CAV3

Summary

CAV3 (caveolin 3, HGNC:1529) is a protein-coding gene on chromosome 3p25.3, encoding Caveolin-3 (P56539). May act as a scaffolding protein within caveolar membranes.

This gene encodes a caveolin family member, which functions as a component of the caveolae plasma membranes found in most cell types. Caveolin proteins are proposed to be scaffolding proteins for organizing and concentrating certain caveolin-interacting molecules. Mutations identified in this gene lead to interference with protein oligomerization or intra-cellular routing, disrupting caveolae formation and resulting in Limb-Girdle muscular dystrophy type-1C (LGMD-1C), hyperCKemia or rippling muscle disease (RMD). Alternative splicing has been identified for this locus, with inclusion or exclusion of a differentially spliced intron. In addition, transcripts utilize multiple polyA sites and contain two potential translation initiation sites.

Source: NCBI Gene 859 — RefSeq curated summary.

At a glance

• Gene–disease (curated): caveolinopathy (Definitive, ClinGen) — +7 more curated relationships
• GWAS associations: 3
• Clinical variants (ClinVar): 392 total — 21 pathogenic, 8 likely-pathogenic
• Phenotypes (HPO): 69
• MANE Select transcript: NM_033337

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:1529
Approved symbol	CAV3
Name	caveolin 3
Location	3p25.3
Locus type	gene with protein product
Status	Approved
Aliases	VIP-21, LGMD1C, VIP21, LQT9
Ensembl gene	ENSG00000182533
Ensembl biotype	protein_coding
OMIM	601253
Entrez	859

Gene structure

Transcript identifiers

Ensembl transcripts: 3 — 2 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000343849, ENST00000397368, ENST00000472766

RefSeq mRNA: 2 — MANE Select: NM_033337 NM_001234, NM_033337

CCDS: CCDS2569

Canonical transcript exons

ENST00000343849 — 2 exons

Exon	Start	End
ENSE00001321611	8733802	8733990
ENSE00001369661	8745526	8746758

Expression profiles

Bgee: expression breadth ubiquitous, 157 present calls, max score 96.39.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 1.5723 / max 335.6754, expressed in 172 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
35193	1.5723	172

Top tissues by expression

278 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
hindlimb stylopod muscle	UBERON:0004252	96.39	gold quality
vastus lateralis	UBERON:0001379	96.24	gold quality
triceps brachii	UBERON:0001509	96.14	gold quality
quadriceps femoris	UBERON:0001377	95.97	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	95.56	gold quality
biceps brachii	UBERON:0001507	95.51	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	95.27	gold quality
diaphragm	UBERON:0001103	94.86	silver quality
gastrocnemius	UBERON:0001388	94.56	gold quality
skeletal muscle tissue	UBERON:0001134	94.43	gold quality
muscle organ	UBERON:0001630	93.53	gold quality
deltoid	UBERON:0001476	93.17	gold quality
muscle of leg	UBERON:0001383	92.80	gold quality
tibialis anterior	UBERON:0001385	92.78	silver quality
gluteal muscle	UBERON:0002000	92.03	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	91.48	gold quality
apex of heart	UBERON:0002098	90.64	gold quality
muscle tissue	UBERON:0002385	89.37	gold quality
heart left ventricle	UBERON:0002084	88.86	gold quality
cardiac ventricle	UBERON:0002082	88.60	gold quality
heart right ventricle	UBERON:0002080	85.20	gold quality
heart	UBERON:0000948	84.52	gold quality
right atrium auricular region	UBERON:0006631	84.40	gold quality
cardiac atrium	UBERON:0002081	83.73	gold quality
body of tongue	UBERON:0011876	83.19	gold quality
cardiac muscle of right atrium	UBERON:0003379	78.09	gold quality
endometrium epithelium	UBERON:0004811	77.86	gold quality
tongue	UBERON:0001723	76.46	gold quality
paraflocculus	UBERON:0005351	74.37	silver quality
oocyte	CL:0000023	73.65	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	2.28

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): EP300, ID2, MYOG, PPARGC1A, RORA, SP1

miRNA regulators (miRDB)

32 targeting CAV3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-4723-5P	99.97	68.70	2034
HSA-MIR-5698	99.97	68.49	2029
HSA-MIR-7111-5P	99.97	68.48	2062
HSA-MIR-101-3P	99.94	75.03	2230
HSA-MIR-144-3P	99.94	73.98	2698
HSA-MIR-22-3P	99.93	68.13	917
HSA-MIR-6715A-3P	99.83	68.05	1473
HSA-MIR-6752-3P	99.72	66.71	1587
HSA-MIR-3059-5P	99.70	69.93	2491
HSA-MIR-587	99.64	70.86	2611
HSA-MIR-2113	99.58	71.22	1521
HSA-MIR-217-5P	99.49	69.93	1419
HSA-MIR-6081	99.48	66.07	1446
HSA-MIR-582-5P	99.47	70.79	2635
HSA-MIR-4311	99.31	70.47	3041
HSA-MIR-6807-3P	99.15	69.23	1275
HSA-MIR-4742-5P	98.89	68.41	1542
HSA-MIR-210-5P	98.57	64.37	832
HSA-MIR-4662A-5P	98.48	67.18	1007
HSA-MIR-4691-5P	98.41	66.77	1343
HSA-MIR-6792-3P	98.41	66.86	1359
HSA-MIR-6882-3P	98.23	67.01	1119
HSA-MIR-146B-3P	97.83	65.29	782
HSA-MIR-22-5P	97.67	68.92	1355
HSA-MIR-3127-5P	97.52	65.24	786
HSA-MIR-6781-3P	97.44	66.85	970
HSA-MIR-4671-5P	97.10	65.70	93
HSA-MIR-2682-3P	97.10	66.16	840
HSA-MIR-3194-5P	96.80	64.90	1027

Literature-anchored findings (GeneRIF, showing 40)

• A heterozygous 80 G–>A substitution in the caveolin-3 gene is associated with sporadic distal myopathy (PMID:11805270)
• A naturally occurring caveolin-3 mutation can inhibit signaling involving cholesterol-sensitive raft domains. (PMID:11884389)
• P28L mutation in the CAV-3 gene and the consequent caveolin-3 deficiency is associated with elevated serum kreatine kinase levels. (PMID:12082049)
• Effects of deleting a tripeptide sequence observed in muscular dystrophy patients on the conformation of peptides corresponding to the scaffolding domain of caveolin-3. (PMID:12387816)
• caveolin-3 may play a role in lamellar granule assembly, trafficking, and/or function. (PMID:12648214)
• severe form of rippling muscle disease associated with homozygous CAV3 mutations. (PMID:12666119)
• A haploinsufficiency model is proposed in which reduced levels of wild-type caveolin-3, although not rendered dysfunctional due to the caveolin-3 R26Q mutant protein, are insufficient for normal muscle cell function. (PMID:12839838)
• Adenovirus-mediated overexpression of human caveolin-3 inhibits hypertrophic responses in rat cardiomyocytes. (PMID:12847114)
• An R27Q missense mutation in the CAV3 gene can lead to various clinical phenotypes including hyper-CK-emia, rippling muscle disease, distal myopathy, and limb-girdle musclar dystrophy 1C. (PMID:12939441)
• CD36 colocalizes with caveolin-3, suggesting that caveolae may regulate cellular fatty acid uptake by CD36. CD36 expression is higher in type 1 compared with type 2 fibers, whereas caveolin-3 expression is significantly higher in type 2 than in type 1 (PMID:14729862)
• the importance of dysferlin-caveolin 3 relationship for skeletal muscle integrity (PMID:14749532)
• Review. Caveolin-3 mutations can result in four distinct, sometimes overlapping, muscle disease phenotypes: limb girdle muscular dystrophy, rippling muscle disease, distal myopathy, and hyperCKemia. (PMID:14981167)
• A muscle biopsy showed a partial reduction of caveolin-3 at the sarcolemma of muscle fibres.Mutational analysis identified a novel heterozygous mutation and generating a Val–>Met change at codon 57 of the amino acid chain. (PMID:15099591)
• demonstrate that Cav-3 is specifically expressed in human cardiac and skeletal myocytes, with high specificity and relatively high sensitivity (88%) for tumors with skeletal muscle differentiation (PMID:16082247)
• The authors describe a family with autosomal dominant rippling muscle disease (RMD) and prominent early-onset toe walking. Molecular analysis revealed a novel heterozygous G > A transition at nucleotide position 136 in exon 2 of the caveolin-3 gene. (PMID:16247063)
• The co-localization of Cav-3 with COX-2 in the caveolae suggests that the caveolins might play an important role for regulating the function of COX-2. (PMID:16479074)
• CAV3 identified and immunolocalized in the caveola-vesicle complexes (CVC )present in erythrocytes infected with P. vivax (PMID:16521037)
• Our findings suggest that caveolin exhibits growth inhibition in a Ca2+-dependent manner, most likely through PKC, in cardiac myoblasts. (PMID:16563233)
• Our findings contribute to the clarification of unexplained persistent hyper-CK-emia, but further research is needed before CAV3 gene mutation analysis becomes part of the routine evaluation of these patients. (PMID:16770780)
• caveolin-3 normally suppresses the myostatin-mediated signal (PMID:17039257)
• Reports of first CAV3 mutations in subjects with long-QT syndrome and functional data demonstrating gain-of-function increase in late sodium current. (PMID:17060380)
• We demonstrated that 9.5% of cases diagnosed as SIDS carry functionally significant genetic variants in LQTS genes (KCNQ1, KCNH2, SCN5A, KCNE1, KCNE2, KCNJ2, CAV3). (PMID:17210839)
• the first molecular and functional evidence implicating CAV3 as a pathogenic basis of Sudden infant death syndrome (PMID:17275750)
• Cav-3 mediates defective gallbladder contraction in the presence of cholesterol stones. Increased expression of Cav-3 results in the sequestration of CCK-1 receptors in the caveolae, probably by inhibiting the functions of Galpha(i3) proteins. (PMID:17307729)
• Molecular analysis revealed a novel heterozygous A>C transition at nucleotide position 140 in exon 2 of the caveolin-3 gene in 17-year-old patient with rippling muscle disease. (PMID:17405141)
• We encountered a Korean male patient with RMD who had suffered from muscle stiffness for 3 years. Mutation analysis of the CAV3 gene revealed the patient to be heterozygous for a novel in-frame deletion mutation. (PMID:17524427)
• This study describe a 39-year-old Japanese man with rippling muscle disease who carried a novel homozygous mutation (Trp70 to a stop codon) in the caveolin-3 gene. (PMID:17537631)
• The presence of different caveolin isoforms in many cell types of the human retina, is reported. (PMID:17615539)
• Caveolin 3 missense mutations lead to different phenotypes in vivo and in vitro. (PMID:18253147)
• Here, we report the clinical, morphological and molecular analysis of a patient with autosomal-recessive RMD carrying two novel compound heterozygous CAV3 mutations that lead to a severe protein truncation. (PMID:18487559)
• Expression of the muscular dystrophy-associated caveolin-3(P104L) mutant in adult mouse skeletal muscle specifically alters the Ca(2+) channel function of the dihydropyridine receptor. (PMID:18509671)
• Two novel missense mutation in the CAV3 gene in Neuromuscul Disord. (PMID:18583131)
• Mutation analysis revealed a novel heterozygous missense mutation in the caveolin-3 gene (c.79C > G; p.Arg27Gly) in both the index patient diagnosed with rippling muscle disease and his mother fasely diagnosed with acid maltase deficiency. (PMID:18671188)
• Genetic studies revealed a G –> A transition at nucleotide position 80 in exon 1 of the Cav-3 gene (c.80G>A), generating a Arg –> Gln change at codon 27 (p.R27Q) of the amino acid chain in heterozygous state in this case. (PMID:18930476)
• Confocal immunofluorescence microscopy shows that caveolin-3 is present throughout the t-tubule system in skeletal muscle fibers, with ‘hot-spots’ at the necks of the tubules in the sub-sarcolemmal space. (PMID:19101541)
• Cav-3 levels were unchanged from the resting levels after both exercise trials in deltoid (PMID:19219452)
• HCN4 associates with Cav3 to form a HCN4 macromolecular complex. Our results also indicated that disruption of caveolae using P104L alters HCN4 function and could cause a reduction of cardiac pacemaker activity. (PMID:19238754)
• Molecular complex formed by MG53, dysferlin, and Cav3 is essential for repair of muscle membrane damage in muscular dystrophy. (PMID:19380584)
• caveolin-3 negatively regulates Kir6.2/SUR2A channel function. (PMID:19481058)
• Caveolin-3 (Cav3) is a new Cx43-interacting protein. (PMID:19544087)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	cav3	ENSDARG00000024141
mus_musculus	Cav3	ENSMUSG00000062694
rattus_norvegicus	Cav3	ENSRNOG00000005798
caenorhabditis_elegans		WBGENE00000301
caenorhabditis_elegans		WBGENE00000302

Paralogs (2): CAV2 (ENSG00000105971), CAV1 (ENSG00000105974)

Protein

Protein identifiers

Caveolin-3 — P56539 (reviewed: P56539)

Alternative names: M-caveolin

All UniProt accessions (1): P56539

UniProt curated annotations — full annotation on UniProt →

Function. May act as a scaffolding protein within caveolar membranes. Interacts directly with G-protein alpha subunits and can functionally regulate their activity. May also regulate voltage-gated potassium channels. Plays a role in the sarcolemma repair mechanism of both skeletal muscle and cardiomyocytes that permits rapid resealing of membranes disrupted by mechanical stress. Mediates the recruitment of CAVIN2 and CAVIN3 proteins to the caveolae.

Subunit / interactions. Homooligomer. Interacts with DLG1 and KCNA5; forms a ternary complex. Interacts with TRIM72. Interacts with MUSK; may regulate MUSK signaling. Interacts with DAG1 (via its C-terminal); the interaction prevents binding of DAG1 with DMD. Interacts with DYSF. Interacts with POPDC1. Interacts with CAVIN1 and CAVIN2. Interacts with CAVIN4.

Subcellular location. Golgi apparatus membrane. Cell membrane. Membrane. Caveola. Sarcolemma.

Tissue specificity. Expressed predominantly in muscle.

Post-translational modifications. Sumoylation with SUMO3 by PIAS4 may reduce agonist-induced internalization and desensitization of adrenergic receptor ABRD2.

Disease relevance. HyperCKmia (HYPCK) [MIM:123320] Characterized by persistent elevated levels of serum creatine kinase without muscle weakness. The disease is caused by variants affecting the gene represented in this entry. Rippling muscle disease 2 (RMD2) [MIM:606072] A disorder characterized by mechanically triggered contractions of skeletal muscle. Mechanical stimulation leads to electrically silent muscle contractions that spread to neighboring fibers and cause visible ripples to move over the muscle. RMD2 inheritance is autosomal dominant or autosomal recessive. The disease is caused by variants affecting the gene represented in this entry. Cardiomyopathy, familial hypertrophic (CMH) [MIM:192600] A hereditary heart disorder characterized by ventricular hypertrophy, which is usually asymmetric and often involves the interventricular septum. The symptoms include dyspnea, syncope, collapse, palpitations, and chest pain. They can be readily provoked by exercise. The disorder has inter- and intrafamilial variability ranging from benign to malignant forms with high risk of cardiac failure and sudden cardiac death. The disease is caused by variants affecting the gene represented in this entry. Long QT syndrome 9 (LQT9) [MIM:611818] A heart disorder characterized by a prolonged QT interval on the ECG and polymorphic ventricular arrhythmias. They cause syncope and sudden death in response to exercise or emotional stress, and can present with a sentinel event of sudden cardiac death in infancy. The disease is caused by variants affecting the gene represented in this entry. Sudden infant death syndrome (SIDS) [MIM:272120] SIDS is the sudden death of an infant younger than 1 year that remains unexplained after a thorough case investigation, including performance of a complete autopsy, examination of the death scene, and review of clinical history. Pathophysiologic mechanisms for SIDS may include respiratory dysfunction, cardiac dysrhythmias, cardiorespiratory instability, and inborn errors of metabolism, but definitive pathogenic mechanisms precipitating an infant sudden death remain elusive. Disease susceptibility is associated with variants affecting the gene represented in this entry. Myopathy, distal, Tateyama type (MPDT) [MIM:614321] A disorder characterized by progressive muscular atrophy and muscle weakness beginning in the hands, the legs, or the feet. Muscle atrophy may be restricted to the small muscles of the hands and feet. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the caveolin family.

RefSeq proteins (2): NP_001225, NP_203123* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001612	Caveolin	Family
IPR018361	Caveolin_CS	Conserved_site

Pfam: PF01146

UniProt features (32 total): sequence variant 26, topological domain 2, chain 1, intramembrane region 1, region of interest 1, cross-link 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P56539-F1	88.54	0.55

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 38

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-445355	Smooth Muscle Contraction
R-HSA-397014	Muscle contraction

MSigDB gene sets: 538 (showing top): GOBP_CARDIAC_CHAMBER_DEVELOPMENT, GOBP_POTASSIUM_ION_TRANSPORT, GOBP_MORPHOGENESIS_OF_AN_EPITHELIUM, GOBP_POSITIVE_REGULATION_OF_MYOTUBE_DIFFERENTIATION, GOBP_MEMBRANE_DEPOLARIZATION, GOBP_NEGATIVE_REGULATION_OF_TRANSMEMBRANE_TRANSPORT, GOBP_REGULATION_OF_CELLULAR_RESPONSE_TO_GROWTH_FACTOR_STIMULUS, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_NEGATIVE_REGULATION_OF_CELL_DEVELOPMENT, GOBP_MAMMARY_GLAND_MORPHOGENESIS, GOBP_REGULATION_OF_PROTEIN_POLYMERIZATION, GOBP_CYTOPLASMIC_MICROTUBULE_ORGANIZATION, GOBP_MUSCLE_TISSUE_DEVELOPMENT, GOBP_GLAND_MORPHOGENESIS, GOBP_POSITIVE_REGULATION_OF_ENDOCYTOSIS

GO Biological Process (63): MAPK cascade (GO:0000165), response to hypoxia (GO:0001666), plasma membrane repair (GO:0001778), regulation of heart rate (GO:0002027), response to ischemia (GO:0002931), cardiac muscle hypertrophy (GO:0003300), triglyceride metabolic process (GO:0006641), calcium ion transport (GO:0006816), endocytosis (GO:0006897), plasma membrane organization (GO:0007009), actin filament organization (GO:0007015), positive regulation of cytosolic calcium ion concentration (GO:0007204), muscle organ development (GO:0007517), myoblast fusion (GO:0007520), regulation of heart contraction (GO:0008016), intracellular protein localization (GO:0008104), positive regulation of cell population proliferation (GO:0008284), negative regulation of cardiac muscle hypertrophy (GO:0010614), positive regulation of myotube differentiation (GO:0010831), regulation of skeletal muscle contraction (GO:0014819), regulation of transforming growth factor beta receptor signaling pathway (GO:0017015), cell differentiation (GO:0030154), positive regulation of microtubule polymerization (GO:0031116), cytoplasmic microtubule organization (GO:0031122), membrane raft organization (GO:0031579), T-tubule organization (GO:0033292), detection of muscle stretch (GO:0035995), regulation of signal transduction by receptor internalization (GO:0038009), regulation of membrane potential (GO:0042391), glucose homeostasis (GO:0042593), cholesterol homeostasis (GO:0042632), negative regulation of MAPK cascade (GO:0043409), negative regulation of cell size (GO:0045792), regulation of nerve growth factor receptor activity (GO:0051394), regulation of cytosolic calcium ion concentration (GO:0051480), nucleus localization (GO:0051647), establishment of localization in cell (GO:0051649), regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction (GO:0051896), negative regulation of calcium ion transport (GO:0051926), cardiac muscle cell development (GO:0055013)

GO Molecular Function (11): calcium channel regulator activity (GO:0005246), sodium channel regulator activity (GO:0017080), potassium channel inhibitor activity (GO:0019870), alpha-tubulin binding (GO:0043014), transmembrane transporter binding (GO:0044325), protein-containing complex binding (GO:0044877), nitric-oxide synthase binding (GO:0050998), molecular adaptor activity (GO:0060090), connexin binding (GO:0071253), protein binding (GO:0005515), enzyme binding (GO:0019899)

GO Cellular Component (17): Golgi membrane (GO:0000139), endoplasmic reticulum (GO:0005783), plasma membrane (GO:0005886), caveola (GO:0005901), cell surface (GO:0009986), intercalated disc (GO:0014704), dystrophin-associated glycoprotein complex (GO:0016010), Z disc (GO:0030018), T-tubule (GO:0030315), neuromuscular junction (GO:0031594), vesicle (GO:0031982), sarcolemma (GO:0042383), membrane raft (GO:0045121), Golgi apparatus (GO:0005794), focal adhesion (GO:0005925), membrane (GO:0016020), protein-containing complex (GO:0032991)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Muscle contraction	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
protein binding	3
binding	3
response to stress	2
regulation of biological quality	2
myotube differentiation	2
ion channel regulator activity	2
cytoplasm	2
endomembrane system	2
intracellular membrane-bounded organelle	2
intracellular signaling cassette	1
response to decreased oxygen levels	1
plasma membrane organization	1
wound healing	1
regulation of heart contraction	1
striated muscle hypertrophy	1
acylglycerol metabolic process	1
metal ion transport	1
vesicle budding from membrane	1
membrane invagination	1
vesicle-mediated transport	1
import into cell	1
endomembrane system organization	1
membrane organization	1
actin cytoskeleton organization	1
supramolecular fiber organization	1
animal organ development	1
muscle structure development	1
syncytium formation by cell-cell fusion	1
heart contraction	1
regulation of blood circulation	1
macromolecule localization	1
cell population proliferation	1
regulation of cell population proliferation	1
positive regulation of cellular process	1
cardiac muscle hypertrophy	1
regulation of cardiac muscle hypertrophy	1
negative regulation of muscle hypertrophy	1
regulation of myotube differentiation	1
positive regulation of striated muscle cell differentiation	1

Protein interactions and networks

STRING

2247 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CAV3	DYSF	O75923	998
CAV3	SNTA1	Q13424	964
CAV3	TRIM72	Q6ZMU5	955
CAV3	CAVIN1	Q6NZI2	955
CAV3	CAV1	Q03135	929
CAV3	DAG1	Q14118	925
CAV3	CACNA1C	Q13936	921
CAV3	KCNC1	P48547	907
CAV3	CACNA1S	Q13698	907
CAV3	DMD	P11532	901
CAV3	CAV2	P51636	899
CAV3	SCN5A	Q14524	897
CAV3	DLG1	Q12959	882
CAV3	CACNA1H	O95180	876
CAV3	STX1A	Q16623	869

IntAct

22 interactions, top by confidence:

A	B	Type	Score
CAVIN1	CAV3	psi-mi:“MI:0915”(physical association)	0.670
GOLM1	EGFR	psi-mi:“MI:0914”(association)	0.640
CAV3	PBX3	psi-mi:“MI:0915”(physical association)	0.560
CAV3	RBFA	psi-mi:“MI:0915”(physical association)	0.560
CAV3	COL25A1	psi-mi:“MI:0915”(physical association)	0.560
M	CAV3	psi-mi:“MI:0915”(physical association)	0.520
CAV3	ADRB2	psi-mi:“MI:0915”(physical association)	0.370
CAV3	PCBP1	psi-mi:“MI:0915”(physical association)	0.370
PTGES3	CAV3	psi-mi:“MI:0915”(physical association)	0.370
GOLM1	RAB19	psi-mi:“MI:0914”(association)	0.350
CAV3	SHTN1	psi-mi:“MI:0914”(association)	0.350
CAV3	CAVIN3	psi-mi:“MI:0403”(colocalization)	0.270
RBFA	CAV3	psi-mi:“MI:0915”(physical association)	0.000
PBX3	CAV3	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (100): CAV3 (Biochemical Activity), ANKRD13C (Affinity Capture-MS), ENDOD1 (Affinity Capture-MS), SARM1 (Affinity Capture-MS), CEP95 (Affinity Capture-MS), CENPT (Affinity Capture-MS), MIS18BP1 (Affinity Capture-MS), MCM10 (Affinity Capture-MS), CAV1 (Affinity Capture-MS), GTSE1 (Affinity Capture-MS), REEP1 (Affinity Capture-MS), AP1S2 (Affinity Capture-MS), REEP4 (Affinity Capture-MS), TBC1D2B (Affinity Capture-MS), SBDS (Affinity Capture-MS)

ESM2 similar proteins: A0M8R6, A0M8S6, A0M8S7, A1X149, P33724, P35431, P41350, P49817, P51637, P51638, P56539, P79132, Q00PJ9, Q03135, Q07DV9, Q07DX1, Q07DY2, Q07DZ2, Q07E02, Q07E25, Q07E26, Q07E38, Q07E39, Q07E49, Q09YH8, Q09YJ1, Q09YK1, Q09YK2, Q09YN6, Q108U7, Q2IBA5, Q2IBC1, Q2IBD7, Q2IBF0, Q2IBF3, Q2IBG8, Q2KI43, Q2QL79, Q2QL90, Q2QLB0

Diamond homologs: A0M8R5, A0M8R6, A0M8S6, A0M8S7, A1X148, A1X149, O46550, P33724, P35431, P41350, P49817, P51636, P51637, P51638, P56539, P79132, Q00PJ9, Q00PK0, Q03135, Q07DV9, Q07DW0, Q07DX1, Q07DX2, Q07DY2, Q07DZ2, Q07DZ3, Q07E02, Q07E25, Q07E26, Q07E38, Q07E39, Q07E49, Q07E50, Q09YH8, Q09YH9, Q09YJ1, Q09YK1, Q09YK2, Q09YL4, Q09YN6

SIGNOR signaling

4 interactions.

A	Effect	B	Mechanism
CAV3	“form complex”	DGC	binding
RORA	“up-regulates quantity by expression”	CAV3	“transcriptional regulation”
EP300	“up-regulates quantity by expression”	CAV3	“transcriptional regulation”
PPARGC1A	“up-regulates quantity by expression”	CAV3	“transcriptional regulation”

Disease & clinical

Clinical variants and AI predictions

ClinVar

392 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	21
Likely pathogenic	8
Uncertain significance	156
Likely benign	89
Benign	40

Top pathogenic / likely-pathogenic (29)

Variant ID	HGVS	Classification
151834	GRCh38/hg38 3p25.3(chr3:8320124-9395968)x1	Pathogenic
2423657	NC_000003.11:g.(?6903076)(9517775_?)del	Pathogenic
2501275	NC_000003.11:g.(?8775485)(8788452_?)del	Pathogenic
2752803	NM_033337.3(CAV3):c.196_197insTT (p.Thr66fs)	Pathogenic
2860549	NM_033337.3(CAV3):c.263G>A (p.Trp88Ter)	Pathogenic
31722	NM_033337.3(CAV3):c.79C>G (p.Arg27Gly)	Pathogenic
31740	NM_033337.3(CAV3):c.114+2T>C	Pathogenic
3246841	NC_000003.11:g.(?8775563)(8787553_?)del	Pathogenic
3246842	NC_000003.11:g.(?8772238)(8775689_?)del	Pathogenic
3729445	NM_033337.3(CAV3):c.256del (p.Leu86fs)	Pathogenic
457133	NM_033337.3(CAV3):c.99C>A (p.Asn33Lys)	Pathogenic
57736	GRCh38/hg38 3p26.3-25.3(chr3:63843-9507969)x1	Pathogenic
662861	NC_000003.12:g.(?8733867)(8745877_?)del	Pathogenic
8276	NM_033337.3(CAV3):c.314C>T (p.Pro105Leu)	Pathogenic
8277	NM_033337.3(CAV3):c.189_197del (p.Thr64_Thr66del)	Pathogenic
8280	NM_033337.3(CAV3):c.84C>A (p.Asp28Glu)	Pathogenic
8283	NM_033337.3(CAV3):c.80G>A (p.Arg27Gln)	Pathogenic
8289	NM_033337.3(CAV3):c.99C>G (p.Asn33Lys)	Pathogenic
8291	NM_033337.3(CAV3):c.423C>G (p.Ser141Arg)	Pathogenic
8295	NM_033337.3(CAV3):c.40G>C (p.Val14Leu)	Pathogenic
846689	NM_033337.3(CAV3):c.79C>T (p.Arg27Ter)	Pathogenic
1180807	NM_033337.3(CAV3):c.154_155dup (p.Ser53fs)	Likely pathogenic
180797	NM_033337.3(CAV3):c.251T>C (p.Leu84Pro)	Likely pathogenic
207882	NM_033337.3(CAV3):c.37A>T (p.Ile13Phe)	Likely pathogenic
3065550	NM_033337.3(CAV3):c.128A>G (p.Asp43Gly)	Likely pathogenic
31729	NM_033337.3(CAV3):c.183C>A (p.Ser61Arg)	Likely pathogenic
8282	NM_033337.3(CAV3):c.137C>T (p.Ala46Val)	Likely pathogenic
973213	NM_033337.3(CAV3):c.299T>A (p.Ile100Asn)	Likely pathogenic
995331	NM_033337.3(CAV3):c.84C>G (p.Asp28Glu)	Likely pathogenic

SpliceAI

944 predictions. Top by Δscore:

Variant	Effect	Δscore
3:8733989:AGG:A	donor_loss	1.0000
3:8733991:GTA:G	donor_loss	1.0000
3:8753220:CGAGG:C	acceptor_gain	1.0000
3:8753222:AGG:A	acceptor_gain	1.0000
3:8753225:C:CC	acceptor_gain	1.0000
3:8753233:G:C	acceptor_gain	1.0000
3:8753233:G:GC	acceptor_gain	1.0000
3:8753240:C:CT	acceptor_gain	1.0000
3:8753241:A:T	acceptor_gain	1.0000
3:8767268:T:TA	donor_gain	1.0000
3:8769378:A:AC	donor_gain	1.0000
3:8769379:C:CC	donor_gain	1.0000
3:8733991:G:GG	donor_gain	0.9900
3:8745520:CTGCA:C	acceptor_loss	0.9900
3:8745521:TGCA:T	acceptor_loss	0.9900
3:8745522:GCAG:G	acceptor_loss	0.9900
3:8745523:CAG:C	acceptor_loss	0.9900
3:8745524:AGGT:A	acceptor_gain	0.9900
3:8745525:GGTG:G	acceptor_gain	0.9900
3:8753222:AGGCT:A	acceptor_loss	0.9900
3:8753223:GG:G	acceptor_gain	0.9900
3:8753225:CT:C	acceptor_loss	0.9900
3:8769218:AGCAC:A	donor_gain	0.9900
3:8769266:C:CA	donor_gain	0.9900
3:8769267:C:A	donor_gain	0.9900
3:8769365:G:C	donor_gain	0.9900
3:8733988:AAGGT:A	donor_gain	0.9800
3:8733989:AGGTA:A	donor_gain	0.9800
3:8733990:GGTAG:G	donor_gain	0.9800
3:8733991:GTAGG:G	donor_gain	0.9800

AlphaMissense

997 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
3:8745592:A:C	S61R	0.999
3:8745594:C:A	S61R	0.999
3:8745594:C:G	S61R	0.999
3:8745604:T:C	F65L	0.999
3:8745606:C:A	F65L	0.999
3:8745606:C:G	F65L	0.999
3:8745532:T:C	F41L	0.998
3:8745534:T:A	F41L	0.998
3:8745534:T:G	F41L	0.998
3:8745568:A:C	S53R	0.998
3:8745570:C:A	S53R	0.998
3:8745570:C:G	S53R	0.998
3:8745583:T:A	W58R	0.997
3:8745583:T:C	W58R	0.997
3:8745585:G:C	W58C	0.997
3:8745585:G:T	W58C	0.997
3:8745676:G:C	G89R	0.997
3:8745677:G:A	G89D	0.997
3:8745725:C:A	P105Q	0.997
3:8745712:T:A	W101R	0.996
3:8745712:T:C	W101R	0.996
3:8733955:C:G	R27G	0.995
3:8745533:T:C	F41S	0.995
3:8745533:T:G	F41C	0.995
3:8745552:G:C	E47D	0.995
3:8745552:G:T	E47D	0.995
3:8745625:T:C	C72R	0.995
3:8745652:G:C	G81R	0.995
3:8745653:G:A	G81D	0.995
3:8733956:G:C	R27P	0.994

dbSNP variants (sampled 300 via entrez): RS1000111300 (3:8741524 G>A,C), RS1000220271 (3:8746762 T>A,C), RS1000351981 (3:8744012 A>C,G), RS1000454283 (3:8744407 T>C), RS1000669024 (3:8746621 T>C), RS1000689596 (3:8745260 G>A), RS1000741887 (3:8735906 C>T), RS1001253696 (3:8732353 G>A), RS1001361708 (3:8737348 C>T), RS1001523605 (3:8738804 CAATGGATCACAGCACTGCTCCATGACT>C), RS1001563491 (3:8742119 G>A), RS1001617257 (3:8741856 G>A,C,T), RS1001641173 (3:8732108 A>C), RS1001693057 (3:8732010 C>T), RS1001797509 (3:8736501 C>T)

Disease associations

OMIM: gene MIM:601253 | disease phenotypes: MIM:192600, MIM:611818, MIM:614321, MIM:606072, MIM:192500, MIM:160565

GenCC curated gene-disease

Disease	Classification	Inheritance
autosomal dominant limb-girdle muscular dystrophy type 1C	Strong	Autosomal recessive
rippling muscle disease 2	Moderate	Autosomal dominant
long QT syndrome 9	Moderate	Autosomal dominant
distal myopathy, Tateyama type	Supportive	Autosomal dominant
inherited rippling muscle disease	Supportive	Autosomal dominant
Brugada syndrome	Limited	Autosomal dominant

ClinGen Gene-Disease Validity (2)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
long QT syndrome	Limited	AD
caveolinopathy	Definitive	AD

Mondo (14): long QT syndrome (MONDO:0002442), hypertrophic cardiomyopathy 1 (MONDO:0008647), long QT syndrome 9 (MONDO:0012736), distal myopathy, Tateyama type (MONDO:0013686), rippling muscle disease 2 (MONDO:0019947), caveolinopathy (MONDO:0016146), cardiomyopathy (MONDO:0004994), long QT syndrome 1 (MONDO:0100316), limb-girdle muscular dystrophy (MONDO:0016971), tubular aggregate myopathy (MONDO:0008051), hypertrophic cardiomyopathy (MONDO:0005045), Brugada syndrome (MONDO:0015263), (MONDO:0011910), inherited rippling muscle disease (MONDO:0020704)

Orphanet (10): Romano-Ward syndrome (Orphanet:101016), Autosomal dominant limb-girdle muscular dystrophy type 1C (Orphanet:265), Distal myopathy, Tateyama type (Orphanet:488650), Congenital long QT syndrome (Orphanet:768), Qualitative or quantitative defects of caveolin-3 (Orphanet:207078), Rare cardiomyopathy (Orphanet:167848), Limb-girdle muscular dystrophy (Orphanet:263), Tubular aggregate myopathy (Orphanet:2593), Rare hypertrophic cardiomyopathy (Orphanet:217569), Rippling muscle disease (Orphanet:97238)

HPO phenotypes

69 total (30 of 69 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000365	Hearing impairment
HP:0000467	Neck muscle weakness
HP:0001197	Abnormality of prenatal development or birth
HP:0001250	Seizure
HP:0001279	Syncope
HP:0001284	Areflexia
HP:0001635	Congestive heart failure
HP:0001645	Sudden cardiac death
HP:0001657	Prolonged QT interval
HP:0001664	Torsade de pointes
HP:0001670	Asymmetric septal hypertrophy
HP:0001682	Subvalvular aortic stenosis
HP:0001688	Sinus bradycardia
HP:0001695	Cardiac arrest
HP:0001699	Sudden death
HP:0001761	Pes cavus
HP:0001962	Palpitations
HP:0002312	Clumsiness
HP:0002900	Hypokalemia
HP:0002936	Distal sensory impairment
HP:0003124	Hypercholesterolemia
HP:0003198	Myopathy
HP:0003236	Elevated circulating creatine kinase concentration
HP:0003326	Myalgia
HP:0003391	Gowers sign
HP:0003394	Muscle spasm
HP:0003457	EMG abnormality
HP:0003458	EMG: myopathic abnormalities
HP:0003557	Increased variability in muscle fiber diameter

GWAS associations

3 associations (top):

Study	Trait	p-value
GCST004970_3	Caudate activity during reward	3.000000e-07
GCST011937_3	Takayasu arteritis	6.000000e-06
GCST011939_6	Takayasu arteritis	6.000000e-06

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0008387	caudate nucleus measurement
EFO:0008396	response to reward

MeSH disease descriptors (7)

Descriptor	Name	Tree numbers
D053840	Brugada Syndrome	C14.280.067.322; C14.280.123.250; C16.320.100
D009202	Cardiomyopathies	C14.280.238
D002312	Cardiomyopathy, Hypertrophic	C14.280.238.100; C14.280.484.048.750.070.160
D008133	Long QT Syndrome	C14.280.067.565; C14.280.123.625; C16.131.240.400.715; C23.550.073.547
D049288	Muscular Dystrophies, Limb-Girdle	C05.651.534.500.280; C10.668.491.175.500.149; C16.320.577.280
C567515	Long Qt Syndrome 9 (supp.)
C563362	Muscular Dystrophy, Limb-Girdle, Type 1C (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

20 total (human), top 20 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
CGP 52608	affects binding, increases reaction	1
incobotulinumtoxinA	decreases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Sunitinib	decreases expression	1
Amiodarone	increases expression	1
Calcium	affects reaction, increases uptake	1
Cholesterol	affects import	1
Diethylhexyl Phthalate	increases expression	1
Estradiol	decreases expression	1
Phenylephrine	increases phosphorylation, decreases response to substance, decreases reaction, increases expression	1
Plant Extracts	affects cotreatment, decreases expression	1
Potassium Chloride	affects reaction, increases uptake	1
Progesterone	decreases expression, decreases reaction, increases expression	1
Silicon Dioxide	increases expression	1
Tetrachlorodibenzodioxin	affects expression	1
Valproic Acid	increases methylation	1
Aflatoxin B1	increases methylation	1
Gold Compounds	decreases expression	1
Sirolimus	decreases reaction, increases expression	1

Cellosaurus cell lines

5 cell lines: 5 induced pluripotent stem cell

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D0F9	HIMRi002-A	Induced pluripotent stem cell	Female
CVCL_D0FA	HIMRi003-A	Induced pluripotent stem cell	Female
CVCL_VE38	EURACi001-A	Induced pluripotent stem cell	Female
CVCL_VE39	EURACi002-A	Induced pluripotent stem cell	Female
CVCL_VE40	EURACi003-A	Induced pluripotent stem cell	Female

Clinical trials (associated diseases)

332 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00702117	PHASE4	COMPLETED	Ajmaline Utilization in the Diagnosis and Treatment of Cardiac Arrhythmias
NCT02513940	PHASE4	COMPLETED	Influence of Testosterone Administration on Drug-Induced QT Interval Prolongation and Torsades de Pointes
NCT03834883	PHASE4	COMPLETED	Reducing the Risk of Drug-Induced QT Interval Lengthening in Women
NCT04169100	PHASE4	UNKNOWN	Novel Form of Acquired Long QT Syndrome
NCT04675788	PHASE4	COMPLETED	Novel Approaches for Minimizing Drug-Induced QT Interval Lengthening
NCT00348530	PHASE4	UNKNOWN	Carvedilol Versus Verapamil in Chronic Heart Failure Secondary to Non-Ischemic Cardiomyopathy
NCT00371891	PHASE4	COMPLETED	Ontario Multidetector Computed Tomographic (MDCT) Coronary Angiography Study (OMCAS)
NCT00401856	PHASE4	COMPLETED	CMR to Assess Fibrosis in Cardiomyopathy Using Eplerenone
NCT00559338	PHASE4	COMPLETED	Impact of Nesiritide Infusion for Decompensated Heart Failure in the Emergency Department
NCT00606775	PHASE4	UNKNOWN	The Preventive Efficacy of Carvedilol on Cardiac Dysfunction in Duchenne Muscular Dystrophy
NCT00658203	PHASE4	COMPLETED	Clinical Evaluation on Advanced Resynchronization
NCT00701220	PHASE4	COMPLETED	Statin Therapy for Ischemic and Nonischemic Cardiomyopathy
NCT00800761	PHASE4	COMPLETED	Intensive Combined Chelation Therapy for Iron-Induced Cardiac Disease in Patients With Thalassemia Major
NCT00806390	PHASE4	TERMINATED	Prevention of Anthracycline or Trastuzumab Induced Cardiomyopathy by Metoprolol
NCT01006473	PHASE4	COMPLETED	Exercise Training in Chagas Cardiomyopathy
NCT01261065	PHASE4	COMPLETED	Mechanisms of Improvement With Beta-Blocker Treatment in Heart Failure
NCT01345188	PHASE4	COMPLETED	Ranolazine in Ischemic Cardiomyopathy
NCT01868841	PHASE4	COMPLETED	123-I mIBG (AdreView) Heart-to-Mediastinal (H/M) Ratio and SPECT Imaging on a Small Field of View-High Efficiency Cardiac SPECT System
NCT02640846	PHASE4	UNKNOWN	Effects of Levosimendan, Milrinone and Norepinephrine on Left and Right Ventricular Function in Septic Shock
NCT03228823	PHASE4	UNKNOWN	Prospective Assessment of Premature Ventricular Contractions Suppression in Cardiomyopathy(PAPS)
NCT04323852	PHASE4	COMPLETED	Can Vitamin D Reduce Heart Muscle Damage After Bypass Surgery?
NCT05034432	PHASE4	RECRUITING	The PIVATAL Study -Study of Ventricular Arrhythmia (VTA) Ablation in Left Ventricular Assist Device (LVAD) Patients
NCT05718128	PHASE4	RECRUITING	Clinical Study of Endocardial Myocardial Biopsy
NCT06964464	PHASE4	RECRUITING	Comparative Effectiveness of Carvedilol Versus Metoprolol Succinate in Heart Failure Patients With an Implantable Cardioverter Defibrillator
NCT00701077	PHASE3	TERMINATED	DAPERB 3,4-DiAminoPyridine and Electrophysiological Response in Brugada Syndrome
NCT00927732	PHASE3	TERMINATED	Hydroquinidine Versus Placebo in Patients With Brugada Syndrome
NCT00170183	PHASE3	COMPLETED	Brain Natriuretic Peptide (BNP) to Preserve Renal Function in Hospitalized Patients With Heart Failure
NCT00270387	PHASE3	COMPLETED	A Study of Short-Term Outcomes and Economic Impact For Patients With Worsening Congestive Heart Failure When Natrecor (Nesiritide) is Added to Standard-Care Therapy, Compared to Administration of Placebo With Standard-Care Therapy
NCT00321295	PHASE3	COMPLETED	Biventricular Pacing In Patients With Left Ventricular Dysfunction After Cardiovascular Surgery
NCT00483197	PHASE3	UNKNOWN	VentrAssistTM LVAD as a Bridge to Cardiac Transplantation - Pivotal Trial
NCT00490321	PHASE3	UNKNOWN	VentrAssistTM LVAD for the Treatment of Advanced Heart Failure - Destination Therapy
NCT00626028	PHASE3	COMPLETED	Comparison of Inhaled Nitric Oxide and Oxygen in Participants Reactivity During Acute Pulmonary Vasodilator Testing
NCT01013714	PHASE3	UNKNOWN	Cardiac Sympathetic Denervation for Prevention of Ventricular Tachyarrhythmias
NCT01217827	PHASE3	COMPLETED	Implantable Cardioverter-Defibrillator Use in the VA System
NCT01648634	PHASE3	COMPLETED	Nebivolol for the Prevention of Left Ventricular Systolic Dysfunction in Patients With Duchenne Muscular Dystrophy
NCT02924285	PHASE3	COMPLETED	Catheter Ablation Versus Amiodarone for Therapy of Premature Ventricular Contractions in Patients With Structural Heart Disease
NCT03860935	PHASE3	COMPLETED	Efficacy and Safety of AG10 in Subjects With Transthyretin Amyloid Cardiomyopathy
NCT04166331	PHASE3	COMPLETED	Adjunctive DobutAmine in sePtic Cardiomyopathy With Tissue Hypoperfusion
NCT05175066	PHASE3	COMPLETED	Bisoprolol Administration to Prevent Anthracycline-induced Cardiotoxicity
NCT05237323	PHASE3	COMPLETED	Micophenolate Mofetil Versus Azathioprine in Myocarditis