C1orf50

Summary

C1orf50 (chromosome 1 open reading frame 50, HGNC:28795) is a protein-coding gene on chromosome 1p34.2, encoding Uncharacterized protein C1orf50 (Q9BV19).

Enables identical protein binding activity.

Source: NCBI Gene 79078 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 11 total — 2 pathogenic, 1 likely-pathogenic
• MANE Select transcript: NM_024097

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:28795
Approved symbol	C1orf50
Name	chromosome 1 open reading frame 50
Location	1p34.2
Locus type	gene with protein product
Status	Approved
Aliases	MGC955
Ensembl gene	ENSG00000164008
Ensembl biotype	protein_coding
Entrez	79078

Gene structure

Transcript identifiers

Ensembl transcripts: 15 — 6 protein_coding_CDS_not_defined, 5 protein_coding, 2 retained_intron, 2 nonsense_mediated_decay

ENST00000372525, ENST00000468913, ENST00000494155, ENST00000650521, ENST00000685942, ENST00000687946, ENST00000691126, ENST00000691927, ENST00000692016, ENST00000692952, ENST00000693399, ENST00000869270, ENST00000869271, ENST00000935170, ENST00000935171

RefSeq mRNA: 1 — MANE Select: NM_024097 NM_024097

CCDS: CCDS473

Canonical transcript exons

ENST00000372525 — 5 exons

Exon	Start	End
ENSE00001080477	42767509	42767624
ENSE00001458015	42775209	42779491
ENSE00001458016	42767249	42767390
ENSE00003553102	42773563	42773649
ENSE00003668723	42774737	42774868

Expression profiles

Bgee: expression breadth ubiquitous, 134 present calls, max score 85.87.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 11.5899 / max 68.7528, expressed in 1810 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
2474	11.5899	1810

Top tissues by expression

134 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	85.87	gold quality
apex of heart	UBERON:0002098	81.50	gold quality
skeletal muscle tissue	UBERON:0001134	81.23	gold quality
mucosa of transverse colon	UBERON:0004991	80.67	gold quality
cortical plate	UBERON:0005343	80.58	gold quality
ganglionic eminence	UBERON:0004023	79.91	gold quality
granulocyte	CL:0000094	79.69	gold quality
gastrocnemius	UBERON:0001388	79.30	gold quality
muscle of leg	UBERON:0001383	79.25	gold quality
right lobe of liver	UBERON:0001114	79.17	gold quality
muscle tissue	UBERON:0002385	79.16	gold quality
ventricular zone	UBERON:0003053	79.13	gold quality
endometrium	UBERON:0001295	79.03	gold quality
right adrenal gland cortex	UBERON:0035827	78.95	gold quality
right adrenal gland	UBERON:0001233	78.85	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	78.58	gold quality
adrenal tissue	UBERON:0018303	78.47	gold quality
liver	UBERON:0002107	78.33	gold quality
hindlimb stylopod muscle	UBERON:0004252	78.03	gold quality
heart left ventricle	UBERON:0002084	78.01	gold quality
prefrontal cortex	UBERON:0000451	77.78	gold quality
substantia nigra	UBERON:0002038	77.41	gold quality
nucleus accumbens	UBERON:0001882	77.24	gold quality
stromal cell of endometrium	CL:0002255	77.19	gold quality
islet of Langerhans	UBERON:0000006	77.17	gold quality
leukocyte	CL:0000738	77.15	gold quality
temporal lobe	UBERON:0001871	77.06	gold quality
monocyte	CL:0000576	77.03	gold quality
amygdala	UBERON:0001876	76.91	gold quality
heart	UBERON:0000948	76.89	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	3.23

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

15 targeting C1orf50, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4534	99.99	66.58	1907
HSA-MIR-3185	99.99	68.12	1959
HSA-MIR-8082	99.95	67.27	1170
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-130B-5P	99.83	68.50	1888
HSA-MIR-302B-5P	99.50	69.49	1857
HSA-MIR-513C-5P	99.50	68.42	1730
HSA-MIR-514B-5P	99.50	68.19	1766
HSA-MIR-302D-5P	99.50	69.34	1863
HSA-MIR-4738-3P	98.98	67.98	1846
HSA-MIR-9500	98.62	66.54	1845
HSA-MIR-6892-5P	97.27	68.60	847
HSA-MIR-4513	95.04	67.06	727
HSA-MIR-6855-3P	95.04	66.57	725
HSA-MIR-2277-3P	91.94	62.27	299

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	C11H1orf50	ENSDARG00000071211
mus_musculus	AU022252	ENSMUSG00000078584
rattus_norvegicus	C5h1orf50	ENSRNOG00000027455
drosophila_melanogaster	CG31800	FBGN0051800
caenorhabditis_elegans		WBGENE00007436

Protein

Protein identifiers

Uncharacterized protein C1orf50 — Q9BV19 (reviewed: Q9BV19)

All UniProt accessions (3): A0A8I5QKT5, Q9BV19, R4GMT4

RefSeq proteins (1): NP_077002* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR019534	DUF2452	Family

Pfam: PF10504

UniProt features (4 total): chain 1, region of interest 1, coiled-coil region 1, sequence variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9BV19-F1	83.24	0.60

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 53 (showing top): chr1p34, LASTOWSKA_NEUROBLASTOMA_COPY_NUMBER_DN, GAZDA_DIAMOND_BLACKFAN_ANEMIA_ERYTHROID_DN, ELK1_02, LU_EZH2_TARGETS_UP, LIM_MAMMARY_STEM_CELL_DN, FEV_TARGET_GENES, GLI4_TARGET_GENES, ID1_TARGET_GENES, ID2_TARGET_GENES, OVOL3_TARGET_GENES, UBN1_TARGET_GENES, GSE10240_CTRL_VS_IL17_AND_IL22_STIM_PRIMARY_BRONCHIAL_EPITHELIAL_CELLS_UP, MIR6892_5P, MIR4513

GO Biological Process (1): biological_process (GO:0008150)

GO Molecular Function (2): identical protein binding (GO:0042802), protein binding (GO:0005515)

GO Cellular Component (1): cellular_component (GO:0005575)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
protein binding	1
binding	1

Protein interactions and networks

STRING

376 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
C1orf50	CFAP144	A6NL82	506
C1orf50	ZBED11	P0CF97	506
C1orf50	CCDC30	Q5VVM6	417
C1orf50	KLHL30	Q0D2K2	396
C1orf50	NIF3L1	Q9GZT8	396
C1orf50	ZNF691	Q5VV52	395
C1orf50	P3H1	Q32P28	394
C1orf50	SVBP	Q8N300	393
C1orf50	KLHDC7A	Q5VTJ3	393
C1orf50	DQX1	Q8TE96	392
C1orf50	TMEM120A	Q9BXJ8	392
C1orf50	NTAQ1	Q96HA8	379
C1orf50	RIMKLA	Q8IXN7	372
C1orf50	RDH14	Q9HBH5	367
C1orf50	SUGP2	Q8IX01	357

IntAct

76 interactions, top by confidence:

A	B	Type	Score
AHCY	C1orf50	psi-mi:“MI:0915”(physical association)	0.920
C1orf50	AHCY	psi-mi:“MI:0915”(physical association)	0.920
C1orf50	NTAQ1	psi-mi:“MI:0915”(physical association)	0.760
NTAQ1	C1orf50	psi-mi:“MI:0915”(physical association)	0.760
APPBP2	C1orf50	psi-mi:“MI:0915”(physical association)	0.720
C1orf50	APPBP2	psi-mi:“MI:0915”(physical association)	0.720
C1orf50	C1orf50	psi-mi:“MI:0915”(physical association)	0.670
C1orf50	EPM2AIP1	psi-mi:“MI:0915”(physical association)	0.560
EPM2AIP1	C1orf50	psi-mi:“MI:0915”(physical association)	0.560
C1orf50	MRP4	psi-mi:“MI:0915”(physical association)	0.560
TAE1	C1orf50	psi-mi:“MI:0915”(physical association)	0.560
MRP4	C1orf50	psi-mi:“MI:0915”(physical association)	0.560
C1orf50	TAE1	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (49): C1orf50 (Two-hybrid), C1orf50 (Two-hybrid), C1orf50 (Two-hybrid), C1orf50 (Two-hybrid), C1orf50 (Two-hybrid), C1orf50 (Affinity Capture-MS), C1orf50 (Two-hybrid), EPM2AIP1 (Two-hybrid), C1orf50 (Two-hybrid), C1orf50 (Affinity Capture-MS), C1orf50 (Two-hybrid), C1orf50 (Two-hybrid), C1orf50 (Two-hybrid), C1orf50 (Affinity Capture-MS), C1orf50 (Two-hybrid)

ESM2 similar proteins: A0A291NUG3, A0A291NUI4, A0A291NUI5, A2AN08, A2CBW9, A2RUW7, A8E5V9, A9CB91, B8XX90, E1C7U0, E7F4N7, F1M391, O36397, P03207, P03246, P03247, P06501, P0C722, P0C723, P0CZ24, P11823, P11824, P18801, P37588, P49408, P52132, P68966, P68967, P77206, Q02189, Q10115, Q148F6, Q2HRD2, Q2KI99, Q3KPU7, Q3TBT3, Q3UVY5, Q5HZQ9, Q5K6N0, Q5XIF1

Diamond homologs: Q09227, Q502G5, Q5EBG8, Q5PQ76, Q9BV19

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

11 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	1
Uncertain significance	2
Likely benign	1
Benign	1

Top pathogenic / likely-pathogenic (3)

Variant ID	HGVS	Classification
154142	GRCh38/hg38 1p34.2(chr1:40834404-43123071)x1	Pathogenic
3247799	NC_000001.10:g.(?43200757)(43424429_?)del	Pathogenic
152832	GRCh38/hg38 1p34.2(chr1:42653385-43093829)x1	Likely pathogenic

SpliceAI

496 predictions. Top by Δscore:

Variant	Effect	Δscore
1:42767388:G:GT	donor_gain	1.0000
1:42767388:G:T	donor_gain	1.0000
1:42773645:GGAAG:G	donor_gain	1.0000
1:42773646:GAAG:G	donor_gain	1.0000
1:42773646:GAAGG:G	donor_gain	1.0000
1:42773647:A:T	donor_gain	1.0000
1:42773647:AAGG:A	donor_loss	1.0000
1:42773648:AGG:A	donor_loss	1.0000
1:42773649:GGTAA:G	donor_loss	1.0000
1:42773650:G:GA	donor_loss	1.0000
1:42773651:T:G	donor_loss	1.0000
1:42774727:T:TA	acceptor_gain	1.0000
1:42774731:TCATA:T	acceptor_loss	1.0000
1:42774734:TAG:T	acceptor_loss	1.0000
1:42774735:A:AG	acceptor_gain	1.0000
1:42774736:G:GA	acceptor_loss	1.0000
1:42774736:G:GG	acceptor_gain	1.0000
1:42774736:GGTA:G	acceptor_gain	1.0000
1:42774867:AGGT:A	donor_loss	1.0000
1:42774869:G:GG	donor_gain	1.0000
1:42774869:GTA:G	donor_loss	1.0000
1:42774870:T:G	donor_loss	1.0000
1:42775203:CTCTA:C	acceptor_loss	1.0000
1:42775204:TCTAG:T	acceptor_loss	1.0000
1:42775205:CTAG:C	acceptor_loss	1.0000
1:42775206:TAG:T	acceptor_loss	1.0000
1:42775207:AGG:A	acceptor_loss	1.0000
1:42775208:G:A	acceptor_loss	1.0000
1:42775208:GGAAT:G	acceptor_gain	1.0000
1:42767386:GGGAG:G	donor_gain	0.9900

AlphaMissense

1296 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:42775272:T:A	W160R	0.994
1:42775272:T:C	W160R	0.994
1:42774796:A:C	K114N	0.992
1:42774796:A:T	K114N	0.992
1:42773641:G:C	A92P	0.985
1:42774812:T:G	Y120D	0.981
1:42774821:T:G	Y123D	0.981
1:42775212:T:A	W140R	0.981
1:42775212:T:C	W140R	0.981
1:42775214:G:C	W140C	0.981
1:42775214:G:T	W140C	0.981
1:42775274:G:C	W160C	0.981
1:42775274:G:T	W160C	0.981
1:42773587:G:C	A74P	0.979
1:42773611:G:C	A82P	0.979
1:42774749:G:C	A99P	0.979
1:42773600:T:C	L78P	0.977
1:42775255:T:C	L154P	0.977
1:42775273:G:C	W160S	0.977
1:42773609:T:A	I81K	0.976
1:42774851:T:C	S133P	0.976
1:42773581:G:C	A72P	0.973
1:42774795:A:T	K114I	0.973
1:42773630:T:C	L88S	0.969
1:42773642:C:A	A92D	0.967
1:42774819:T:C	L122P	0.967
1:42774795:A:C	K114T	0.965
1:42774768:T:C	L105P	0.960
1:42774784:T:G	C110W	0.960
1:42775269:T:C	S159P	0.960

dbSNP variants (sampled 300 via entrez): RS1000144610 (1:42774418 A>G), RS1000208421 (1:42767646 A>G), RS1000606747 (1:42774420 G>A), RS1001033744 (1:42768858 G>A), RS1001130019 (1:42775980 T>A,C), RS1001485054 (1:42768068 G>A), RS1001637977 (1:42774591 T>G), RS1001934293 (1:42767740 A>T), RS1002114208 (1:42774910 C>T), RS1002264746 (1:42769485 G>A), RS1002537281 (1:42769197 G>A), RS1002593046 (1:42776431 T>C), RS1002642382 (1:42776155 C>T), RS1002689722 (1:42765475 T>C), RS1002777390 (1:42779267 C>CTCGGGAGGCTGAGGCAGGAGAATG)

Disease associations

OMIM: gene `` | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

19 total (human), top 19 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
aristolochic acid I	increases expression	1
N,N,N’,N’-tetrakis(2-pyridylmethyl)ethylenediamine	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
abrine	increases expression	1
Resveratrol	affects cotreatment, increases expression	1
Temozolomide	increases expression	1
Acetaminophen	increases expression	1
Cadmium	increases abundance, increases expression	1
Caffeine	affects phosphorylation	1
Methyl Methanesulfonate	increases expression	1
Plant Extracts	affects cotreatment, increases expression	1
Selenium	affects cotreatment, decreases expression	1
Testosterone	increases expression	1
Tobacco Smoke Pollution	increases expression	1
Valproic Acid	affects expression	1
Vitamin E	affects cotreatment, decreases expression	1
Cyclosporine	increases expression	1
Cadmium Chloride	increases expression, increases abundance	1
Acrylamide	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.