CASP14

Summary

CASP14 (caspase 14, HGNC:1502) is a protein-coding gene on chromosome 19p13.12, encoding Caspase-14 (P31944). Non-apoptotic caspase involved in epidermal differentiation.

This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. This caspase has been shown to be processed and activated by caspase 8 and caspase 10 in vitro, and by anti-Fas agonist antibody or TNF-related apoptosis inducing ligand in vivo. The expression and processing of this caspase may be involved in keratinocyte terminal differentiation, which is important for the formation of the skin barrier.

Source: NCBI Gene 23581 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 90 total
• Phenotypes (HPO): 2
• Druggable target: yes
• MANE Select transcript: NM_012114

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:1502
Approved symbol	CASP14
Name	caspase 14
Location	19p13.12
Locus type	gene with protein product
Status	Approved
Aliases	MICE, MGC119078, MGC119079, caspase-14
Ensembl gene	ENSG00000105141
Ensembl biotype	protein_coding
OMIM	605848
Entrez	23581

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 1 protein_coding, 1 retained_intron

ENST00000427043, ENST00000598738

RefSeq mRNA: 1 — MANE Select: NM_012114 NM_012114

CCDS: CCDS12323

Canonical transcript exons

ENST00000427043 — 7 exons

Exon	Start	End
ENSE00000689553	15055158	15055274
ENSE00000689554	15053733	15053958
ENSE00000873256	15053482	15053631
ENSE00001740684	15052206	15052278
ENSE00001782777	15049480	15049645
ENSE00003015547	15055985	15058293
ENSE00003542678	15055430	15055533

Expression profiles

Bgee: expression breadth ubiquitous, 127 present calls, max score 98.45.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.6804 / max 288.5297, expressed in 44 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
174298	0.4816	37
174297	0.1560	25
174295	0.0243	9
174296	0.0140	7
174299	0.0045	2

Top tissues by expression

247 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
skin of abdomen	UBERON:0001416	98.45	gold quality
skin of leg	UBERON:0001511	97.88	gold quality
zone of skin	UBERON:0000014	95.08	gold quality
upper arm skin	UBERON:0004263	85.56	silver quality
mammalian vulva	UBERON:0000997	82.75	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	75.00	gold quality
pancreatic ductal cell	CL:0002079	70.79	silver quality
vagina	UBERON:0000996	68.61	gold quality
penis	UBERON:0000989	67.36	gold quality
upper leg skin	UBERON:0004262	67.27	gold quality
tibialis anterior	UBERON:0001385	65.79	silver quality
ileal mucosa	UBERON:0000331	62.59	gold quality
skin of hip	UBERON:0001554	57.45	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	57.35	silver quality
lower esophagus mucosa	UBERON:0035834	57.21	gold quality
epithelial cell of pancreas	CL:0000083	55.96	gold quality
deltoid	UBERON:0001476	54.55	gold quality
cardiac muscle of right atrium	UBERON:0003379	54.34	gold quality
left ventricle myocardium	UBERON:0006566	54.23	gold quality
gastrocnemius	UBERON:0001388	54.15	gold quality
kidney epithelium	UBERON:0004819	53.93	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	52.51	gold quality
muscle of leg	UBERON:0001383	51.33	gold quality
heart left ventricle	UBERON:0002084	50.66	gold quality
cardiac ventricle	UBERON:0002082	50.30	gold quality
myocardium	UBERON:0002349	50.25	gold quality
apex of heart	UBERON:0002098	50.11	gold quality
body of pancreas	UBERON:0001150	50.03	gold quality
esophagus mucosa	UBERON:0002469	48.94	gold quality
popliteal artery	UBERON:0002250	48.31	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): AP1, FOXO1, HR, JUN, NFKB

miRNA regulators (miRDB)

131 targeting CASP14, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-6758-5P	100.00	66.21	1470
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-6856-5P	100.00	65.47	1298
HSA-MIR-4510	100.00	66.60	2050
HSA-MIR-4481	100.00	66.42	1669
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-3134	100.00	66.43	777
HSA-MIR-6127	100.00	66.76	2188
HSA-MIR-6129	100.00	66.46	2080
HSA-MIR-6130	100.00	66.69	2012
HSA-MIR-6133	100.00	66.48	2064
HSA-MIR-6851-5P	100.00	65.63	1294
HSA-MIR-6077	99.99	68.04	2299
HSA-MIR-4531	99.99	69.70	3181
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-4745-5P	99.98	65.95	1028
HSA-MIR-4715-3P	99.98	66.03	670
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-302E	99.96	70.74	2669
HSA-MIR-6508-5P	99.92	70.67	2465
HSA-MIR-9902	99.89	69.15	2250
HSA-MIR-6124	99.87	69.78	3551
HSA-MIR-4779	99.86	66.50	1583
HSA-MIR-8067	99.86	69.59	2260
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-765	99.84	68.24	2442

Literature-anchored findings (GeneRIF, showing 33)

• processing of caspase 14 in epidermal differentiation (PMID:12200134)
• caspase-14, similarly to other keratinocyte differentiation-associated proteins, is downregulated by retinoids, suggesting that this caspase plays a part in terminal keratinocyte differentiation and skin barrier formation (PMID:12445205)
• Loss of caspase-14 expression is associated with psoriatic lesions (PMID:15331408)
• psoriatic keratinocytes may activate mechanisms that prevent the nuclear entry of caspase 14 (PMID:15619438)
• caspase-14 is aberrantly expressed in epithelial tumors (PMID:16061209)
• there are tumor-specific alterations in caspase-14 expression which may define subsets of epithelial cancers with distinct clinical behaviors (PMID:16061862)
• Caspase-14 is present in the human placenta, primarily in the trophoblast, but its function is not clear (PMID:16168224)
• caspase-14 has a substrate specificity similar to the group I caspases, and demonstrate that it functions in a distinct manner from executioner caspases to carry out specific proteolytic events during keratinocyte differentiation. (PMID:16854378)
• caspase-14 is up-regulated during trophoblast differentiation, as represented by the BeWo cell line (PMID:17359582)
• Expression of exogenous caspase-14 led to growth inhibition and reduced the tumorigenicity of A431 skin cancer cells. (PMID:17436577)
• caspase-14 gene is rarely mutated in colorectal carcinomas, but not mutated in gastric, lung, breast and hepatocellular carcinomas (PMID:17558860)
• These data reveal the basic organization of the human caspase-14 promoter and suggest an important role of AP-1 and NFkappaB in the transcriptional control of caspase-14. (PMID:18424262)
• Expression of caspase 6 and caspase 14 genes were different between normal skin of keloid-prone individuals and normal skin of keloid-resistant patients. (PMID:18762957)
• Results imply that caspase-14 inhibits trophoblast differentiation. (PMID:19747408)
• Purification and characterization of active caspase-14 from human epidermis and development of the cleavage site-directed antibody (PMID:19960512)
• Caspase 14 is a cysteine protease and is inhibited by full-length LEKTI and 5 recombinant fragments of LEKTI to varied extents. (PMID:20533828)
• Regulation of caspase 14 levels provides a possible link between impaired skin barrier function and inflammatory reactions in skin diseases such as atopic dermatitis and may offer an explanation to the skin barrier dysfunction in inflamed skin lesions. (PMID:21539619)
• Casp-14 overexpression correlated with tumor stage, cell differentiation and lymphovascular involvement, suggesting that casp-14 was associated with tumor cell growth and metastatic potential. (PMID:21567094)
• A strong association was evident between GATA-3 and caspase-14 expression in preinvasive ductal carcinoma in situ samples, where GATA-3 also displayed prognostic significance (PMID:21930782)
• genetic polynorphism is associated with the risk of childhood leukemia (PMID:22548721)
• regulation of procaspase-14 maturation during terminal differentiation is a unique two-step process involving KLK7 and an activation intermediate of caspase-14. (PMID:22825846)
• Caspase-14 might play a significant role in the pathogenesis of diabetic retinopathy by accelerating retinal endothelial and epithelial cells death. (PMID:22876114)
• ceramides, an important structural lipid, stimulate caspase-14 expression, coordinating formation of lipid lamellar membranes with the formation of corneocytes (PMID:23362869)
• Suggest caspase-14 is a marker of human skin differentiation during development. (PMID:23377137)
• genetic polymorphisms in AICDA and CASP14 are associated with risk for brain tumor in Korean children. (PMID:23408445)
• Results suggest that caspase-14 may interact with GCM1 to participate in syncytiotrophoblast differentiation during placental development. (PMID:23580611)
• partial loss of caspase 14 is not associated with dedifferentiation in neoplastic lesions of the oral mucosa (PMID:23645350)
• Mesotrypsin generated saposins A-D from prosaposin, and mature caspase-14 contributed to this process by activating mesotrypsinogen to mesotrypsin. Knockdown of these proteases markedly down-regulated saposin A synthesis in skin equivalent models. (PMID:24872419)
• caspase-14 contributes to retinal pigment epithelium cell barrier disruption under hyperglycemic conditions. (PMID:25121097)
• Caspase-14 was decreased in inflammatory lesions compared to non-lesion in atopic dermatitis. The amount of caspase-14 in the lesions correlated with clinical severity as determined by eczema area and severity index score and the skin barrier functions. (PMID:25315296)
• overexpression of S100A7 in A431 skin squamous carcinoma cells significantly promoted cell proliferation in vitro and tumor growth in vivo, whereas it suppressed the expression of GATA-3 and caspase-14 (PMID:25651379)
• High CASP14 expression is a marker of breast cancer aggressiveness in association with proliferation, TNBC phenotype, and cancer stemness. (PMID:28570747)
• Caspase-14-From Biomolecular Basics to Clinical Approach. A Review of Available Data. (PMID:34070382)

Cross-species orthologs

9 orthologs

Organism	Symbol	Gene ID
danio_rerio	casp8	ENSDARG00000058325
mus_musculus	Casp14	ENSMUSG00000005355
rattus_norvegicus	Casp14	ENSRNOG00000007352
drosophila_melanogaster	Dronc	FBGN0026404
drosophila_melanogaster	Decay	FBGN0028381
caenorhabditis_elegans		WBGENE00000417
caenorhabditis_elegans		WBGENE00000819
caenorhabditis_elegans		WBGENE00000820
caenorhabditis_elegans	csp-3	WBGENE00000821

Paralogs (16): CASP10 (ENSG00000003400), CFLAR (ENSG00000003402), CASP8 (ENSG00000064012), PYCARD (ENSG00000103490), CASP2 (ENSG00000106144), CASP9 (ENSG00000132906), CASP1 (ENSG00000137752), CASP5 (ENSG00000137757), CASP6 (ENSG00000138794), CASP3 (ENSG00000164305), CASP7 (ENSG00000165806), PYDC1 (ENSG00000169900), CASP4 (ENSG00000196954), CARD16 (ENSG00000204397), CASP12 (ENSG00000204403), CARD18 (ENSG00000255501)

Protein

Protein identifiers

Caspase-14 — P31944 (reviewed: P31944)

All UniProt accessions (2): B2CIS9, P31944

UniProt curated annotations — full annotation on UniProt →

Function. Non-apoptotic caspase involved in epidermal differentiation. Is the predominant caspase in epidermal stratum corneum. Seems to play a role in keratinocyte differentiation and is required for cornification. Regulates maturation of the epidermis by proteolytically processing filaggrin. In vitro has a preference for the substrate [WY]-X-X-D motif and is active on the synthetic caspase substrate WEHD-ACF. Involved in processing of prosaposin in the epidermis. May be involved in retinal pigment epithelium cell barrier function. Involved in DNA degradation in differentiated keratinocytes probably by cleaving DFFA/ICAD leading to liberation of DFFB/CAD.

Subunit / interactions. Heterodimer of a large and a small subunit, both processed from the precursor; the mature active form is a p17/p10 dimer and the intermediate form a p20/p8 dimer.

Subcellular location. Cytoplasm. Nucleus.

Tissue specificity. Expressed in keratinocytes of adult skin suprabasal layers (from spinous layers to the stratum granulosum and stratum corneum) (at protein level). Expressed in keratinocytes of hair shaft and sebaceous glands (at protein level). In psoriatic skin only expressed at very low levels. The p17/10 mature form is expressed in epidermis stratum corneum, the p20/p8 intermediate form in epidermis upper granular cells of the stratum granulosum.

Post-translational modifications. Maturation by proteolytic processing appears to be a two-step process. The precursor is processed by KLK7 to yield the p20/p8 intermediate form which acts on the precursor to yield the p17/p10 mature form. Initially, cleavage between Ile-152 and Lys-153 has been proposed to yield the large and small subunits of the active enzyme.

Disease relevance. Ichthyosis, congenital, autosomal recessive 12 (ARCI12) [MIM:617320] A form of autosomal recessive congenital ichthyosis, a disorder of keratinization with abnormal differentiation and desquamation of the epidermis, resulting in abnormal skin scaling over the whole body. The main skin phenotypes are lamellar ichthyosis (LI) and non-bullous congenital ichthyosiform erythroderma (NCIE), although phenotypic overlap within the same patient or among patients from the same family can occur. Lamellar ichthyosis is a condition often associated with an embedment in a collodion-like membrane at birth; skin scales later develop, covering the entire body surface. Non-bullous congenital ichthyosiform erythroderma characterized by fine whitish scaling on an erythrodermal background; larger brownish scales are present on the buttocks, neck and legs. The disease is caused by variants affecting the gene represented in this entry.

Activity regulation. Inhibited by caspase-1 inhibitor YVAD-FMK and the pan-caspase inhibitor VAD-FMK.

Induction. In undifferentiated keratinocytes under postconfluency growth conditions (in vitro). By high glucose in retinal pigment epithelia cells.

Miscellaneous. Expressed in bacteria requires high concentrations of kosmotropic salts to be activated. The mature and the intermediate form differ in activity towards synthetic caspase substrates: the p17/p10 mature form but not the p20/p8 intermediate form is active on WEHD-MCA; p20/p8 is active on a number of other caspase substrates without any marked preference (VEID-AFC, DEVD-AFC, LEVD-AFC and LEHD-AFC).

Similarity. Belongs to the peptidase C14A family.

RefSeq proteins (1): NP_036246* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001309	Pept_C14_p20	Domain
IPR002138	Pept_C14_p10	Domain
IPR002398	Pept_C14	Family
IPR011600	Pept_C14_caspase	Domain
IPR015917	Pept_C14A	Domain
IPR029030	Caspase-like_dom_sf	Homologous_superfamily
IPR033139	Caspase_cys_AS	Active_site

Pfam: PF00656

UniProt features (8 total): chain 4, propeptide 2, active site 2

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P31944-F1	89.44	0.73

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (2): 89; 132

Function

Pathways and Gene Ontology

Reactome pathways

5 pathways

ID	Pathway
R-HSA-6809371	Formation of the cornified envelope
R-HSA-9725554	Differentiation of Keratinocytes in Interfollicular Epidermis in Mammalian Skin
R-HSA-1266738	Developmental Biology
R-HSA-6805567	Keratinization
R-HSA-9734767	Developmental Cell Lineages

MSigDB gene sets: 82 (showing top): GOBP_EPITHELIUM_DEVELOPMENT, GOBP_EPIDERMAL_CELL_DIFFERENTIATION, GOMF_CYSTEINE_TYPE_PEPTIDASE_ACTIVITY, GOBP_EPIDERMIS_DEVELOPMENT, GOBP_NEURON_APOPTOTIC_PROCESS, GOBP_KERATINIZATION, GOBP_SKIN_DEVELOPMENT, GOBP_POSITIVE_REGULATION_OF_NEURON_APOPTOTIC_PROCESS, GOBP_PROTEOLYSIS, GOCC_INTERMEDIATE_FILAMENT_CYTOSKELETON, GOCC_KERATIN_FILAMENT, GOCC_CORNIFIED_ENVELOPE, chr19p13, GOMF_PEPTIDASE_ACTIVITY, MODULE_220

GO Biological Process (6): proteolysis (GO:0006508), epidermis development (GO:0008544), keratinization (GO:0031424), positive regulation of neuron apoptotic process (GO:0043525), cornification (GO:0070268), cell differentiation (GO:0030154)

GO Molecular Function (5): cysteine-type endopeptidase activity (GO:0004197), protein binding (GO:0005515), peptidase activity (GO:0008233), cysteine-type peptidase activity (GO:0008234), hydrolase activity (GO:0016787)

GO Cellular Component (7): cornified envelope (GO:0001533), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), mitochondrion (GO:0005739), cytosol (GO:0005829), keratin filament (GO:0045095)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
Developmental Biology	2
Keratinization	1
Developmental Cell Lineages of the Integumentary System	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
intracellular membrane-bounded organelle	2
cytoplasm	2
protein metabolic process	1
tissue development	1
keratinocyte differentiation	1
multicellular organismal process	1
positive regulation of apoptotic process	1
regulation of neuron apoptotic process	1
neuron apoptotic process	1
programmed cell death	1
keratinization	1
cornified envelope assembly	1
cellular developmental process	1
endopeptidase activity	1
cysteine-type peptidase activity	1
binding	1
hydrolase activity	1
catalytic activity, acting on a protein	1
peptidase activity	1
catalytic activity	1
plasma membrane	1
nuclear lumen	1
intracellular anatomical structure	1
intermediate filament	1

Protein interactions and networks

STRING

1348 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CASP14	FLG2	Q5D862	874
CASP14	FLG	P20930	862
CASP14	BLMH	Q13867	746
CASP14	DFFB	O76075	635
CASP14	LORICRIN	P23490	623
CASP14	TGM3	Q08188	608
CASP14	DFFA	O00273	569
CASP14	PNPLA1	Q8N8W4	567
CASP14	ALOXE3	Q9BYJ1	554
CASP14	ALOX12B	O75342	554
CASP14	RASA4	O43374	550
CASP14	TINCR	A0A2R8Y7D0	549
CASP14	IVL	P07476	545
CASP14	KRTAP13-3	Q3SY46	541
CASP14	TGM1	P22735	533

IntAct

122 interactions, top by confidence:

A	B	Type	Score
JADE1	KAT7	psi-mi:“MI:0914”(association)	0.720
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
IFT88	IFT56	psi-mi:“MI:0914”(association)	0.640
GTF2H3	ERCC3	psi-mi:“MI:0914”(association)	0.640
NCBP1	KPNA3	psi-mi:“MI:0914”(association)	0.640
NCBP2	KPNA3	psi-mi:“MI:0914”(association)	0.640
CCNC	MED19	psi-mi:“MI:0914”(association)	0.640
ALDH3A1	RCCD1	psi-mi:“MI:0914”(association)	0.640
CFTR	VIM	psi-mi:“MI:0914”(association)	0.610
CASP14	MEOX2	psi-mi:“MI:0915”(physical association)	0.560
MEOX2	CASP14	psi-mi:“MI:0915”(physical association)	0.560
KSR2	POLR3A	psi-mi:“MI:0914”(association)	0.530
FTH1	A2ML1	psi-mi:“MI:0914”(association)	0.530
TBC1D22B	A2ML1	psi-mi:“MI:0914”(association)	0.530
ZSCAN12	A2ML1	psi-mi:“MI:0914”(association)	0.530
NDUFS5	NDUFS4	psi-mi:“MI:0914”(association)	0.530
ZIC1	CTSV	psi-mi:“MI:0914”(association)	0.530
MRPL38	DUSP14	psi-mi:“MI:0914”(association)	0.530
E6	CASK	psi-mi:“MI:0914”(association)	0.520
CFTR	PLEKHG3	psi-mi:“MI:0914”(association)	0.480
DDX21	MED19	psi-mi:“MI:2364”(proximity)	0.480
CASP14	PSAP	psi-mi:“MI:0915”(physical association)	0.470

BioGRID (185): CASP14 (Two-hybrid), CASP14 (Affinity Capture-MS), CASP14 (Affinity Capture-MS), CASP14 (Affinity Capture-MS), CASP14 (Affinity Capture-MS), CASP14 (Affinity Capture-MS), CASP14 (Affinity Capture-MS), CASP14 (Affinity Capture-MS), CASP14 (Affinity Capture-MS), CASP14 (Affinity Capture-MS), CASP14 (Affinity Capture-MS), CASP14 (Affinity Capture-MS), CASP14 (Affinity Capture-MS), CASP14 (Affinity Capture-MS), CASP14 (Affinity Capture-MS)

ESM2 similar proteins: A0A1D5PPP7, F1NV61, O01382, O02002, O08738, O35397, O89094, O89110, P29452, P29594, P31944, P42574, P42575, P43527, P55211, P55212, P55213, P55215, P55865, P55866, P55867, P70343, P70677, P89116, Q08DY9, Q0IIM3, Q14344, Q14790, Q153Z0, Q2PFV2, Q3T0P5, Q504J1, Q5IS54, Q5IS99, Q60431, Q60446, Q61699, Q66HA8, Q8BLR2, Q8C3Q9

Diamond homologs: A0A1D5PPP7, F1NV61, G5EBM1, G5ECW5, O01382, O02002, O08738, O15519, O35397, O89094, O89110, P31944, P42573, P42574, P42575, P45436, P55210, P55211, P55212, P55213, P55214, P55866, P70677, P89116, P97864, Q08DY9, Q14790, Q29IM7, Q2PFV2, Q3T0P5, Q5IS54, Q5IS99, Q5RD56, Q60431, Q8C3Q9, Q8MJC3, Q8MJU1, Q8MKI5, Q92851, Q95ND5

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

90 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	60
Likely benign	7
Benign	20

Top pathogenic / likely-pathogenic (0)

SpliceAI

1110 predictions. Top by Δscore:

Variant	Effect	Δscore
19:15053473:T:TA	acceptor_gain	1.0000
19:15053478:CCA:C	acceptor_loss	1.0000
19:15053479:CA:C	acceptor_loss	1.0000
19:15053480:A:AG	acceptor_gain	1.0000
19:15053480:A:T	acceptor_loss	1.0000
19:15053481:G:GG	acceptor_gain	1.0000
19:15053481:GGA:G	acceptor_gain	1.0000
19:15053481:GGAGA:G	acceptor_gain	1.0000
19:15053628:CGAGG:C	donor_loss	1.0000
19:15053629:GAGG:G	donor_loss	1.0000
19:15053631:GG:G	donor_loss	1.0000
19:15053632:G:C	donor_loss	1.0000
19:15053726:A:AG	acceptor_gain	1.0000
19:15053727:C:G	acceptor_gain	1.0000
19:15053731:A:AG	acceptor_gain	1.0000
19:15053732:G:GC	acceptor_gain	1.0000
19:15053732:GC:G	acceptor_gain	1.0000
19:15053732:GCA:G	acceptor_gain	1.0000
19:15053732:GCAA:G	acceptor_gain	1.0000
19:15053732:GCAAT:G	acceptor_gain	1.0000
19:15053910:GCCC:G	donor_gain	1.0000
19:15053920:C:G	donor_gain	1.0000
19:15053956:G:GT	donor_gain	1.0000
19:15055156:A:AG	acceptor_gain	1.0000
19:15055157:G:GG	acceptor_gain	1.0000
19:15055531:GAG:G	donor_gain	1.0000
19:15055532:AGGT:A	donor_loss	1.0000
19:15055534:G:GG	donor_gain	1.0000
19:15055534:GTGA:G	donor_loss	1.0000
19:15055535:T:A	donor_loss	1.0000

AlphaMissense

1582 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:15053596:T:C	F48L	0.988
19:15053598:C:A	F48L	0.988
19:15053598:C:G	F48L	0.988
19:15053930:G:C	K125N	0.986
19:15053930:G:T	K125N	0.986
19:15053557:G:C	D35H	0.982
19:15053926:C:A	P124H	0.979
19:15055263:C:T	S170F	0.978
19:15055245:A:T	D164V	0.975
19:15053558:A:C	D35A	0.971
19:15053757:T:C	F68L	0.971
19:15053759:C:A	F68L	0.971
19:15053759:C:G	F68L	0.971
19:15053488:T:C	Y12H	0.970
19:15055244:G:C	D164H	0.970
19:15055246:T:A	D164E	0.970
19:15055246:T:G	D164E	0.970
19:15053793:A:C	S80R	0.968
19:15053795:T:A	S80R	0.968
19:15053795:T:G	S80R	0.968
19:15053953:G:C	R133P	0.967
19:15053559:C:A	D35E	0.966
19:15053559:C:G	D35E	0.966
19:15053597:T:C	F48S	0.966
19:15053816:G:A	M87I	0.966
19:15053816:G:C	M87I	0.966
19:15053816:G:T	M87I	0.966
19:15053817:G:C	A88P	0.966
19:15053796:T:C	C81R	0.964
19:15055263:C:A	S170Y	0.964

dbSNP variants (sampled 300 via entrez): RS1000254363 (19:15054240 C>T), RS1000446748 (19:15053050 T>G), RS1000640009 (19:15055366 C>T), RS1000987619 (19:15055600 GCCT>G), RS1001092716 (19:15049316 C>T), RS1001535539 (19:15047516 T>C), RS1001601456 (19:15048424 G>A), RS1001628581 (19:15047633 C>T), RS1001797947 (19:15058453 T>C), RS1001889791 (19:15058739 C>A,G,T), RS1002010212 (19:15052739 G>A), RS1002323691 (19:15049687 TCTCTCTCTCTCACACACACA>T), RS1002550950 (19:15052956 A>C,G), RS1003207131 (19:15050271 C>G,T), RS1003472321 (19:15056993 C>A)

Disease associations

OMIM: gene MIM:605848 | disease phenotypes: MIM:617320

GenCC curated gene-disease

Mondo (1): ichthyosis, congenital, autosomal recessive 12 (MONDO:0015018)

Orphanet (0):

HPO phenotypes

2 total (2 of 2 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0040190	White scaling skin

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST009391_413	Metabolite levels	6.000000e-06

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0010387	phosphatidylcholine 38:5 measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (2): CHEMBL3831289 (PROTEIN FAMILY), CHEMBL5991 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — C14: Caspase

Most potent curated ligand interactions (1 total), top 1:

Ligand	Action	Affinity	Parameter
grassystatin A	Inhibition	5.3	pIC50

ChEMBL bioactivities

6 potent at pChembl≥5 of 8 total, top 6 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.80	EC50	16	nM	CHEMBL1091826
6.87	IC50	134	nM	CHEMBL5715921
5.30	IC50	5000	nM	GRASSYSTATIN A
5.14	IC50	7280	nM	CHEMBL4172307
5.04	IC50	9120	nM	CHEMBL568171
5.00	IC50	1.01e+04	nM	CHEMBL4168948

PubChem BioAssay actives

4 with measured affinity, of 16 total; 4 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
N-(4-methoxyphenyl)-N-methyl-1,2,3-benzotriazin-4-amine	1393168: Activation of caspase cascade in human T47D cells using N-(Ac-DEVD)-N’-ethoxycarbonyl-R110 fluorogenic substrate incubated for 48 hrs by fluorescent plate reader based assay	ec50	0.0160	uM
methyl (2S)-1-[(2R)-2-[[(2S)-2-[[(2S,3R)-2-[[(3S,4S)-4-[[(2S)-4-amino-2-[[(2S)-2-[[(2R)-2-[(2S)-2-[(2S)-2-(dimethylamino)-3-methylbutanoyl]oxy-3-methylbutanoyl]oxy-3-methylbutanoyl]amino]-4-methylpentanoyl]amino]-4-oxobutanoyl]amino]-3-hydroxy-6-methylheptanoyl]amino]-3-hydroxybutanoyl]amino]propanoyl]-methylamino]-3-phenylpropanoyl]pyrrolidine-2-carboxylate	448870: Inhibition of caspase 14 after 10 to 15 mins by fluorescence assay	ic50	5.0000	uM
(4S)-4-[[(2S,3S)-2-amino-3-methylpentanoyl]amino]-5-[[(2S,3R)-1-[(1-carboxy-3-oxopropan-2-yl)amino]-3-hydroxy-1-oxobutan-2-yl]amino]-5-oxopentanoic acid	1350778: Inhibition of human caspase 14 using Ac-WEHD-AMC fluorogenic peptide as substrate by fluorescence assay	ic50	7.2800	uM
4-(cyclopentylamino)-6-(3,5-difluoroanilino)-1,3,5-triazine-2-carbonitrile	444702: Inhibition of human Caspase 14	ic50	9.1201	uM

CTD chemical–gene interactions

39 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
perfluorooctane sulfonic acid	decreases expression	2
Tobacco Smoke Pollution	affects expression, decreases expression	2
VX-agent	increases expression	1
pyrogallol 1,3-dimethyl ether	affects cotreatment, decreases expression	1
diisononyl phthalate	decreases expression, affects cotreatment	1
arsenite	increases expression	1
lead nitrate	affects cotreatment, decreases expression	1
sodium arsenite	affects expression	1
butylbenzyl phthalate	affects cotreatment, decreases expression	1
CGP 52608	increases reaction, affects binding	1
perfluoro-n-nonanoic acid	decreases expression	1
10’(Z),13’(E),15’(E)-heptadecatrienylhydroquinone	increases expression	1
dimethylarsinous acid	decreases expression	1
licochalcone B	decreases expression	1
bisphenol S	increases expression	1
Zoledronic Acid	decreases expression	1
Acetaminophen	decreases expression	1
Air Pollutants	decreases expression, increases abundance	1
Benzo(a)pyrene	affects methylation	1
Cadmium	decreases expression	1
Calcitriol	increases expression	1
Diethylhexyl Phthalate	decreases expression, affects cotreatment	1
Dust	increases expression	1
Estradiol	increases expression	1
Furaldehyde	affects cotreatment, increases expression	1
Lead	affects binding	1
Menthol	increases expression	1
Mercury	affects cotreatment, decreases expression	1
Metformin	affects cotreatment, increases expression	1
N-Nitrosopyrrolidine	increases expression	1

ChEMBL screening assays

14 unique, capped per target: 14 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4199992	Binding	Activation of caspase (unknown origin)	MK-8353: Discovery of an Orally Bioavailable Dual Mechanism ERK Inhibitor for Oncology. — ACS Med Chem Lett

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.