C15orf40

Summary

C15orf40 (chromosome 15 open reading frame 40, HGNC:28443) is a protein-coding gene on chromosome 15q25.2, encoding UPF0235 protein C15orf40 (Q8WUR7).

Located in mitochondrion.

Source: NCBI Gene 123207 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 43 total
• MANE Select transcript: NM_144597

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:28443
Approved symbol	C15orf40
Name	chromosome 15 open reading frame 40
Location	15q25.2
Locus type	gene with protein product
Status	Approved
Aliases	MGC29937
Ensembl gene	ENSG00000169609
Ensembl biotype	protein_coding
Entrez	123207

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 7 protein_coding, 3 retained_intron, 2 nonsense_mediated_decay

ENST00000304177, ENST00000451195, ENST00000505341, ENST00000506912, ENST00000508990, ENST00000510873, ENST00000512638, ENST00000514272, ENST00000538348, ENST00000563387, ENST00000565712, ENST00000565725

RefSeq mRNA: 5 — MANE Select: NM_144597 NM_001160113, NM_001160114, NM_001160115, NM_001160116, NM_144597

CCDS: CCDS32312, CCDS53968, CCDS53969

Canonical transcript exons

ENST00000304177 — 4 exons

Exon	Start	End
ENSE00001159521	82994817	83005692
ENSE00003514385	83010237	83010363
ENSE00003599815	83011497	83011639
ENSE00003606533	83008548	83008675

Expression profiles

Bgee: expression breadth ubiquitous, 245 present calls, max score 88.65.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 10.6089 / max 66.4794, expressed in 1792 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
151286	10.6089	1792

Top tissues by expression

258 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
olfactory segment of nasal mucosa	UBERON:0005386	88.65	gold quality
islet of Langerhans	UBERON:0000006	87.38	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	87.16	gold quality
stromal cell of endometrium	CL:0002255	86.88	gold quality
granulocyte	CL:0000094	86.73	gold quality
left adrenal gland cortex	UBERON:0035825	86.18	gold quality
left adrenal gland	UBERON:0001234	85.92	gold quality
body of pancreas	UBERON:0001150	85.91	gold quality
right adrenal gland	UBERON:0001233	85.81	gold quality
hindlimb stylopod muscle	UBERON:0004252	85.81	gold quality
skin of leg	UBERON:0001511	85.75	gold quality
leukocyte	CL:0000738	85.72	gold quality
pancreas	UBERON:0001264	85.72	gold quality
right uterine tube	UBERON:0001302	85.65	gold quality
mucosa of stomach	UBERON:0001199	85.61	gold quality
monocyte	CL:0000576	85.60	gold quality
metanephros cortex	UBERON:0010533	85.57	gold quality
cortex of kidney	UBERON:0001225	85.51	gold quality
minor salivary gland	UBERON:0001830	85.23	gold quality
small intestine Peyer’s patch	UBERON:0003454	85.19	gold quality
right ovary	UBERON:0002118	85.16	gold quality
adipose tissue	UBERON:0001013	85.15	gold quality
adrenal cortex	UBERON:0001235	85.11	gold quality
right adrenal gland cortex	UBERON:0035827	85.05	gold quality
adrenal gland	UBERON:0002369	84.92	gold quality
adult mammalian kidney	UBERON:0000082	84.85	gold quality
esophagus mucosa	UBERON:0002469	84.85	gold quality
left ovary	UBERON:0002119	84.78	gold quality
left coronary artery	UBERON:0001626	84.76	gold quality
skin of abdomen	UBERON:0001416	84.75	gold quality

Single-cell (SCXA)

Detected in 9 experiment(s), a significant marker in 6.

Experiment	Marker?	Max mean expression
E-MTAB-8894	yes	1904.65
E-MTAB-6701	yes	1470.67
E-MTAB-8142	yes	38.53
E-HCAD-9	yes	16.48
E-ANND-3	yes	6.22
E-CURD-112	yes	3.69
E-CURD-135	no	2492.05
E-MTAB-10018	no	648.55
E-GEOD-125970	no	3.49

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

94 targeting C15orf40, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-6740-5P	100.00	65.64	932
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-4531	99.99	69.70	3181
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-3617-3P	99.98	67.86	918
HSA-MIR-3065-5P	99.97	71.56	3281
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-23A-3P	99.95	74.24	3163
HSA-MIR-23B-3P	99.95	74.24	3163
HSA-MIR-23C	99.95	73.92	3192
HSA-MIR-545-3P	99.95	70.74	2783
HSA-MIR-548J-3P	99.94	72.61	4881
HSA-MIR-548AE-3P	99.93	72.66	4867
HSA-MIR-548AH-3P	99.93	72.54	4872
HSA-MIR-548AM-3P	99.93	72.54	4872
HSA-MIR-548AQ-3P	99.93	72.66	4867
HSA-MIR-1305	99.91	71.43	3443
HSA-MIR-3140-3P	99.88	68.47	2069
HSA-MIR-5003-3P	99.85	69.29	2517

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	3110040N11Rik	ENSMUSG00000025102
rattus_norvegicus		ENSRNOG00000069610

Protein

Protein identifiers

UPF0235 protein C15orf40 — Q8WUR7 (reviewed: Q8WUR7)

All UniProt accessions (7): Q8WUR7, H0Y996, H0Y9H8, H0YAC3, H3BM85, H3BMR1, H3BQZ5

UniProt curated annotations — full annotation on UniProt →

Similarity. Belongs to the UPF0235 family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q8WUR7-1	1	yes
Q8WUR7-2	2
Q8WUR7-3	3

RefSeq proteins (5): NP_001153585, NP_001153586, NP_001153587, NP_001153588, NP_653198* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003746	DUF167	Family
IPR036591	YggU-like_sf	Homologous_superfamily

Pfam: PF02594

UniProt features (7 total): splice variant 2, chain 1, region of interest 1, compositionally biased region 1, modified residue 1, sequence variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8WUR7-F1	75.55	0.35

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 116

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 102 (showing top): GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, CADWELL_ATG16L1_TARGETS_DN, BRUINS_UVC_RESPONSE_LATE, RATTENBACHER_BOUND_BY_CELF1, BARX1_TARGET_GENES, DIDO1_TARGET_GENES, RYBP_TARGET_GENES, SALL4_TARGET_GENES, SNIP1_TARGET_GENES, ZBTB12_TARGET_GENES, ZNF257_TARGET_GENES, ZSCAN31_TARGET_GENES, MIR616_5P, MIR371B_5P, MIR373_5P

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (2): cytoplasm (GO:0005737), mitochondrion (GO:0005739)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
intracellular anatomical structure	1
cellular anatomical structure	1
cytoplasm	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

611 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
C15orf40	C8orf82	Q6P1X6	570
C15orf40	PROSER2	Q86WR7	560
C15orf40	OR7G3	Q8NG95	542
C15orf40	RLIG1	Q8N999	480
C15orf40	RAMAC	Q9BTL3	475
C15orf40	WHAMM	Q8TF30	464
C15orf40	C2orf69	Q8N8R5	447
C15orf40	C5orf63	A6NC05	447
C15orf40	DGLUCY	Q7Z3D6	447
C15orf40	FSD2	A1L4K1	446
C15orf40	SERTAD2	Q14140	433
C15orf40	BTBD1	Q9H0C5	428
C15orf40	WDR70	Q9NW82	396
C15orf40	NXPH2	O95156	394
C15orf40	TMEM232	C9JQI7	393

IntAct

5 interactions, top by confidence:

A	B	Type	Score
C15orf40	ACSL3	psi-mi:“MI:0915”(physical association)	0.400
CALML3	MYO1C	psi-mi:“MI:0914”(association)	0.350
C15orf40	CLIC2	psi-mi:“MI:0914”(association)	0.350
SAP30	CLIC2	psi-mi:“MI:0914”(association)	0.350

BioGRID (12): C15orf40 (Co-fractionation), C15orf40 (Co-fractionation), C15orf40 (Proximity Label-MS), C15orf40 (Negative Genetic), KLHL36 (Affinity Capture-MS), CLIC2 (Affinity Capture-MS), C15orf40 (Affinity Capture-MS), C15orf40 (Affinity Capture-MS), C15orf40 (Co-fractionation), C15orf40 (Affinity Capture-MS), C15orf40 (Affinity Capture-MS), C15orf40 (Cross-Linking-MS (XL-MS))

ESM2 similar proteins: A2AIG8, A2VE52, O15315, O35719, O43502, O46675, O54804, O73884, P0C7P0, P23434, P35790, P47854, Q01134, Q08DW9, Q0VD27, Q3SZ84, Q3ZBL5, Q4R766, Q4R7M4, Q53S33, Q5E9H2, Q5E9T4, Q5PPH0, Q5U1X1, Q5VYX0, Q5ZI20, Q6AYT7, Q6GV29, Q7Z624, Q86XW9, Q8BK26, Q8CEI1, Q8CIW5, Q8MI29, Q8N0X4, Q8N2K0, Q8NBA8, Q8R2J9, Q8WUR7, Q924H5

Diamond homologs: A0KUF7, A1KB74, A1RHL9, A3D6Z7, A4J2F3, A4XZY4, A5D180, A5FQ39, A6WQT5, A7H9D8, A8F059, A8FSL7, A8GQ50, A8GTZ4, A8GWJ3, A8ZS81, A9KXP6, B0B7V8, B0BC23, B0BVI5, B1GYK8, B1KIX3, B2J1T0, B2V7H9, B3ER80, B3PFH5, B3PQB3, B4U5M3, B5ZTD4, B6YUU2, B7KEV7, B8E927, B8JFX1, C0QR78, C1D6C4, C1DI68, C3PLX4, C4K236, O84393, Q0AE64

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

43 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	24
Likely benign	2
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1156 predictions. Top by Δscore:

Variant	Effect	Δscore
15:82989007:C:G	acceptor_gain	1.0000
15:82989008:A:AG	acceptor_gain	1.0000
15:82989009:G:GA	acceptor_gain	1.0000
15:82989009:GA:G	acceptor_gain	1.0000
15:82989009:GAT:G	acceptor_gain	1.0000
15:82989009:GATT:G	acceptor_gain	1.0000
15:82989142:G:GT	donor_gain	1.0000
15:82989143:A:T	donor_gain	1.0000
15:82989188:GGTG:G	donor_loss	1.0000
15:82989189:G:GG	donor_gain	1.0000
15:82989189:GTGT:G	donor_loss	1.0000
15:82989190:T:A	donor_loss	1.0000
15:82989879:A:AG	acceptor_gain	1.0000
15:82989879:A:AT	acceptor_loss	1.0000
15:82989880:G:GG	acceptor_gain	1.0000
15:82989880:GGTT:G	acceptor_gain	1.0000
15:83005613:T:TA	donor_gain	1.0000
15:83010236:CCTG:C	donor_gain	1.0000
15:83010783:AAAGG:A	donor_gain	1.0000
15:82988998:A:AG	acceptor_gain	0.9900
15:82989000:A:G	acceptor_gain	0.9900
15:82989001:A:G	acceptor_gain	0.9900
15:82989006:A:AG	acceptor_gain	0.9900
15:82989009:GATTT:G	acceptor_gain	0.9900
15:82989090:G:GT	donor_gain	0.9900
15:82989100:G:GT	donor_gain	0.9900
15:82989182:GCAA:G	donor_gain	0.9900
15:82989183:C:T	donor_gain	0.9900
15:82989185:ATCG:A	donor_gain	0.9900
15:82989186:TCG:T	donor_gain	0.9900

AlphaMissense

972 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
15:83008645:A:T	I90N	0.997
15:83010275:A:T	I67N	0.995
15:83010281:A:T	I65K	0.994
15:83008606:A:T	L103H	0.993
15:83008561:A:T	V118E	0.992
15:83008606:A:G	L103P	0.991
15:83010269:G:T	A69E	0.991
15:83008614:A:C	N100K	0.990
15:83008614:A:T	N100K	0.990
15:83008651:A:T	V88E	0.990
15:83005672:C:A	K129N	0.989
15:83005672:C:G	K129N	0.989
15:83005674:T:G	K129Q	0.989
15:83005683:A:G	S126P	0.989
15:83010281:A:C	I65R	0.989
15:83008645:A:C	I90S	0.988
15:83008649:C:G	A89P	0.988
15:83010265:T:A	K70N	0.988
15:83010265:T:G	K70N	0.988
15:83005622:A:G	L146S	0.987
15:83008594:A:G	L107P	0.987
15:83010242:A:T	V78E	0.987
15:83010275:A:C	I67S	0.987
15:83005692:C:G	G123R	0.986
15:83008555:A:G	L120S	0.985
15:83005691:C:T	G123D	0.984
15:83008625:C:G	G97R	0.984
15:83008625:C:T	G97R	0.984
15:83008657:A:T	V86E	0.983
15:83008618:G:T	A99D	0.980

dbSNP variants (sampled 300 via entrez): RS1000039873 (15:82997229 T>A), RS1000065285 (15:83007226 T>C), RS1000419391 (15:82998304 G>A), RS1000443788 (15:83010648 C>A,T), RS1000448349 (15:83010427 C>A,T), RS1000471583 (15:82998990 G>A,C), RS1000501833 (15:83010629 C>T), RS1000600520 (15:83004317 G>A,C,T), RS1001317614 (15:82991216 G>T), RS1001369387 (15:82991382 T>C), RS1001377605 (15:82996205 GCTCGTGCCTTTAACTCCCTAAAGAATCTCCAGT>G), RS1001383532 (15:82991618 G>A,T), RS1001547306 (15:82997325 T>C,G), RS1001789701 (15:83005285 A>C), RS1001834650 (15:82991343 G>A)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST011766_31	Chronic obstructive pulmonary disease	4.000000e-07
GCST011766_32	Chronic obstructive pulmonary disease	4.000000e-07

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

11 total (human), top 11 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Air Pollutants	increases abundance, increases expression, affects expression	2
Valproic Acid	affects expression, increases expression	2
triphenyl phosphate	affects expression	1
beta-lapachone	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
Benzo(a)pyrene	decreases methylation	1
Folic Acid	decreases expression	1
Ozone	affects expression, increases abundance	1
Smoke	increases abundance, increases expression	1
Cyclosporine	decreases expression	1
Copper Sulfate	decreases expression	1

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_SG06	HAP1 C15orf40 (-) 1	Cancer cell line	Male
CVCL_XM20	HAP1 C15orf40 (-) 2	Cancer cell line	Male
CVCL_XM21	HAP1 C15orf40 (-) 3	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.