biliverdin reductase A (P53004). Reduces the gamma-methene bridge of the open tetrapyrrole, biliverdin IXalpha, to bilirubin with the concomitant oxidation of a NADH or NADPH cofactor.

The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene.

Source: NCBI Gene 644 — RefSeq curated summary.

At a glance

• Gene–disease (curated): hyperbiliverdinemia (Moderate, ClinGen)
• GWAS associations: 2
• Clinical variants (ClinVar): 92 total — 2 pathogenic, 2 likely-pathogenic
• Phenotypes (HPO): 8
• MANE Select transcript: NM_000712

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:1062
Approved symbol	BLVRA
Name	biliverdin reductase A
Location	7p13
Locus type	gene with protein product
Status	Approved
Aliases	BVRA, BVRalpha
Ensembl gene	ENSG00000106605
Ensembl biotype	protein_coding
OMIM	109750
Entrez	644

Gene structure

Transcript identifiers

Ensembl transcripts: 17 — 15 protein_coding, 2 retained_intron

ENST00000265523, ENST00000402924, ENST00000424330, ENST00000453612, ENST00000486984, ENST00000854106, ENST00000854107, ENST00000854108, ENST00000929414, ENST00000929415, ENST00000929416, ENST00000940897, ENST00000940898, ENST00000940899, ENST00000940900, ENST00000940901, ENST00000940902

RefSeq mRNA: 2 — MANE Select: NM_000712 NM_000712, NM_001253823

CCDS: CCDS5472

Canonical transcript exons

ENST00000265523 — 8 exons

Exon	Start	End
ENSE00000680543	43791249	43791368
ENSE00000680545	43792715	43792812
ENSE00000680547	43800465	43800572
ENSE00000680549	43803676	43803847
ENSE00001086664	43758680	43758734
ENSE00001086670	43771138	43771170
ENSE00001550088	43806977	43807342
ENSE00003651621	43787904	43788025

Expression profiles

Bgee: expression breadth ubiquitous, 290 present calls, max score 98.17.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 27.7627 / max 186.4325, expressed in 1808 samples.

FANTOM5 promoters (3 alternative TSS)

Promoter ID	TPM avg	Samples expressed
78370	26.6019	1808
78369	0.9713	452
78373	0.1896	99

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
monocyte	CL:0000576	98.17	gold quality
mononuclear cell	CL:0000842	97.57	gold quality
leukocyte	CL:0000738	97.34	gold quality
tongue squamous epithelium	UBERON:0006919	96.89	gold quality
epithelium of esophagus	UBERON:0001976	96.71	gold quality
esophagus squamous epithelium	UBERON:0006920	96.61	gold quality
squamous epithelium	UBERON:0006914	95.99	gold quality
middle temporal gyrus	UBERON:0002771	95.86	gold quality
gingival epithelium	UBERON:0001949	95.64	gold quality
corpus epididymis	UBERON:0004359	95.64	gold quality
lower esophagus	UBERON:0013473	95.58	gold quality
lower esophagus muscularis layer	UBERON:0035833	95.58	gold quality
renal glomerulus	UBERON:0000074	95.52	gold quality
spleen	UBERON:0002106	95.47	gold quality
esophagus	UBERON:0001043	95.22	gold quality
metanephric glomerulus	UBERON:0004736	95.14	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	95.13	gold quality
right lung	UBERON:0002167	95.08	gold quality
gingiva	UBERON:0001828	95.07	gold quality
cervix squamous epithelium	UBERON:0006922	95.01	silver quality
granulocyte	CL:0000094	94.97	gold quality
mucosa of stomach	UBERON:0001199	94.94	gold quality
esophagus mucosa	UBERON:0002469	94.94	gold quality
kidney epithelium	UBERON:0004819	94.85	gold quality
endothelial cell	CL:0000115	94.82	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	94.74	gold quality
oral cavity	UBERON:0000167	94.73	gold quality
muscle layer of sigmoid colon	UBERON:0035805	94.67	gold quality
cervix epithelium	UBERON:0004801	94.66	gold quality
epithelium of nasopharynx	UBERON:0001951	94.63	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-6701	yes	51.40
E-ANND-3	yes	15.88

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): E2F1, GLI2, NFKB

miRNA regulators (miRDB)

10 targeting BLVRA, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-3658	99.96	73.87	4379
HSA-MIR-7856-5P	99.75	69.99	2901
HSA-MIR-3679-3P	99.64	69.88	1599
HSA-MIR-6507-5P	99.36	70.46	2524
HSA-MIR-1253	99.12	67.08	1688
HSA-MIR-138-5P	98.43	70.49	1292
HSA-MIR-3085-5P	97.72	65.43	544
HSA-MIR-6793-3P	97.66	65.78	1084

Literature-anchored findings (GeneRIF, showing 36)

• Bilirubin, acting as a cytoprotective antioxidant, is itself oxidized to biliverdin and then recycled by biliverdin reductase back to bilirubin. This redox cycle may constitute the principal physiologic function of bilirubin. (PMID:12456881)
• Biliverdin reductase is a novel regulator for induction of activating transcription factor-2 and heme oxygenase-1 (PMID:14988408)
• BVR advances the role of HO-1 in cytoprotection and affords cytoprotection independent of heme degradation (PMID:15741166)
• hBVR activation of PKC betaII underscores its potential function in propagation of signals relayed through PKCs (PMID:17227757)
• Results describe the activation of biliverdin-IXalpha reductase by inorganic phosphate and related anions. (PMID:17402939)
• These findings, together with observations that si-hBVR blocked activation of ERK and Elk1 by IGF1 and prevented formation of ternary complex between MEK/ERK/hBVR, define the critical role of hBVR in ERK signaling and nuclear functions of the kinase. (PMID:18463290)
• Case Report: A novel mutation in the biliverdin reductase-A gene combined with liver cirrhosis results in hyperbiliverdinaemia (green jaundice). (PMID:19580635)
• Limited role for the bilirubin-biliverdin redox amplification cycle in the cellular antioxidant protection by biliverdin reductase. (PMID:19690164)
• hBVR is a regulator of the TNF-alpha-GPBP-collagen type IV signaling cascade (PMID:20177069)
• hBVR was detected in the nucleus at 1, 2, and 4 h after hypoxia (1% O(2)), at which times its kinase and reductase activities were increased. (PMID:20410444)
• These observations support direct and indirect antioxidant properties of BVR and bilirubin and an important role for BVR and bilirubin in HO-1 conferred protection of endothelial cells. (PMID:20430037)
• Primary spontaneous pneumothorax in smokers is associated with lung macrophage oxidative stress. The response to this condition involves HIF-1alpha-mediated induction of HO-1, BVR and H-ferritin. (PMID:20526373)
• data support the notion that BLVRA contributes significantly to modulation of the aging process by adjusting the cellular oxidative status. (PMID:21099244)
• An up-regulation of the biliverdin reductase-A protein levels was found in the hippocampus of the subjects with Alzheimer disease and arguably its earliest form, mild cognitive impairment. (PMID:21241799)
• A homozygous BLVRA inactivating mutation is associated with the appearance of green jaundice accompanying cholestasis episodes. (PMID:21278388)
• A significant increase of nitrated BVRA was demonstrated only in Alzheimer’s disease and mild cognitive impairment hippocampi (PMID:21483094)
• rs699512 (Thr3Ala), the only common non-synonymous SNP within BLVRA, reduced the risk of essential hypertension in Kazaks. (PMID:21721974)
• The current study reports increased levels of both HO-1 and BVR-A in plasma from probable Alzheimer disease patients, as a result of the increased oxidative environment. (PMID:22776971)
• Our results suggest that patients with chronic HCV infection significantly upregulate BLVRA expression in PBL. (PMID:23536765)
• Activation of human biliverdin-IXalpha reductase by urea: generation of kinetically distinct forms during the unfolding pathway. (PMID:24060811)
• These findings suggest that hBVR significantly contributes to the modulation of hypoxia-induced chemoresistance of glioblastoma cells by adjusting their cellular redox status. (PMID:24113378)
• Increased biliverdin reductase expression is associated with multidrug resistance in leukemia. (PMID:24222129)
• Interactions of HO-2 with CPR and BVR, were evaluated. (PMID:25196843)
• Data suggest that isoenzymes BVRA and BVRB play different roles in energy metabolism and in pathogenesis of abdominal obesity and hypertriglyceridemia. [REVIEW] (PMID:25726384)
• BLVRA mRNA levels in the liver as well as in peripheral blood leukocytes are significantly higher in hepatocellular carcinoma patients most likely as a feedback mechanism to control increased oxidative stress associated with HCC progression. (PMID:27740521)
• Genetic polymorphisms of the UGT1A1 promoter, specifically the T-3279G phenobarbital-responsive enhancer module and (TA)7 dinucleotide repeat, as well as the intron and coding region variants of the OATP2, HMOX1, and BLVRA genes, were significantly higher among the cases than the controls. (PMID:27943244)
• Data found that BVR-A interacts with BACE1, and its loss would favor the CKI-mediated phosphorylation of BACE1 and the associated increased Abeta production along with the alteration of brain insulin signaling. These results suggest that the impairment of BVR-A is an early molecular event contributing to both the onset of brain insulin resistance and the increased Abeta production observed in Alzheimer disease. (PMID:29981845)
• Associations between G6PD, OATP1B1 and BLVRA variants and susceptibility to neonatal hyperbilirubinaemia in a Chinese Han population. (PMID:30636082)
• Reduced biliverdin reductase-A levels are associated with early alterations of insulin signaling in obesity. (PMID:30826467)
• TLR4 counteracts BVRA signaling in human leukocytes via differential regulation of AMPK, mTORC1 and mTORC2. (PMID:31065010)
• Biliverdin reductase deficiency triggers an endothelial-to-mesenchymal transition in human endothelial cells (PMID:31704097)
• Reduced Biliverdin Reductase-A Expression in Visceral Adipose Tissue is Associated with Adipocyte Dysfunction and NAFLD in Human Obesity. (PMID:33260451)
• Biliverdin reductase-A protein levels are reduced in type 2 diabetes and are associated with poor glycometabolic control. (PMID:34453944)
• BLVRA exerts its biological effects to induce malignant properties of hepatocellular carcinoma cells via Wnt/beta-catenin pathway. (PMID:38216836)
• Associations between UGT1A1, SLCO1B1, SLCO1B3, BLVRA and HMOX1 polymorphisms and susceptibility to neonatal severe hyperbilirubinemia in Chinese Han population. (PMID:38279097)
• UGT1A1 and BLVRA allele and genotype variants in neonatal patients with hyperbilirubinemia in southern China. (PMID:39468242)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	blvra	ENSDARG00000059857
mus_musculus	Blvra	ENSMUSG00000001999
rattus_norvegicus	Blvra	ENSRNOG00000011778
drosophila_melanogaster	CG17712	FBGN0027597

Paralogs (3): DHDH (ENSG00000104808), GFOD2 (ENSG00000141098), GFOD1 (ENSG00000145990)

Protein

Protein identifiers

Biliverdin reductase A — P53004 (reviewed: P53004)

Alternative names: Biliverdin-IX alpha-reductase

All UniProt accessions (3): P53004, A0A140VJF4, C9J1E1

UniProt curated annotations — full annotation on UniProt →

Function. Reduces the gamma-methene bridge of the open tetrapyrrole, biliverdin IXalpha, to bilirubin with the concomitant oxidation of a NADH or NADPH cofactor. Does not reduce bilirubin IXbeta. Uses the reactants NADH or NADPH depending on the pH; NADH is used at the acidic pH range (6-6.9) and NADPH at the alkaline range (8.5-8.7). NADPH, however, is the probable reactant in biological systems.

Subunit / interactions. Monomer.

Subcellular location. Cytoplasm. Cytosol.

Tissue specificity. Liver.

Disease relevance. Hyperbiliverdinemia (HBLVD) [MIM:614156] A condition characterized by a green discoloration of the skin, urine, serum, and other bodily fluids. It is due to increased biliverdin resulting from inefficient conversion to bilirubin. Affected individuals appear to have symptoms only in the context of obstructive cholestasis and/or liver failure. In some cases, green jaundice can resolve after resolution of obstructive cholestasis. The disease is caused by variants affecting the gene represented in this entry.

Cofactor. Binds 1 zinc ion per subunit.

Pathway. Porphyrin-containing compound metabolism; protoheme degradation.

Similarity. Belongs to the Gfo/Idh/MocA family. Biliverdin reductase subfamily.

RefSeq proteins (2): NP_000703, NP_001240752 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000683	Gfo/Idh/MocA-like_OxRdtase_N	Domain
IPR015249	Biliverdin_Rdtase_cat	Domain
IPR017094	Biliverdin_Rdtase_A	Family
IPR036291	NAD(P)-bd_dom_sf	Homologous_superfamily
IPR051450	Gfo/Idh/MocA_Oxidoreductases	Family

Pfam: PF01408, PF09166

Enzyme classification (BRENDA):

• EC 1.3.1.24 — biliverdin reductase (BRENDA: 18 organisms, 80 substrates, 52 inhibitors, 70 Km, 26 kcat entries)

Substrate kinetics (BRENDA)

4 substrates with measured Km, best-characterized 4. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
BILIVERDIN	0.001–0.1633	29
NADPH	0.001–0.059	19
NADH	0.107–2	14
BILIVERDIN IXALPHA	0.0004–0.023	5

Catalyzed reactions (Rhea), 2 shown:

• (4Z,15Z)-bilirubin IXalpha + NADP(+) = biliverdin IXalpha + NADPH + H(+) (RHEA:15793)
• (4Z,15Z)-bilirubin IXalpha + NAD(+) = biliverdin IXalpha + NADH + H(+) (RHEA:15797)

UniProt features (44 total): helix 12, strand 11, binding site 8, modified residue 5, sequence variant 3, sequence conflict 3, propeptide 1, chain 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
2H63	X-RAY DIFFRACTION	2.7

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P53004-F1	95.88	0.94

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (8): 16–19; 44–46; 77–80; 98; 280; 281; 292; 293

Post-translational modifications (5): 174, 178, 230, 248, 253

Function

Pathways and Gene Ontology

Reactome pathways

7 pathways

ID	Pathway
R-HSA-189483	Heme degradation
R-HSA-9707564	Cytoprotection by HMOX1
R-HSA-1430728	Metabolism
R-HSA-189445	Metabolism of porphyrins
R-HSA-2262752	Cellular responses to stress
R-HSA-8953897	Cellular responses to stimuli
R-HSA-9711123	Cellular response to chemical stress

MSigDB gene sets: 312 (showing top): GOBP_LIPID_MODIFICATION, GOBP_HEMOGLOBIN_METABOLIC_PROCESS, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, BORCZUK_MALIGNANT_MESOTHELIOMA_UP, GOBP_HEPATICOBILIARY_SYSTEM_DEVELOPMENT, GOBP_INFLAMMATORY_RESPONSE, GOMF_OXIDOREDUCTASE_ACTIVITY_ACTING_ON_THE_CH_CH_GROUP_OF_DONORS, YANG_BREAST_CANCER_ESR1_BULK_UP, REACTOME_METABOLISM_OF_PORPHYRINS, STARK_PREFRONTAL_CORTEX_22Q11_DELETION_DN, GOZGIT_ESR1_TARGETS_DN, GOBP_CANONICAL_NF_KAPPAB_SIGNAL_TRANSDUCTION, GOBP_MACROMOLECULE_CATABOLIC_PROCESS, GOCC_CELL_SURFACE, GOBP_RESPONSE_TO_FOOD

GO Biological Process (27): MAPK cascade (GO:0000165), glycogen metabolic process (GO:0005977), apoptotic DNA fragmentation (GO:0006309), fatty acid metabolic process (GO:0006631), triglyceride metabolic process (GO:0006641), chemotaxis (GO:0006935), inflammatory response (GO:0006954), immune response (GO:0006955), response to oxidative stress (GO:0006979), canonical NF-kappaB signal transduction (GO:0007249), insulin receptor signaling pathway (GO:0008286), gene expression (GO:0010467), response to food (GO:0032094), response to lipopolysaccharide (GO:0032496), lipid oxidation (GO:0034440), complement component C5a signaling pathway (GO:0038178), heme catabolic process (GO:0042167), glucose homeostasis (GO:0042593), negative regulation of apoptotic process (GO:0043066), phosphatidylinositol 3-kinase/protein kinase B signal transduction (GO:0043491), ear development (GO:0043583), sensory perception of itch (GO:0160025), insulin metabolic process (GO:1901142), reactive oxygen species biosynthetic process (GO:1903409), response to cyclosporin A (GO:1905237), lipid metabolic process (GO:0006629), pigment metabolic process (GO:0042440)

GO Molecular Function (10): nucleotide binding (GO:0000166), RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), biliverdin reductase [NAD(P)H] activity (GO:0004074), protein serine/threonine kinase activity (GO:0004674), zinc ion binding (GO:0008270), biliberdin reductase (NADH) activity (GO:0106276), biliverdin reductase (NADPH) activity (GO:0106277), protein binding (GO:0005515), oxidoreductase activity (GO:0016491), metal ion binding (GO:0046872)

GO Cellular Component (5): nucleus (GO:0005634), cytosol (GO:0005829), cell surface (GO:0009986), extracellular exosome (GO:0070062), cytoplasm (GO:0005737)

Reactome top-level categories

Rollup of top-5 pathways:

Category	Pathways
Metabolism of porphyrins	1
Cellular response to chemical stress	1
Metabolism	1
Cellular responses to stimuli	1
Cellular responses to stress	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
intracellular signaling cassette	3
cellular anatomical structure	3
response to chemical	2
biliverdin reductase [NAD(P)H] activity	2
energy reserve metabolic process	1
glucan metabolic process	1
DNA catabolic process	1
apoptotic nuclear changes	1
lipid metabolic process	1
monocarboxylic acid metabolic process	1
acylglycerol metabolic process	1
taxis	1
defense response	1
immune system process	1
response to stimulus	1
response to stress	1
cell surface receptor protein tyrosine kinase signaling pathway	1
cellular response to insulin stimulus	1
macromolecule biosynthetic process	1
response to nutrient levels	1
response to molecule of bacterial origin	1
response to lipid	1
response to oxygen-containing compound	1
lipid modification	1
complement receptor mediated signaling pathway	1
G protein-coupled receptor signaling pathway	1
porphyrin-containing compound catabolic process	1
heme metabolic process	1
pigment catabolic process	1
carbohydrate homeostasis	1
apoptotic process	1
regulation of apoptotic process	1
negative regulation of programmed cell death	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
RNA polymerase II transcription regulatory region sequence-specific DNA binding	1
cis-regulatory region sequence-specific DNA binding	1
oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor	1
protein kinase activity	1
transition metal ion binding	1

Protein interactions and networks

STRING

1787 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
BLVRA	HMOX1	P09601	946
BLVRA	BLVRB	P30043	935
BLVRA	HMOX2	P30519	920
BLVRA	DIAPH3	Q9NSV4	826
BLVRA	UGT1A1	P22309	817
BLVRA	SLCO1B1	Q9Y6L6	754
BLVRA	SLCO1B3	Q9NPD5	735
BLVRA	POR	P16435	694
BLVRA	ELSPBP1	Q96BH3	680
BLVRA	HARS2	P49590	665
BLVRA	HPX	P02790	658
BLVRA	HP	P00737	605
BLVRA	FECH	P22830	605
BLVRA	H6PD	O95479	588
BLVRA	G6PD	P11413	559

IntAct

62 interactions, top by confidence:

A	B	Type	Score
BLVRA	LNX1	psi-mi:“MI:0915”(physical association)	0.740
LNX1	BLVRA	psi-mi:“MI:0915”(physical association)	0.740
CFTR	ESYT2	psi-mi:“MI:0914”(association)	0.710
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
BLVRA	DDHD2	psi-mi:“MI:0914”(association)	0.530
WDR53	BLVRA	psi-mi:“MI:0914”(association)	0.530
C1orf174	AHCYL1	psi-mi:“MI:0914”(association)	0.530
TPD52L1	TPD52L2	psi-mi:“MI:0914”(association)	0.530
EZH1	EPOP	psi-mi:“MI:0914”(association)	0.530
BLVRA	MAPK1	psi-mi:“MI:0915”(physical association)	0.500
BLVRA	MAPK1	psi-mi:“MI:0914”(association)	0.500
DDX21	MED19	psi-mi:“MI:2364”(proximity)	0.480
BLVRA	MAPK3	psi-mi:“MI:0407”(direct interaction)	0.440
AIFM1	SEC16A	psi-mi:“MI:2364”(proximity)	0.420
TUBA1A	TUBAL3	psi-mi:“MI:2364”(proximity)	0.420
LTK	PIK3R2	psi-mi:“MI:0914”(association)	0.420
Hmox1	BLVRA	psi-mi:“MI:0915”(physical association)	0.400
HSCB	RBP5	psi-mi:“MI:0914”(association)	0.350
PRNP	CARNS1	psi-mi:“MI:0914”(association)	0.350
PRNP	WDR91	psi-mi:“MI:0914”(association)	0.350
CGAS	HSPA4L	psi-mi:“MI:0914”(association)	0.350
P2RY12	GPR89A	psi-mi:“MI:0914”(association)	0.350
THBS3	APBB1	psi-mi:“MI:0914”(association)	0.350
WDR53	NACAD	psi-mi:“MI:0914”(association)	0.350

BioGRID (124): LNX1 (Two-hybrid), TLN1 (Affinity Capture-MS), TBX20 (Affinity Capture-MS), OSBPL6 (Affinity Capture-MS), PCYOX1 (Affinity Capture-MS), ARF5 (Affinity Capture-MS), RTN4IP1 (Affinity Capture-MS), OCIAD1 (Affinity Capture-MS), RRAGB (Affinity Capture-MS), SNX5 (Affinity Capture-MS), DDHD2 (Affinity Capture-MS), BLVRA (Affinity Capture-MS), BLVRA (Affinity Capture-MS), BLVRA (Affinity Capture-MS), BLVRA (Affinity Capture-MS)

ESM2 similar proteins: A2Y8B9, A3AZW5, C3RZA1, F4I312, H9BFW7, O14727, O88879, O95786, P0CI65, P46844, P53004, Q0P585, Q3U3W5, Q3V3E1, Q5EA24, Q5IH13, Q5IH14, Q5R673, Q5RCR9, Q5VS72, Q6AZT7, Q6DIQ1, Q6GLL2, Q6GN68, Q6P2P2, Q6YXW6, Q7M6Z3, Q7TNH6, Q7Z494, Q810N6, Q84ZX8, Q8BGG7, Q8BZT9, Q8CD15, Q8CFC1, Q8IUF8, Q8R5A0, Q8TF42, Q8W519, Q93XN8

Diamond homologs: A0A024SMV2, A0R191, A4FIQ1, B3TMR8, D4GP30, O13991, P11886, P37168, P46844, P46853, P49305, P53004, P74041, Q2I8V6, Q53TZ2, Q6DKE0, Q9ALN5, Q9CY64, Q9KWL3, Q9RR32, Q9UT60, Q9ZA33, A1R665, A4QAF9, A7ZAH5, B7JA34, C0ZWI9, C1DLA8, C3MH72, C5BYN4, F0M433, O05265, O32223, O42896, P26935, P75931, P77376, P94437, Q04869, Q3UHD2

SIGNOR signaling

10 interactions.

A	Effect	B	Mechanism
BLVRA	up-regulates	PRKCB	phosphorylation
BLVRA	“down-regulates quantity”	bilirubin(2-)	“chemical modification”
BLVRA	“up-regulates quantity”	biliverdin(2-)	“chemical modification”
INSR	“up-regulates activity”	BLVRA	phosphorylation
AKT1	“up-regulates activity”	BLVRA	phosphorylation
PRKCD	“up-regulates activity”	BLVRA	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 75 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Aggrephagy	5	23.4×	5e-04
Recycling pathway of L1	5	21.1×	5e-04
Post NMDA receptor activation events	5	19.2×	5e-04
Activation of NMDA receptors and postsynaptic events	5	17.4×	7e-04
L1CAM interactions	6	13.6×	5e-04
Interferon Signaling	5	11.3×	4e-03
Neurotransmitter receptors and postsynaptic signal transmission	5	9.4×	5e-03
HCMV Early Events	5	7.6×	8e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

92 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	2
Uncertain significance	47
Likely benign	15
Benign	13

Top pathogenic / likely-pathogenic (4)

Variant ID	HGVS	Classification
29612	NM_000712.4(BLVRA):c.52C>T (p.Arg18Ter)	Pathogenic
29613	NM_001253823.1(BLVRA):c.131C>A (p.Ser44Ter)	Pathogenic
1029936	NM_000712.4(BLVRA):c.157G>T (p.Gly53Ter)	Likely pathogenic
4845899	NM_000712.4(BLVRA):c.577C>T (p.Arg193Ter)	Likely pathogenic

SpliceAI

1522 predictions. Top by Δscore:

Variant	Effect	Δscore
7:43771136:A:AG	acceptor_gain	1.0000
7:43771137:G:GA	acceptor_gain	1.0000
7:43771137:GT:G	acceptor_gain	1.0000
7:43771171:G:A	donor_loss	1.0000
7:43771172:T:A	donor_loss	1.0000
7:43792714:GGCA:G	acceptor_gain	1.0000
7:43800454:T:TA	acceptor_gain	1.0000
7:43800457:C:A	acceptor_gain	1.0000
7:43800463:A:AC	acceptor_loss	1.0000
7:43800463:A:AG	acceptor_gain	1.0000
7:43800463:AG:A	acceptor_gain	1.0000
7:43800464:G:GA	acceptor_gain	1.0000
7:43800464:GG:G	acceptor_gain	1.0000
7:43800464:GGA:G	acceptor_gain	1.0000
7:43800464:GGAA:G	acceptor_gain	1.0000
7:43800464:GGAAA:G	acceptor_gain	1.0000
7:43800527:G:GT	donor_gain	1.0000
7:43800571:AG:A	donor_loss	1.0000
7:43800572:GG:G	donor_loss	1.0000
7:43803672:ACAG:A	acceptor_loss	1.0000
7:43803674:A:AG	acceptor_gain	1.0000
7:43803674:AGCT:A	acceptor_gain	1.0000
7:43803675:G:GA	acceptor_gain	1.0000
7:43803675:G:GT	acceptor_loss	1.0000
7:43803675:GCT:G	acceptor_gain	1.0000
7:43803675:GCTG:G	acceptor_gain	1.0000
7:43803844:AAAGG:A	donor_loss	1.0000
7:43803848:G:GG	donor_gain	1.0000
7:43803848:GTAA:G	donor_loss	1.0000
7:43803849:T:A	donor_loss	1.0000

AlphaMissense

1933 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
7:43791336:C:G	C74W	0.989
7:43792741:T:A	V94D	0.989
7:43806987:T:A	W215R	0.989
7:43806987:T:C	W215R	0.989
7:43792750:A:T	E97V	0.983
7:43791334:T:C	C74R	0.982
7:43787941:G:A	G17D	0.981
7:43787950:G:A	G20D	0.979
7:43787935:G:A	G15D	0.977
7:43791335:G:A	C74Y	0.977
7:43791326:C:A	A71D	0.975
7:43800474:T:C	L121S	0.975
7:43800561:T:C	L150P	0.975
7:43787932:T:A	V14D	0.974
7:43803730:G:C	R172P	0.974
7:43792723:T:C	L88P	0.973
7:43800509:T:C	F133L	0.973
7:43800511:C:A	F133L	0.973
7:43800511:C:G	F133L	0.973
7:43800566:T:C	F152L	0.973
7:43800568:C:A	F152L	0.973
7:43800568:C:G	F152L	0.973
7:43807187:C:G	C281W	0.972
7:43807104:G:C	D254H	0.971
7:43800554:G:A	G148R	0.970
7:43800554:G:C	G148R	0.970
7:43803829:T:C	L205P	0.970
7:43787959:G:C	R23P	0.969
7:43803742:T:C	L176P	0.966
7:43792744:T:C	L95P	0.965

dbSNP variants (sampled 300 via entrez): RS1000046450 (7:43758753 ACGGGGGTCGCGCGCAGGGGAG>A,ACGGGGGTCGCGCGCAGGGGAGCGGGGGTCGCGCGCAGGGGAG), RS1000091063 (7:43763135 G>A), RS1000226265 (7:43785659 G>A), RS1000278585 (7:43786102 TA>T,TAA), RS1000358710 (7:43772523 A>G,T), RS1000360761 (7:43807808 G>A,T), RS1000429688 (7:43779044 A>C,G), RS1000436660 (7:43763504 C>T), RS1000510756 (7:43792052 TA>T), RS1000604524 (7:43787733 C>T), RS1000694390 (7:43773783 C>A,T), RS1000701431 (7:43781403 G>A), RS1000811299 (7:43780649 G>A), RS1000906268 (7:43767866 G>A), RS1000955807 (7:43760856 C>A,T)

Disease associations

OMIM: gene MIM:109750 | disease phenotypes: MIM:614156

GenCC curated gene-disease

Disease	Classification	Inheritance
hyperbiliverdinemia	Moderate	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
hyperbiliverdinemia	Moderate	AR

Mondo (1): hyperbiliverdinemia (MONDO:0013595)

Orphanet (1): Hyperbiliverdinemia (Orphanet:276405)

HPO phenotypes

8 total (8 of 8 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000007	Autosomal recessive inheritance
HP:0001081	Cholelithiasis
HP:0001396	Cholestasis
HP:0001410	Decreased liver function
HP:0003584	Late onset
HP:0032003	Green urine
HP:0034383	Elevated circulating biliverdin concentration

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST004487_7	Peak insulin response	4.000000e-08
GCST90002392_719	Mean corpuscular volume	2.000000e-10

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0008000	peak insulin response measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

57 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, increases expression	5
bisphenol A	affects cotreatment, increases methylation, decreases expression, increases expression	4
trichostatin A	affects cotreatment, decreases expression	2
sodium arsenite	affects reaction, increases expression, affects response to substance, increases cleavage, decreases expression (+4 more)	2
Benzo(a)pyrene	affects cotreatment, increases expression, decreases methylation	2
Cadmium	increases abundance, increases expression, decreases expression	2
Cadmium Chloride	increases abundance, increases expression	2
aristolochic acid I	increases expression	1
bisphenol F	increases expression	1
dicrotophos	decreases expression	1
triphenyl phosphate	affects expression	1
pirinixic acid	affects binding, decreases expression, increases activity	1
sodium bichromate	decreases expression	1
tetrabromobisphenol A	decreases expression	1
manganese chloride	decreases expression, increases abundance	1
ochratoxin A	decreases expression	1
potassium chromate(VI)	affects cotreatment, decreases expression	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression	1
epigallocatechin gallate	affects cotreatment, decreases expression	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
nutlin 3	affects cotreatment, increases secretion	1
ICG 001	decreases expression	1
bisphenol B	increases expression	1
abrine	decreases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
hexabrominated diphenyl ether 153	decreases expression	1
bisphenol S	increases expression	1
bisphenol AF	increases expression	1
Temozolomide	decreases expression	1

Cellosaurus cell lines

2 cell lines: 1 transformed cell line, 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B2ST	Abcam HEK293T BLVRA KO	Transformed cell line	Female
CVCL_D5I9	HeLa/Blvra KO	Cancer cell line	Female

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.