CABP7

Summary

CABP7 (calcium binding protein 7, HGNC:20834) is a protein-coding gene on chromosome 22q12.2, encoding Calcium-binding protein 7 (Q86V35). Negatively regulates Golgi-to-plasma membrane trafficking by interacting with PI4KB and inhibiting its activity.

Predicted to enable calcium ion binding activity. Located in trans-Golgi network membrane.

Source: NCBI Gene 164633 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 41 total
• MANE Select transcript: NM_182527

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:20834
Approved symbol	CABP7
Name	calcium binding protein 7
Location	22q12.2
Locus type	gene with protein product
Status	Approved
Aliases	MGC57793
Ensembl gene	ENSG00000100314
Ensembl biotype	protein_coding
OMIM	618759
Entrez	164633

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

ENST00000216144, ENST00000952608

RefSeq mRNA: 1 — MANE Select: NM_182527 NM_182527

CCDS: CCDS13867

Canonical transcript exons

ENST00000216144 — 5 exons

Exon	Start	End
ENSE00000652118	29727662	29727805
ENSE00000652119	29728630	29728742
ENSE00000652120	29729055	29729208
ENSE00001312931	29720003	29720533
ENSE00001313884	29729442	29731833

Expression profiles

Bgee: expression breadth ubiquitous, 127 present calls, max score 88.57.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.4078 / max 35.2375, expressed in 158 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
191630	0.4078	158

Top tissues by expression

215 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
pons	UBERON:0000988	88.57	gold quality
Ammon’s horn	UBERON:0001954	87.36	gold quality
islet of Langerhans	UBERON:0000006	80.97	gold quality
ganglionic eminence	UBERON:0004023	78.95	gold quality
buccal mucosa cell	CL:0002336	78.72	gold quality
right hemisphere of cerebellum	UBERON:0014890	77.48	gold quality
caput epididymis	UBERON:0004358	76.80	gold quality
cerebellar hemisphere	UBERON:0002245	76.56	gold quality
cerebellar cortex	UBERON:0002129	76.49	gold quality
cerebellum	UBERON:0002037	76.44	gold quality
cortical plate	UBERON:0005343	74.43	gold quality
superior vestibular nucleus	UBERON:0007227	73.59	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	73.58	gold quality
spinal cord	UBERON:0002240	73.12	gold quality
right adrenal gland cortex	UBERON:0035827	72.61	gold quality
right adrenal gland	UBERON:0001233	72.44	gold quality
cerebellar vermis	UBERON:0004720	71.70	gold quality
entorhinal cortex	UBERON:0002728	71.33	gold quality
left adrenal gland	UBERON:0001234	70.39	gold quality
cerebral cortex	UBERON:0000956	70.11	gold quality
adrenal cortex	UBERON:0001235	69.92	gold quality
anterior cingulate cortex	UBERON:0009835	69.91	gold quality
left adrenal gland cortex	UBERON:0035825	69.56	gold quality
medulla oblongata	UBERON:0001896	69.42	gold quality
prefrontal cortex	UBERON:0000451	68.78	gold quality
temporal lobe	UBERON:0001871	67.81	gold quality
pancreas	UBERON:0001264	67.70	gold quality
adrenal gland	UBERON:0002369	67.69	gold quality
substantia nigra	UBERON:0002038	67.41	gold quality
amygdala	UBERON:0001876	67.36	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-5061	yes	10.31
E-GEOD-81608	yes	4.61
E-ANND-3	no	3.02
E-GEOD-83139	no	2.84

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

108 targeting CABP7, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-1193	100.00	65.93	529
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-4723-5P	99.97	68.70	2034
HSA-MIR-5698	99.97	68.49	2029
HSA-MIR-7111-5P	99.97	68.48	2062
HSA-MIR-185-3P	99.95	67.01	1743
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-9902	99.89	69.15	2250
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-3151-5P	99.86	63.83	1069
HSA-MIR-629-3P	99.85	67.99	1875
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-6842-5P	99.80	67.54	1587
HSA-MIR-7110-5P	99.80	67.84	1712
HSA-MIR-448	99.79	72.37	2103
HSA-MIR-6817-3P	99.79	68.35	2126
HSA-MIR-92A-2-5P	99.75	67.01	2164
HSA-MIR-6764-5P	99.75	67.89	2304
HSA-MIR-148A-3P	99.74	73.77	1700
HSA-MIR-148B-3P	99.74	73.75	1700
HSA-MIR-152-3P	99.74	73.75	1703
HSA-MIR-149-3P	99.72	68.22	3963

Literature-anchored findings (GeneRIF, showing 3)

• CaBP7 and 8 possess a targeting mechanism that is unique amongst the CaBPs that may contribute to differential functional Ca(2+)-sensing by these family members. (PMID:19338761)
• Data indicate that the Ca(2+)-bound form of calcium-binding protein 7 (CaBP7) N-terminal domain (NTD) is monomeric and exhibits an open conformation. (PMID:22989873)
• CaBP7 regulates lysosome clustering at the intercellular bridge during cytokinesis in HeLa cells. CaBP7 depletion induces lysosome mislocalization, extension of intercellular bridge lifetime, and cytokinesis failure. (PMID:25717182)

Cross-species orthologs

16 orthologs

Organism	Symbol	Gene ID
danio_rerio	cabp7b	ENSDARG00000060846
danio_rerio	CABP7	ENSDARG00000078272
mus_musculus	Cabp7	ENSMUSG00000009075
rattus_norvegicus	Cabp7	ENSRNOG00000057703
drosophila_melanogaster	TpnC4	FBGN0033027
drosophila_melanogaster	CG13526	FBGN0034774
drosophila_melanogaster	CG5024	FBGN0039373
drosophila_melanogaster	CG17770	FBGN0039374
drosophila_melanogaster	CG30378	FBGN0050378
caenorhabditis_elegans		WBGENE00000285
caenorhabditis_elegans		WBGENE00000287
caenorhabditis_elegans	pat-10	WBGENE00003934
caenorhabditis_elegans		WBGENE00006583
caenorhabditis_elegans		WBGENE00008453
caenorhabditis_elegans	F35C12.3	WBGENE00009408
caenorhabditis_elegans		WBGENE00015264

Paralogs (20): CABP5 (ENSG00000105507), CALML4 (ENSG00000129007), CALM2 (ENSG00000143933), CETN2 (ENSG00000147400), CETN3 (ENSG00000153140), CABP1 (ENSG00000157782), CALM3 (ENSG00000160014), CABP2 (ENSG00000167791), CALML6 (ENSG00000169885), EFCAB3 (ENSG00000172421), EFCAB12 (ENSG00000172771), CABP4 (ENSG00000175544), CETN1 (ENSG00000177143), CALML3 (ENSG00000178363), CALML5 (ENSG00000178372), CALN1 (ENSG00000183166), CALM1 (ENSG00000198668), EFCAB2 (ENSG00000203666), EFCAB7 (ENSG00000203965), EFCAB9 (ENSG00000214360)

Protein

Protein identifiers

Calcium-binding protein 7 — Q86V35 (reviewed: Q86V35)

Alternative names: Calneuron II, Calneuron-2

All UniProt accessions (1): Q86V35

UniProt curated annotations — full annotation on UniProt →

Function. Negatively regulates Golgi-to-plasma membrane trafficking by interacting with PI4KB and inhibiting its activity.

Subunit / interactions. Interacts with PI4KB. This binding competes with FREQ/NCS1 binding in a calcium-dependent manner.

Subcellular location. Golgi apparatus. trans-Golgi network membrane. Cytoplasm. Perinuclear region. Cell membrane.

Domain organisation. The C-terminal transmembrane domain (TMD) is necessary and sufficient for membrane targeting.

RefSeq proteins (1): NP_872333* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001751	S100/CaBP7/8-like_CS	Conserved_site
IPR002048	EF_hand_dom	Domain
IPR011992	EF-hand-dom_pair	Homologous_superfamily
IPR018247	EF_Hand_1_Ca_BS	Binding_site
IPR051111	Ca-binding_regulatory	Family

Pfam: PF13499

UniProt features (24 total): binding site 9, helix 5, topological domain 2, strand 2, turn 2, domain 2, chain 1, transmembrane region 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
2LV7	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q86V35-F1	58.35	0.00

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (9): 82; 84; 86; 88; 93; 46; 48; 50; 57

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 86 (showing top): GOBP_NEUROMUSCULAR_JUNCTION_DEVELOPMENT, GOBP_MUSCLE_TISSUE_DEVELOPMENT, PEREZ_TP63_TARGETS, AREB6_01, GOBP_CELL_JUNCTION_ORGANIZATION, GOCC_TRANS_GOLGI_NETWORK, GOBP_MUSCLE_CONTRACTION, GGCKCATGS_UNKNOWN, TGACATY_UNKNOWN, AACTTT_UNKNOWN, PEREZ_TP53_AND_TP63_TARGETS, GOBP_MUSCLE_SYSTEM_PROCESS, AGCTCCT_MIR28, AP2GAMMA_01, LEIN_PONS_MARKERS

GO Biological Process (0):

GO Molecular Function (3): calcium ion binding (GO:0005509), protein binding (GO:0005515), metal ion binding (GO:0046872)

GO Cellular Component (6): plasma membrane (GO:0005886), trans-Golgi network membrane (GO:0032588), perinuclear region of cytoplasm (GO:0048471), cytoplasm (GO:0005737), Golgi apparatus (GO:0005794), membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
cytoplasm	2
metal ion binding	1
binding	1
cation binding	1
membrane	1
cell periphery	1
trans-Golgi network	1
organelle membrane	1
intracellular anatomical structure	1
endomembrane system	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

1499 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CABP7	GUF1	Q8N442	598
CABP7	PROSER1	Q86XN7	507
CABP7	NCS1	P36610	492
CABP7	S100A6	P06703	466
CABP7	NXPH4	O95158	464
CABP7	RCVRN	P35243	462
CABP7	PI4KB	P78405	458
CABP7	S100G	P29377	456
CABP7	RASSF8	Q8NHQ8	438
CABP7	SMOC1	Q9H4F8	426
CABP7	RYR1	P21817	425
CABP7	ITPR1	Q14643	417
CABP7	TOR1AIP1	Q5JTV8	400
CABP7	PVALB	P20472	392
CABP7	CAPN12	Q6ZSI9	386

IntAct

5 interactions, top by confidence:

A	B	Type	Score
CABP7	MTIF3	psi-mi:“MI:0915”(physical association)	0.560
CABP7	EPDR1	psi-mi:“MI:0915”(physical association)	0.400

BioGRID (5): MTIF3 (Two-hybrid), EPDR1 (Affinity Capture-MS), CABP7 (Affinity Capture-MS), CABP7 (Affinity Capture-RNA), CABP7 (Affinity Capture-MS)

ESM2 similar proteins: A1A4F0, A2QM49, A2ZIM4, E1BPQ3, E2R4X3, F4IXT6, N4WW42, O49567, O57428, O81514, P0C941, P18380, P38279, P50581, P52885, P56180, P68253, P86214, P86252, P86265, Q01741, Q0C8A7, Q0DWQ7, Q2QWX8, Q2RBJ4, Q2XXR3, Q3SZ89, Q4R6N0, Q5GH77, Q5HYJ1, Q5ZHX6, Q66H96, Q6UXP3, Q6YXZ1, Q7X7E9, Q7XT08, Q866X0, Q86UG4, Q86V35, Q8BFZ1

Diamond homologs: A6H742, A7E3Q8, O50064, O59945, O88818, P0CM54, P0CM55, P13796, P13797, P19179, P32599, P46939, P48451, P54680, Q06BI3, Q14651, Q24214, Q25088, Q3V0K9, Q55G87, Q61233, Q63598, Q66H96, Q6DG81, Q6P698, Q7F0J0, Q7G188, Q7XHW4, Q84UL5, Q866X0, Q86V35, Q91ZM8, Q99K51, Q9BXU9, Q9FJ70, Q9FKI0, Q9JJG7, Q9N4M4, Q9SJ84, Q9SVG9

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

41 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	36
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

846 predictions. Top by Δscore:

Variant	Effect	Δscore
22:29720529:GGAGG:G	donor_gain	1.0000
22:29720530:GAGG:G	donor_gain	1.0000
22:29720530:GAGGG:G	donor_gain	1.0000
22:29720532:GG:G	donor_gain	1.0000
22:29720533:GG:G	donor_gain	1.0000
22:29720534:G:C	donor_loss	1.0000
22:29720534:G:GG	donor_gain	1.0000
22:29720535:T:G	donor_loss	1.0000
22:29727658:TCA:T	acceptor_loss	1.0000
22:29727660:A:AG	acceptor_gain	1.0000
22:29727660:A:T	acceptor_loss	1.0000
22:29727661:G:GA	acceptor_gain	1.0000
22:29727661:GA:G	acceptor_gain	1.0000
22:29727661:GAGA:G	acceptor_gain	1.0000
22:29727661:GAGAT:G	acceptor_gain	1.0000
22:29727801:GGATG:G	donor_gain	1.0000
22:29727802:GATG:G	donor_gain	1.0000
22:29727802:GATGG:G	donor_gain	1.0000
22:29727803:ATG:A	donor_gain	1.0000
22:29727804:TG:T	donor_gain	1.0000
22:29727805:GG:G	donor_gain	1.0000
22:29727806:G:GA	donor_loss	1.0000
22:29727806:G:GG	donor_gain	1.0000
22:29728624:CACCA:C	acceptor_loss	1.0000
22:29728626:CCA:C	acceptor_loss	1.0000
22:29728627:CAG:C	acceptor_loss	1.0000
22:29728628:A:C	acceptor_loss	1.0000
22:29728739:G:GT	donor_gain	1.0000
22:29728740:A:T	donor_gain	1.0000
22:29729049:C:A	acceptor_gain	1.0000

AlphaMissense

1432 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
22:29727676:T:C	F42L	1.000
22:29727677:T:C	F42S	1.000
22:29727678:C:A	F42L	1.000
22:29727678:C:G	F42L	1.000
22:29727686:T:C	F45S	1.000
22:29727689:A:C	D46A	1.000
22:29727704:G:T	G51V	1.000
22:29727710:T:A	I53N	1.000
22:29727710:T:C	I53T	1.000
22:29727710:T:G	I53S	1.000
22:29727725:T:A	L58Q	1.000
22:29727725:T:C	L58P	1.000
22:29727733:G:C	A61P	1.000
22:29727734:C:A	A61D	1.000
22:29727737:T:A	M62K	1.000
22:29727737:T:C	M62T	1.000
22:29727737:T:G	M62R	1.000
22:29727740:G:C	R63P	1.000
22:29727746:T:C	L65P	1.000
22:29727748:G:C	G66R	1.000
22:29727749:G:T	G66V	1.000
22:29727757:C:T	P69S	1.000
22:29727758:C:A	P69H	1.000
22:29727758:C:G	P69R	1.000
22:29727773:T:C	L74P	1.000
22:29727794:T:C	L81P	1.000
22:29727797:A:C	D82A	1.000
22:29727797:A:T	D82V	1.000
22:29728654:A:T	E93V	1.000
22:29728656:T:C	F94L	1.000

dbSNP variants (sampled 300 via entrez): RS1000049546 (22:29720259 C>A,T), RS1000100090 (22:29720372 A>C,G,T), RS1000159222 (22:29727297 T>G), RS1000508329 (22:29722747 C>G), RS1000599738 (22:29722948 C>T), RS1001054236 (22:29719003 A>G), RS1001062861 (22:29724485 C>G,T), RS1001106630 (22:29719282 G>A,C), RS1001261040 (22:29720008 ACGAG>A,ACGAGCGAG,ACGAGCGAGCGAGCGAGCGAG), RS1001374204 (22:29730272 G>A), RS1001661523 (22:29718494 T>C), RS1001714012 (22:29718741 G>A), RS1002276016 (22:29724324 C>G,T), RS1002294045 (22:29723512 G>A), RS1002383147 (22:29718367 T>C)

Disease associations

OMIM: gene MIM:618759 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST003974_1	Tonsillectomy	1.000000e-09
GCST90000050_84	Age at first birth	2.000000e-08

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0007924	tonsillectomy risk measurement
EFO:0009101	age at first birth measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

20 total (human), top 20 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, decreases methylation	2
Valproic Acid	affects expression, increases methylation	2
bisphenol F	decreases expression	1
trichostatin A	increases expression	1
butyraldehyde	increases expression	1
tetrabromobisphenol A	increases expression	1
aflatoxin B2	decreases methylation	1
tetrachlorodian	increases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	decreases expression	1
licochalcone B	increases expression	1
Arsenic	affects methylation	1
Malathion	decreases expression	1
Plant Oils	increases expression	1
Rotenone	decreases expression	1
Tobacco Smoke Pollution	decreases expression	1
8-Bromo Cyclic Adenosine Monophosphate	decreases expression	1
Aflatoxin B1	decreases expression	1
Asbestos, Serpentine	increases expression	1
Cadmium Chloride	decreases expression	1
Acrylamide	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.