CASS4

Summary

CASS4 (Cas scaffold protein family member 4, HGNC:15878) is a protein-coding gene on chromosome 20q13.31, encoding Cas scaffolding protein family member 4 (Q9NQ75). Docking protein that plays a role in tyrosine kinase-based signaling related to cell adhesion and cell spreading.

Enables protein tyrosine kinase binding activity. Involved in several processes, including positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction; positive regulation of protein tyrosine kinase activity; and positive regulation of substrate adhesion-dependent cell spreading. Located in cytoplasm and focal adhesion.

Source: NCBI Gene 57091 — RefSeq curated summary.

At a glance

• GWAS associations: 12
• Clinical variants (ClinVar): 118 total
• MANE Select transcript: NM_020356

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:15878
Approved symbol	CASS4
Name	Cas scaffold protein family member 4
Location	20q13.31
Locus type	gene with protein product
Status	Approved
Aliases	HEFL, HEPL
Ensembl gene	ENSG00000087589
Ensembl biotype	protein_coding
OMIM	618888
Entrez	57091

Gene structure

Transcript identifiers

Ensembl transcripts: 8 — 7 protein_coding, 1 retained_intron

ENST00000360314, ENST00000434344, ENST00000497244, ENST00000679529, ENST00000679887, ENST00000887185, ENST00000887186, ENST00000956166

RefSeq mRNA: 4 — MANE Select: NM_020356 NM_001164114, NM_001164115, NM_001164116, NM_020356

CCDS: CCDS33492, CCDS54475, CCDS93062

Canonical transcript exons

ENST00000679887 — 6 exons

Exon	Start	End
ENSE00000556996	56451819	56453129
ENSE00003484835	56450599	56450679
ENSE00003662395	56445900	56446001
ENSE00003666477	56437164	56437586
ENSE00003912931	56458340	56460382
ENSE00003914899	56412260	56412494

Expression profiles

Bgee: expression breadth ubiquitous, 164 present calls, max score 83.46.

FANTOM5 (CAGE): breadth broad, TPM avg 3.2652 / max 457.1229, expressed in 444 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
185420	1.9336	282
185419	0.4226	136
185418	0.2994	97
209172	0.2659	84
185417	0.1513	62
185421	0.1178	46
185416	0.0746	16

Top tissues by expression

283 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
upper lobe of left lung	UBERON:0008952	83.46	gold quality
upper lobe of lung	UBERON:0008948	81.79	gold quality
blood	UBERON:0000178	81.29	gold quality
right lung	UBERON:0002167	78.05	gold quality
granulocyte	CL:0000094	77.73	gold quality
vermiform appendix	UBERON:0001154	76.27	gold quality
leukocyte	CL:0000738	74.95	gold quality
monocyte	CL:0000576	74.25	gold quality
mononuclear cell	CL:0000842	74.03	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	73.91	gold quality
buccal mucosa cell	CL:0002336	73.42	gold quality
lung	UBERON:0002048	72.48	gold quality
caecum	UBERON:0001153	70.39	gold quality
gall bladder	UBERON:0002110	70.30	gold quality
spleen	UBERON:0002106	70.14	gold quality
lymph node	UBERON:0000029	69.34	gold quality
smooth muscle tissue	UBERON:0001135	65.75	gold quality
type B pancreatic cell	CL:0000169	64.50	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	63.94	silver quality
descending thoracic aorta	UBERON:0002345	63.79	gold quality
rectum	UBERON:0001052	63.49	gold quality
bone marrow cell	CL:0002092	63.25	silver quality
right ovary	UBERON:0002118	62.99	gold quality
right lobe of liver	UBERON:0001114	62.87	gold quality
right coronary artery	UBERON:0001625	62.21	gold quality
bone marrow	UBERON:0002371	62.20	gold quality
lower esophagus muscularis layer	UBERON:0035833	61.46	gold quality
lower esophagus	UBERON:0013473	61.45	gold quality
omental fat pad	UBERON:0010414	61.27	gold quality
peritoneum	UBERON:0002358	61.21	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	4.05

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

35 targeting CASS4, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-6748-5P	100.00	65.81	1057
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-450A-1-3P	100.00	69.33	1837
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-493-5P	99.96	72.47	2382
HSA-MIR-3119	99.92	71.34	2390
HSA-MIR-4307	99.82	70.45	3374
HSA-MIR-545-5P	99.66	70.18	2308
HSA-MIR-217-5P	99.49	69.93	1419
HSA-MIR-766-3P	99.47	65.24	1811
HSA-MIR-542-3P	99.34	67.58	1270
HSA-MIR-4505	99.27	67.81	2678
HSA-MIR-5787	99.22	67.86	2628
HSA-MIR-449B-3P	99.20	67.24	1047
HSA-MIR-6807-3P	99.15	69.23	1275
HSA-MIR-219A-2-3P	98.62	68.78	797
HSA-MIR-3928-5P	98.50	67.48	980
HSA-MIR-6806-3P	98.50	67.31	980
HSA-MIR-3187-5P	98.36	65.74	1776
HSA-MIR-4436B-3P	98.25	65.26	1494
HSA-MIR-6735-5P	98.24	65.36	1488
HSA-MIR-7843-5P	98.12	65.26	1421
HSA-MIR-6842-3P	98.07	66.33	1325
HSA-MIR-4468	98.01	66.85	1187
HSA-MIR-3977	98.00	68.17	1500
HSA-MIR-4632-5P	97.82	65.38	1470
HSA-MIR-6879-5P	97.77	65.52	1521

Literature-anchored findings (GeneRIF, showing 5)

• HEPL maintains Cas family function in localization to focal adhesions, as well as regulation of FAK activity, focal adhesion integrity, and cell spreading. (PMID:18256281)
• Hepl is overexpressed in the nucleus and aberrantly accumulates in the cytoplasm of non-small cell lung cancer cells, and Hepl may play a role in the progression of lung cancer, including lymph node metastasis and TNM stage. (PMID:23001926)
• EFS and CASS4 protein function in the context of the larger CAS family group. [Review] (PMID:26119091)
• High expression of CASS4 is associated with invasion in non-small cell lung cancer. (PMID:27677288)
• The results of this study showed that Cas scaffolding protein family member 4 with protein tyrosine kinase 2 and their significant role in the activation of downstream signaling pathways in Alzheimer’s disease. (PMID:29789968)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	cass4	ENSDARG00000006775
mus_musculus	Cass4	ENSMUSG00000074570
rattus_norvegicus	Cass4	ENSRNOG00000021560
drosophila_melanogaster	p130CAS	FBGN0035101

Paralogs (3): BCAR1 (ENSG00000050820), EFS (ENSG00000100842), NEDD9 (ENSG00000111859)

Protein

Protein identifiers

Cas scaffolding protein family member 4 — Q9NQ75 (reviewed: Q9NQ75)

Alternative names: HEF-like protein, HEF1-EFS-p130Cas-like protein

All UniProt accessions (2): Q9NQ75, B4DII4

UniProt curated annotations — full annotation on UniProt →

Function. Docking protein that plays a role in tyrosine kinase-based signaling related to cell adhesion and cell spreading. Regulates PTK2/FAK1 activity, focal adhesion integrity, and cell spreading.

Subunit / interactions. Interacts (via SH3 domain) with PTK2/FAK1 (via C-terminus).

Subcellular location. Cytoplasm. Cytoskeleton. Cell junction. Focal adhesion.

Tissue specificity. Expressed abundantly in lung and spleen. Also highly expressed in ovarian and leukemia cell lines.

Post-translational modifications. Phosphorylated on tyrosines by SRC.

Similarity. Belongs to the CAS family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q9NQ75-1	1	yes
Q9NQ75-2	2
Q9NQ75-3	3

RefSeq proteins (4): NP_001157586, NP_001157587, NP_001157588, NP_065089* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001452	SH3_domain	Domain
IPR014928	Serine_rich_dom	Domain
IPR021901	CAS_C	Domain
IPR035744	CASS4_SH3	Domain
IPR036028	SH3-like_dom_sf	Homologous_superfamily
IPR037362	CAS_fam	Family
IPR038319	Serine_rich_sf	Homologous_superfamily

Pfam: PF08824, PF12026, PF14604

UniProt features (31 total): strand 6, modified residue 5, compositionally biased region 5, sequence variant 4, region of interest 3, sequence conflict 3, splice variant 2, chain 1, domain 1, turn 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
2CRE	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9NQ75-F1	58.88	0.23

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (5): 200, 249, 305, 376, 390

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 165 (showing top): GSE45365_NK_CELL_VS_BCELL_UP, GOBP_REGULATION_OF_PROTEIN_TYROSINE_KINASE_ACTIVITY, GOBP_REGULATION_OF_PHOSPHORYLATION, GOBP_REGULATION_OF_TRANSFERASE_ACTIVITY, GOBP_POSITIVE_REGULATION_OF_SUBSTRATE_ADHESION_DEPENDENT_CELL_SPREADING, GOBP_POSITIVE_REGULATION_OF_PEPTIDYL_TYROSINE_PHOSPHORYLATION, GOBP_POSITIVE_REGULATION_OF_CELL_ADHESION, GOBP_POSITIVE_REGULATION_OF_CATALYTIC_ACTIVITY, CEBP_Q2, GOBP_REGULATION_OF_SUBSTRATE_ADHESION_DEPENDENT_CELL_SPREADING, GOBP_POSITIVE_REGULATION_OF_PROTEIN_TYROSINE_KINASE_ACTIVITY, GOBP_POSITIVE_REGULATION_OF_MOLECULAR_FUNCTION, GOBP_POSITIVE_REGULATION_OF_PHOSPHORUS_METABOLIC_PROCESS, GOBP_PHOSPHATIDYLINOSITOL_3_KINASE_PROTEIN_KINASE_B_SIGNAL_TRANSDUCTION, GOBP_SUBSTRATE_ADHESION_DEPENDENT_CELL_SPREADING

GO Biological Process (7): cell adhesion (GO:0007155), cell surface receptor protein tyrosine kinase signaling pathway (GO:0007169), cell migration (GO:0016477), positive regulation of cell migration (GO:0030335), positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction (GO:0051897), positive regulation of protein tyrosine kinase activity (GO:0061098), positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)

GO Molecular Function (2): protein tyrosine kinase binding (GO:1990782), protein binding (GO:0005515)

GO Cellular Component (5): cytoplasm (GO:0005737), cytoskeleton (GO:0005856), focal adhesion (GO:0005925), plasma membrane (GO:0005886), anchoring junction (GO:0070161)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular process	1
enzyme-linked receptor protein signaling pathway	1
cell motility	1
cell migration	1
regulation of cell migration	1
positive regulation of cell motility	1
phosphatidylinositol 3-kinase/protein kinase B signal transduction	1
regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction	1
positive regulation of intracellular signal transduction	1
protein tyrosine kinase activity	1
positive regulation of protein kinase activity	1
positive regulation of peptidyl-tyrosine phosphorylation	1
regulation of protein tyrosine kinase activity	1
positive regulation of cell-substrate adhesion	1
substrate adhesion-dependent cell spreading	1
regulation of substrate adhesion-dependent cell spreading	1
protein kinase binding	1
binding	1
intracellular anatomical structure	1
cellular anatomical structure	1
intracellular membraneless organelle	1
cell-substrate junction	1
membrane	1
cell periphery	1
cell junction	1

Protein interactions and networks

STRING

1771 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CASS4	ZCWPW1	Q9H0M4	800
CASS4	NME8	Q8N427	798
CASS4	FERMT2	Q96AC1	771
CASS4	SORL1	Q92673	740
CASS4	CD2AP	Q9Y5K6	735
CASS4	RIN3	Q8TB24	729
CASS4	ABCA7	Q8IZY2	727
CASS4	PICALM	Q13492	725
CASS4	CELF1	Q92879	723
CASS4	SLC24A4	Q8NFF2	720
CASS4	PTK2B	Q14289	715
CASS4	INPP5D	Q92835	713
CASS4	MS4A6A	Q9H2W1	697
CASS4	BIN1	O00499	680
CASS4	HLA-DRB5	Q30154	672

IntAct

5 interactions, top by confidence:

A	B	Type	Score
CRK	BCR/ABL fusion	psi-mi:“MI:0914”(association)	0.460
CASS4	PKM	psi-mi:“MI:0217”(phosphorylation reaction)	0.440
CASS4	MICAL1	psi-mi:“MI:0915”(physical association)	0.400
ABL2	MPIG6B	psi-mi:“MI:0914”(association)	0.350

BioGRID (10): MICAL1 (Affinity Capture-MS), CDC42EP2 (Two-hybrid), ZYX (Two-hybrid), HSF2BP (Two-hybrid), FHL3 (Two-hybrid), ANKS1B (Two-hybrid), CASS4 (Affinity Capture-MS), MICAL1 (Affinity Capture-MS), CASS4 (Affinity Capture-MS), CASS4 (Affinity Capture-MS)

ESM2 similar proteins: A0A8I3PDQ1, A0M8S4, A0M8T5, A5GFW5, B6RSP1, B9EJA2, D4A039, E9Q0S6, O00750, O35177, Q00PJ1, Q07DV1, Q07DW4, Q07DX4, Q07DY4, Q07E15, Q07E28, Q07E41, Q08EC4, Q09YG9, Q09YI1, Q09YK4, Q09YM8, Q108T9, Q14511, Q155Q3, Q2IBA2, Q2IBB2, Q2IBD4, Q2IBE6, Q2IBF7, Q2QL82, Q2QLA2, Q2QLB3, Q2QLF8, Q2QLG9, Q2VUH7, Q3UIL6, Q5JV73, Q61140

Diamond homologs: A4FU49, A5GFW5, A7A261, O43281, O75791, O89100, P29355, P34109, P38753, P43603, P49710, P62993, P62994, Q07883, Q08012, Q08EC4, Q4P5J4, Q4R729, Q557J6, Q5I1X5, Q5R4J7, Q5TCX8, Q60631, Q64355, Q66II3, Q6FN49, Q6GPJ9, Q6YKA8, Q75DS3, Q7TSG5, Q8WUF5, Q96KQ4, Q9NQ75, A0A8I3PDQ1, A2QW93, D4A2Y9, O35177, O43586, O60504, P10569

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

118 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	89
Likely benign	16
Benign	3

Top pathogenic / likely-pathogenic (0)

SpliceAI

992 predictions. Top by Δscore:

Variant	Effect	Δscore
20:56437161:CAG:C	acceptor_loss	1.0000
20:56437163:G:A	acceptor_loss	1.0000
20:56450678:GT:G	donor_gain	1.0000
20:56458339:GA:G	acceptor_gain	1.0000
20:56458339:GAATC:G	acceptor_gain	1.0000
20:56412495:G:GG	donor_gain	0.9900
20:56412495:GT:G	donor_loss	0.9900
20:56412496:T:G	donor_loss	0.9900
20:56437157:C:G	acceptor_gain	0.9900
20:56437160:ACAG:A	acceptor_gain	0.9900
20:56437162:A:AG	acceptor_gain	0.9900
20:56437162:AG:A	acceptor_gain	0.9900
20:56437163:G:GA	acceptor_gain	0.9900
20:56437163:GG:G	acceptor_gain	0.9900
20:56437163:GGC:G	acceptor_gain	0.9900
20:56437163:GGCA:G	acceptor_gain	0.9900
20:56437163:GGCAC:G	acceptor_gain	0.9900
20:56450680:G:GG	donor_gain	0.9900
20:56452959:G:GT	donor_gain	0.9900
20:56453073:G:T	donor_gain	0.9900
20:56458335:TTTA:T	acceptor_loss	0.9900
20:56458338:A:AG	acceptor_gain	0.9900
20:56458338:AGA:A	acceptor_loss	0.9900
20:56458339:G:GA	acceptor_gain	0.9900
20:56458339:GAA:G	acceptor_gain	0.9900
20:56458339:GAAT:G	acceptor_gain	0.9900
20:56412493:AG:A	donor_gain	0.9800
20:56412494:GG:G	donor_gain	0.9800
20:56437156:A:AG	acceptor_gain	0.9800
20:56437281:TGG:T	donor_gain	0.9800

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000016814 (20:56416727 C>G), RS1000057196 (20:56446883 G>C,T), RS1000132329 (20:56445686 G>A), RS1000150688 (20:56440759 A>G), RS1000199055 (20:56423122 C>A), RS1000245072 (20:56411173 G>A,C), RS1000479126 (20:56442245 G>A,T), RS1000497160 (20:56431435 C>G,T), RS1000508535 (20:56442501 C>T), RS1000557539 (20:56413731 A>G), RS1000591651 (20:56431134 T>G), RS1000634840 (20:56436040 C>T), RS1000738585 (20:56441965 G>A), RS1000772736 (20:56436119 C>T), RS1000840095 (20:56429834 ATTTTTCATAACTTCCTGTAT>A,ATTTTTCATAACTTCCTGTATTTTTTCATAACTTCCTGTAT)

Disease associations

OMIM: gene MIM:618888 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

12 associations (top):

Study	Trait	p-value
GCST002245_3	Alzheimer’s disease (late onset)	3.000000e-08
GCST002685_17	Refractive astigmatism	2.000000e-06
GCST003901_14	Cognitive decline (age-related)	3.000000e-06
GCST004603_283	Platelet count	2.000000e-12
GCST004607_184	Plateletcrit	7.000000e-13
GCST007319_27	Alzheimer’s disease (late onset)	2.000000e-07
GCST007319_4	Alzheimer’s disease (late onset)	9.000000e-08
GCST007320_51	Alzheimer’s disease or family history of Alzheimer’s disease	3.000000e-08
GCST007320_61	Alzheimer’s disease or family history of Alzheimer’s disease	7.000000e-10
GCST007321_5	Family history of Alzheimer’s disease	6.000000e-06
GCST90002400_303	Plateletcrit	3.000000e-22
GCST90002402_595	Platelet count	2.000000e-17

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0004309	platelet count
EFO:0007985	platelet crit
EFO:0009268	family history of Alzheimer’s disease

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

24 total (human), top 24 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, decreases expression	2
Aflatoxin B1	decreases methylation, increases methylation	2
aristolochic acid I	increases expression	1
triphenyl phosphate	affects expression	1
bisphenol A	decreases expression	1
benzo(e)pyrene	increases methylation	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression, affects cotreatment, decreases expression	1
di-n-butylphosphoric acid	affects expression	1
licochalcone B	increases expression	1
jinfukang	affects cotreatment, decreases expression	1
incobotulinumtoxinA	decreases expression	1
theaflavin-3,3’-digallate	affects expression	1
Leflunomide	decreases expression	1
Acetaminophen	decreases expression	1
Cisplatin	affects cotreatment, decreases expression	1
Folic Acid	decreases expression	1
Lipopolysaccharides	decreases expression, affects response to substance, increases expression, affects cotreatment	1
Methapyrilene	increases methylation	1
Silicon Dioxide	decreases expression	1
Tobacco Smoke Pollution	increases expression	1
Tretinoin	increases expression	1
Urethane	decreases expression	1
Valproic Acid	decreases methylation	1
Okadaic Acid	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.