CCDC154

Summary

CCDC154 (coiled-coil domain containing 154, HGNC:34454) is a protein-coding gene on chromosome 16p13.3, encoding Coiled-coil domain-containing protein 154 (A6NI56).

Predicted to be involved in bone mineralization involved in bone maturation. Predicted to act upstream of or within bone resorption; odontogenesis; and sensory perception of sound. Predicted to be located in early endosome.

Source: NCBI Gene 645811 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 165 total — 1 pathogenic
• MANE Select transcript: NM_001143980

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:34454
Approved symbol	CCDC154
Name	coiled-coil domain containing 154
Location	16p13.3
Locus type	gene with protein product
Status	Approved
Aliases	LOC645811
Ensembl gene	ENSG00000197599
Ensembl biotype	protein_coding
OMIM	618740
Entrez	645811

Gene structure

Transcript identifiers

Ensembl transcripts: 4 — 2 protein_coding, 1 retained_intron, 1 nonsense_mediated_decay

ENST00000389176, ENST00000409671, ENST00000463299, ENST00000483702

RefSeq mRNA: 1 — MANE Select: NM_001143980 NM_001143980

CCDS: CCDS92082

Canonical transcript exons

ENST00000389176 — 17 exons

Exon	Start	End
ENSE00001422461	1435969	1436086
ENSE00001424078	1436445	1436521
ENSE00001427305	1437817	1437954
ENSE00001429838	1436692	1436811
ENSE00001505103	1438050	1438176
ENSE00001505107	1439025	1439126
ENSE00001505109	1442406	1442529
ENSE00001505110	1442880	1442975
ENSE00001505115	1443796	1444012
ENSE00001578439	1438619	1438737
ENSE00001586355	1438815	1438943
ENSE00001701144	1444316	1444556
ENSE00003509933	1434668	1434852
ENSE00003556806	1443261	1443301
ENSE00003591194	1443506	1443695
ENSE00003607599	1435089	1435175
ENSE00003937684	1434383	1434534

Expression profiles

Bgee: expression breadth ubiquitous, 129 present calls, max score 87.84.

Top tissues by expression

132 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
pituitary gland	UBERON:0000007	87.84	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	87.64	gold quality
right hemisphere of cerebellum	UBERON:0014890	87.42	gold quality
adenohypophysis	UBERON:0002196	85.98	gold quality
cerebellar hemisphere	UBERON:0002245	85.80	gold quality
cerebellar cortex	UBERON:0002129	85.55	gold quality
cerebellum	UBERON:0002037	85.37	gold quality
right testis	UBERON:0004534	85.11	gold quality
left testis	UBERON:0004533	84.86	gold quality
testis	UBERON:0000473	83.60	gold quality
spleen	UBERON:0002106	82.23	gold quality
right lobe of thyroid gland	UBERON:0001119	81.99	gold quality
left lobe of thyroid gland	UBERON:0001120	81.31	gold quality
granulocyte	CL:0000094	81.09	gold quality
thyroid gland	UBERON:0002046	80.95	gold quality
right uterine tube	UBERON:0001302	80.32	gold quality
right frontal lobe	UBERON:0002810	79.77	gold quality
nucleus accumbens	UBERON:0001882	79.50	gold quality
endocervix	UBERON:0000458	79.08	gold quality
hypothalamus	UBERON:0001898	78.63	gold quality
Ammon’s horn	UBERON:0001954	78.08	gold quality
putamen	UBERON:0001874	77.87	gold quality
amygdala	UBERON:0001876	77.84	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	77.72	gold quality
substantia nigra	UBERON:0002038	77.63	gold quality
caudate nucleus	UBERON:0001873	77.62	gold quality
lower esophagus mucosa	UBERON:0035834	77.59	gold quality
temporal lobe	UBERON:0001871	77.47	gold quality
prostate gland	UBERON:0002367	77.45	gold quality
brain	UBERON:0000955	77.08	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	1.07

Regulation

Is transcription factor: no

Literature-anchored findings (GeneRIF, showing 2)

• CCDC154 is a novel osteopetrosis-related gene involved in cell cycle regulation and tumor suppression growth. (PMID:22895184)
• Coiled-coil domain-containing 154 promotes colorectal cancer proliferation and metastasis via interacting with minichromosome maintenance complex component 2. (PMID:37863352)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Ccdc154	ENSMUSG00000059562
rattus_norvegicus	Ccdc154	ENSRNOG00000030541

Protein

Protein identifiers

Coiled-coil domain-containing protein 154 — A6NI56 (reviewed: A6NI56)

All UniProt accessions (4): A0A590PWR5, A6NI56, B7ZBA8, H3BS06

UniProt curated annotations — full annotation on UniProt →

Subcellular location. Early endosome.

Miscellaneous. Overexpression suppresses cell proliferation by inducing G2/M arrest.

RefSeq proteins (1): NP_001137452* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR029512	CCDC154	Family

Pfam: PF15450

UniProt features (5 total): coiled-coil region 4, chain 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-A6NI56-F1	76.92	0.44

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 21 (showing top): GSE37336_LY6C_POS_VS_NEG_NAIVE_CD4_TCELL_DN, GOBP_SKELETAL_SYSTEM_DEVELOPMENT, GOBP_ANATOMICAL_STRUCTURE_MATURATION, GOBP_BONE_DEVELOPMENT, GOBP_BONE_MINERALIZATION, GOBP_OSSIFICATION, GOBP_BONE_MATURATION, GOBP_BONE_MINERALIZATION_INVOLVED_IN_BONE_MATURATION, GOBP_ANIMAL_ORGAN_MATURATION, GOBP_DEVELOPMENTAL_MATURATION, GSE14000_TRANSLATED_RNA_VS_MRNA_4H_LPS_DC_DN, BLANCO_MELO_MERS_COV_INFECTION_MCR5_CELLS_UP, GSE7219_UNSTIM_VS_LPS_AND_ANTI_CD40_STIM_DC_DN, TBPL1_TARGET_GENES, OSMAN_BLOOD_CHAD63_KH_AGE_18_50YO_HIGH_DOSE_SUBJECTS_24HR_UP

GO Biological Process (1): bone mineralization involved in bone maturation (GO:0035630)

GO Molecular Function (0):

GO Cellular Component (2): early endosome (GO:0005769), endosome (GO:0005768)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
bone mineralization	1
ossification involved in bone maturation	1
endosome	1
endomembrane system	1
cytoplasmic vesicle	1

Protein interactions and networks

STRING

530 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CCDC154	C2orf81	A6NN90	644
CCDC154	CCDC106	Q9BWC9	605
CCDC154	STMP1	E0CX11	594
CCDC154	IQCN	Q9H0B3	586
CCDC154	GOLGA6L7	A0A1B0GV03	528
CCDC154	JAKMIP3	Q5VZ66	507
CCDC154	MYO3B	Q8WXR4	450
CCDC154	OR5J2	Q8NH18	447
CCDC154	ADPRM	Q3LIE5	447
CCDC154	CCDC15	Q0P6D6	446
CCDC154	LIMK2	P53671	445
CCDC154	ELOA2	Q8IYF1	432
CCDC154	C6orf136	Q5SQH8	419
CCDC154	ZNF658	Q5TYW1	400
CCDC154	RHBDF1	Q96CC6	398

IntAct

5 interactions, top by confidence:

A	B	Type	Score
PB2	SEC15L3	psi-mi:“MI:0914”(association)	0.350
AP3B1	CCDC154	psi-mi:“MI:0915”(physical association)	0.000
NOLC1	CCDC154	psi-mi:“MI:0915”(physical association)	0.000
EAF1	CCDC154	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (6): CCDC154 (Affinity Capture-MS), CCDC154 (Affinity Capture-MS), CCDC154 (Affinity Capture-MS), CCDC154 (Affinity Capture-MS), CCDC154 (Affinity Capture-MS), CCDC154 (Proximity Label-MS)

ESM2 similar proteins: A0A140LIT1, A0JNH6, A1A5D9, A4FV37, A6NC98, A6NI56, A6NJZ7, A6NNM3, F6XLV1, H7BZ55, O15049, P0C7N4, P0CW27, P58660, Q0P5D1, Q2KJ21, Q2TAC2, Q3LUD3, Q3T1I3, Q3UPH7, Q4QRL3, Q5ND29, Q5TZA2, Q6NSJ2, Q6PHN1, Q6QZQ4, Q7Z6P3, Q80VM7, Q8C7U1, Q8CB62, Q8CB87, Q8CHW5, Q8CJ40, Q8N137, Q8N283, Q8N6Y0, Q8R370, Q8TER5, Q8TF21, Q91VJ2

Diamond homologs: A6NI56, Q6RUT8

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

165 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	123
Likely benign	29
Benign	0

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
252979	GRCh37/hg19 16p13.3(chr16:88165-1715454)x1	Pathogenic

SpliceAI

3215 predictions. Top by Δscore:

Variant	Effect	Δscore
16:1434851:CG:C	acceptor_gain	1.0000
16:1437812:CGCA:C	donor_loss	1.0000
16:1437813:GCAC:G	donor_loss	1.0000
16:1437814:CA:C	donor_loss	1.0000
16:1438043:C:CA	donor_gain	1.0000
16:1438062:T:A	donor_gain	1.0000
16:1438072:T:TA	donor_gain	1.0000
16:1438175:CC:C	acceptor_gain	1.0000
16:1438176:CC:C	acceptor_gain	1.0000
16:1438184:T:TC	acceptor_gain	1.0000
16:1438618:CCAGG:C	donor_gain	1.0000
16:1438940:TTCT:T	acceptor_gain	1.0000
16:1438942:CT:C	acceptor_gain	1.0000
16:1438944:C:CC	acceptor_gain	1.0000
16:1442402:GTAC:G	donor_loss	1.0000
16:1442404:ACC:A	donor_loss	1.0000
16:1442405:C:CA	donor_loss	1.0000
16:1434849:TGCG:T	acceptor_gain	0.9900
16:1434850:GCG:G	acceptor_gain	0.9900
16:1434850:GCGC:G	acceptor_loss	0.9900
16:1434851:CGC:C	acceptor_gain	0.9900
16:1434852:GC:G	acceptor_loss	0.9900
16:1434853:C:CA	acceptor_loss	0.9900
16:1434853:C:CC	acceptor_gain	0.9900
16:1434854:T:A	acceptor_loss	0.9900
16:1435082:T:TA	donor_gain	0.9900
16:1436589:C:T	acceptor_gain	0.9900
16:1436827:CCAG:C	acceptor_gain	0.9900
16:1437890:AGCT:A	donor_gain	0.9900
16:1437950:CGGAG:C	acceptor_gain	0.9900

AlphaMissense

4312 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000109953 (16:1435204 C>T), RS1000145429 (16:1443746 A>C), RS1000157574 (16:1434291 T>A,C), RS1000360829 (16:1437701 C>A,T), RS1000472446 (16:1441241 G>A), RS1000492314 (16:1434237 T>A), RS1000648110 (16:1437868 C>A), RS1000687418 (16:1441488 CACCCACAGCGGAGGCCCCTGCTGA>C), RS1000788790 (16:1441966 G>A), RS1000914724 (16:1438023 T>C), RS1001324303 (16:1439713 G>C), RS1001339537 (16:1443720 T>A,C), RS1001455620 (16:1443599 C>A,T), RS1001678557 (16:1434325 G>A,T), RS1001763706 (16:1436041 T>C)

Disease associations

OMIM: gene MIM:618740 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST010002_107	Refractive error	6.000000e-18

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

24 total (human), top 24 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, decreases methylation	2
aristolochic acid I	increases expression	1
GSK-J4	increases expression	1
OTX015	decreases expression	1
mivebresib	decreases expression	1
bisphenol A	decreases expression	1
sodium arsenite	increases expression	1
triphenyltin	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
tributyltinisothiocyanate	decreases expression	1
bisphenol S	decreases methylation	1
jinfukang	increases expression	1
(+)-JQ1 compound	decreases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Air Pollutants	affects expression, increases abundance	1
Arsenic	affects methylation	1
Cisplatin	decreases expression	1
Endosulfan	increases expression	1
Ozone	affects expression, increases abundance	1
Plant Extracts	affects cotreatment, decreases expression	1
Smoke	decreases expression	1
Urethane	decreases expression	1
Valproic Acid	increases methylation	1
Okadaic Acid	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.