CCL15

Summary

CCL15 (C-C motif chemokine ligand 15, HGNC:10613) is a protein-coding gene on chromosome 17q12, encoding C-C motif chemokine 15 (Q16663). Chemotactic factor that attracts T-cells and monocytes, but not neutrophils, eosinophils, or B-cells.

This gene is located in a cluster of similar genes in the same region of chromosome 17. These genes encode CC cytokines, which are secreted proteins characterized by two adjacent cysteines. The product of this gene is chemotactic for T cells and monocytes, and acts through C-C chemokine receptor type 1 (CCR1). The proprotein is further processed into numerous smaller functional peptides. Naturally-occurring readthrough transcripts occur from this gene into the downstream gene, CCL14 (chemokine (C-C motif) ligand 14).

Source: NCBI Gene 6359 — RefSeq curated summary.

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 13 total
• MANE Select transcript: NM_032965

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:10613
Approved symbol	CCL15
Name	C-C motif chemokine ligand 15
Location	17q12
Locus type	gene with protein product
Status	Approved
Aliases	HCC-2, NCC-3, SCYL3, MIP-5, Lkn-1, MIP-1d, HMRP-2B
Ensembl gene	ENSG00000275718
Ensembl biotype	protein_coding
OMIM	601393
Entrez	6359

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

ENST00000614368, ENST00000617897

RefSeq mRNA: 1 — MANE Select: NM_032965 NM_032965

CCDS: CCDS11304

Canonical transcript exons

ENST00000614050 — 0 exons

Expression profiles

Bgee: expression breadth broad, 98 present calls, max score 97.88.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.1227 / max 21.7386, expressed in 52 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
165419	1.1062	101
165420	0.1227	52

Top tissues by expression

122 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
mucosa of transverse colon	UBERON:0004991	97.88	gold quality
rectum	UBERON:0001052	97.36	gold quality
duodenum	UBERON:0002114	94.55	gold quality
right lobe of liver	UBERON:0001114	89.45	gold quality
small intestine Peyer’s patch	UBERON:0003454	84.83	gold quality
transverse colon	UBERON:0001157	84.54	gold quality
small intestine	UBERON:0002108	83.71	gold quality
liver	UBERON:0002107	82.96	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	82.71	gold quality
gall bladder	UBERON:0002110	80.86	gold quality
right uterine tube	UBERON:0001302	79.67	gold quality
right lung	UBERON:0002167	74.90	gold quality
adult mammalian kidney	UBERON:0000082	74.28	gold quality
vermiform appendix	UBERON:0001154	73.94	gold quality
intestine	UBERON:0000160	71.95	gold quality
kidney	UBERON:0002113	67.83	gold quality
colon	UBERON:0001155	67.08	gold quality
upper lobe of left lung	UBERON:0008952	64.70	gold quality
islet of Langerhans	UBERON:0000006	63.84	gold quality
fallopian tube	UBERON:0003889	63.03	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	61.33	gold quality
urinary bladder	UBERON:0001255	60.02	gold quality
mucosa of stomach	UBERON:0001199	59.68	gold quality
lung	UBERON:0002048	59.58	gold quality
colonic epithelium	UBERON:0000397	59.49	gold quality
right adrenal gland cortex	UBERON:0035827	56.63	gold quality
adrenal tissue	UBERON:0018303	53.18	gold quality
smooth muscle tissue	UBERON:0001135	52.95	gold quality
right adrenal gland	UBERON:0001233	52.62	gold quality
cortex of kidney	UBERON:0001225	52.58	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	8.92
E-MTAB-7249	no	1.32

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): AP1, CREB3, FOS, JUN, NFKB1, NFKB, NFKBIA, RELA, SMAD4

Literature-anchored findings (GeneRIF, showing 26)

• truncation of NH2-terminal amino acid residues increases agonistic potency on CC chemokine receptors 1 and 3 (PMID:11832479)
• Lkn-1 activates the ERK pathway by transducing the signal through G(i)/G(o) protein, PLC, PKC delta and Ras, and it may play a role for cell proliferation, differentiation, and regulation of gene expression for other cellular processes (PMID:12759139)
• These observations demonstrate that the two NF-kappaB binding sites are essential for phorbol myristate acetate-induced leukotactin-1 (Lkn-1)/CCL15 expression in human monocytes. (PMID:15179048)
• CCL15(25-92) has in vitro and in vivo angiogenic activity (PMID:15251437)
• alanine-aspartic acid residues preceding the first cysteine at the NH(2)-terminus are essential for the binding and biological activity of leukotactin-1 (PMID:15894113)
• Compared with full-length CCL15, proteolytically processed CCL15 isoforms with N-terminal deletions display increased potency to induce calcium fluxes and chemotactic activity on monocytes and to induce adhesiveness of mononuclear cells to fibronectin. (PMID:16034099)
• Transcription of the CCL15 gene is regulated by AP-1 and NF-kappaB through MEK and JNK MAPK pathways in monocytoid cells. (PMID:16364464)
• Results point to an involvement of the CCL15-CCR1 axis in the pathophysiology of chronic renal failure. (PMID:16737685)
• factor NF-kappaB plays an important role in regulation of LZIP expression, and LZIP expression regulates the monocyte cell migration induced by Lkn-1 (PMID:17296613)
• PKCdelta activation due to Lkn-1 is involved in migration, as well as the butyric acid-induced differentiation. (PMID:19669929)
• enhanced expression in intestinal epithelium in inflammatory bowel disease and display of antibacterial activity (PMID:19812544)
• increased secretion by macrophages during Mycobacterium tuberculosis infection (PMID:20016943)
• CCL15 is elevated in human asthma and correlates with disease severity . (PMID:22092970)
• Data show that Only three of these proteins EGF, PDGF-BB and MIP-1delta (CCL15) differed significantly in plasma between controls and Alzheimer’s disease (AD). (PMID:22279551)
• we investigated a role of CCL15 in upregulating ICAM-1 in endothelial cells (PMID:23690481)
• two inflammatory cytokines, MIP-1delta and MIP-3alpha, are able to increase mesenchymal stromal cells migration in vitro (PMID:25579056)
• Loss of SMAD4 was significantly associated with CCL15 expression. (PMID:26341919)
• CCL15 activation of CCR1 plays critical roles in hepatocellular carcinoma metastasis. (PMID:26501423)
• Orthotopic animal models of HCC were established to investigate the role of CCL15 in hMSCs migration toward HCC in vivo. Both histological and flow cytometric analysis showed that significantly fewer hMSCs localized within 97H-CCL15-shRNA xenografts compared with 97H-green fluorescent protein xenografts after intravenous delivery (PMID:26763650)
• follicular thyroid carcinoma (FTC) might induce tumor associated macrophages (TAMs) infiltration by producing CCL15. Measurement of TAMs and CCL15 in follicular thyroid lesions may be applied clinically to differentiate FTC from follicular adenoma (PMID:26875556)
• CCL15 secreted from SMAD4-deficient xenografted human colorectal cancer cells recruited CCR1(+) cells, promoting their metastatic activities to the lung. Lung metastases from colorectal cancer patients revealed that CCL15 expression correlated with loss of SMAD4. CCL15-positive metastases recruited approximately 1.9 times more numbers of CCR1(+) cells than CCL15-negative metastases. (PMID:27492974)
• Plasma concentrations of CCL15, the human homolog of mouse CCL9, were elevated in a previously published cohort of 211 cGVHD patients compared with controls and associated with NRM. In a cohort of 792 patients, CCL15 measured at day +100 could not predict cGVHD occurring within the next 3 months with clinically relevant sensitivity/specificity. (PMID:29348127)
• C-C Motif Chemokine Ligand 15 May Be a Useful Biomarker for Predicting the Prognosis of Patients with Chronic Hypersensitivity Pneumonitis. (PMID:31416084)
• Eosinophil-derived chemokine (hCCL15/23, mCCL6) interacts with CCR1 to promote eosinophilic airway inflammation. (PMID:33640900)
• Hepatitis B Virus X Protein Modulates Chemokine CCL15 Upregulation in Hepatocellular Carcinoma. (PMID:33653254)
• CTHRC1 promotes colorectal cancer progression by recruiting tumor-associated macrophages via up-regulation of CCL15. (PMID:37987774)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	ccl35.2	ENSDARG00000070378
danio_rerio	ccl35.1	ENSDARG00000103466
mus_musculus	Ccl6	ENSMUSG00000018927
mus_musculus	Ccl9	ENSMUSG00000019122
rattus_norvegicus	Ccl9	ENSRNOG00000028548

Paralogs (26): CX3CL1 (ENSG00000006210), CCL26 (ENSG00000006606), CCL22 (ENSG00000102962), CCL17 (ENSG00000102970), CCL24 (ENSG00000106178), CCL7 (ENSG00000108688), CCL2 (ENSG00000108691), CCL8 (ENSG00000108700), CCL1 (ENSG00000108702), CCL20 (ENSG00000115009), CCL25 (ENSG00000131142), CCL21 (ENSG00000137077), XCL1 (ENSG00000143184), XCL2 (ENSG00000143185), CCL11 (ENSG00000172156), CCL19 (ENSG00000172724), CCL13 (ENSG00000181374), CCL5 (ENSG00000271503), CCL23 (ENSG00000274736), CCL16 (ENSG00000275152), CCL4 (ENSG00000275302), CCL18 (ENSG00000275385), CCL4L2 (ENSG00000276070), CCL3L3 (ENSG00000276085), CCL14 (ENSG00000276409), CCL3 (ENSG00000277632)

Protein

Protein identifiers

C-C motif chemokine 15 — Q16663 (reviewed: Q16663)

Alternative names: Chemokine CC-2, Leukotactin-1, MIP-1 delta, Macrophage inflammatory protein 5, Mrp-2b, NCC-3, Small-inducible cytokine A15

All UniProt accessions (2): Q16663, A0A087X1J9

UniProt curated annotations — full annotation on UniProt →

Function. Chemotactic factor that attracts T-cells and monocytes, but not neutrophils, eosinophils, or B-cells. Acts mainly via CC chemokine receptor CCR1. Also binds to CCR3. CCL15(22-92), CCL15(25-92) and CCL15(29-92) are more potent chemoattractants than the CCL15.

Subunit / interactions. Monomer.

Subcellular location. Secreted.

Tissue specificity. Most abundant in heart, skeletal muscle and adrenal gland. Lower levels in placenta, liver, pancreas and bone marrow. CCL15(22-92), CCL15(25-92) and CCL15(29-92) are found in high levels in synovial fluids from rheumatoid patients.

Post-translational modifications. The N-terminal is proteolytically cleaved by proteases associated with inflammatory responses. The processed forms CCL15(22-92), CCL15(25-92) and CCL15(29-92) exhibit increase in CCR1-mediated signaling and chemotaxis assays in vitro.

Similarity. Belongs to the intercrine beta (chemokine CC) family.

RefSeq proteins (1): NP_116741* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000827	Chemokine_CC_CS	Conserved_site
IPR001811	Chemokine_IL8-like_dom	Domain
IPR036048	Interleukin_8-like_sf	Homologous_superfamily
IPR039809	Chemokine_b/g/d	Family

Pfam: PF00048

UniProt features (17 total): strand 5, chain 4, disulfide bond 3, helix 2, signal peptide 1, sequence variant 1, sequence conflict 1

Structure

Experimental structures (PDB)

3 structures.

PDB	Method	Resolution (Å)
7VL9	ELECTRON MICROSCOPY	2.6
7VLA	ELECTRON MICROSCOPY	2.7
2HCC	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q16663-F1	78.01	0.54

Antibody-complex structures (SAbDab): 2 — 7VL9, 7VLA

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (3): 53–77, 54–93, 64–104

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 303 (showing top): GOBP_SPINAL_CORD_DEVELOPMENT, MODULE_52, MODULE_92, GOBP_ANTIMICROBIAL_HUMORAL_RESPONSE, GOBP_CELL_CHEMOTAXIS, GOBP_INFLAMMATORY_RESPONSE, GOBP_RESPONSE_TO_PEPTIDE, ATACCTC_MIR202, MODULE_45, GRAESSMANN_APOPTOSIS_BY_SERUM_DEPRIVATION_UP, GRAESSMANN_RESPONSE_TO_MC_AND_SERUM_DEPRIVATION_UP, IVANOVA_HEMATOPOIESIS_LATE_PROGENITOR, SOUCEK_MYC_TARGETS, GOBP_NEUROGENESIS, YY1_Q6

GO Biological Process (12): intracellular calcium ion homeostasis (GO:0006874), chemotaxis (GO:0006935), inflammatory response (GO:0006954), signal transduction (GO:0007165), cell-cell signaling (GO:0007267), positive regulation of cell migration (GO:0030335), positive regulation of inflammatory response (GO:0050729), cell chemotaxis (GO:0060326), antimicrobial humoral immune response mediated by antimicrobial peptide (GO:0061844), chemokine-mediated signaling pathway (GO:0070098), immune response (GO:0006955), positive chemotaxis (GO:0050918)

GO Molecular Function (6): signaling receptor binding (GO:0005102), chemokine activity (GO:0008009), heparin binding (GO:0008201), chemoattractant activity (GO:0042056), CCR chemokine receptor binding (GO:0048020), cytokine activity (GO:0005125)

GO Cellular Component (2): obsolete extracellular space (GO:0005615), extracellular region (GO:0005576)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cell communication	2
signaling	2
cell migration	2
chemotaxis	2
chemokine receptor binding	2
receptor ligand activity	2
intracellular monoatomic cation homeostasis	1
calcium ion homeostasis	1
response to chemical	1
taxis	1
defense response	1
cellular process	1
regulation of cellular process	1
cellular response to stimulus	1
regulation of cell migration	1
positive regulation of cell motility	1
inflammatory response	1
positive regulation of defense response	1
positive regulation of response to external stimulus	1
regulation of inflammatory response	1
cellular response to chemical stimulus	1
antimicrobial humoral response	1
G protein-coupled receptor signaling pathway	1
cytokine-mediated signaling pathway	1
cellular response to chemokine	1
immune system process	1
response to stimulus	1
protein binding	1
cytokine activity	1
cell chemotaxis	1
glycosaminoglycan binding	1
sulfur compound binding	1
positive chemotaxis	1
cellular anatomical structure	1

Protein interactions and networks

STRING

600 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CCL15	CCR1	P32246	995
CCL15	CCR3	P51677	969
CCL15	CCL2	P13500	896
CCL15	A0A0J9YW77	A0A0J9YW77	817
CCL15	CCL1	P22362	752
CCL15	CCL20	P78556	750
CCL15	CCL11	P50877	732
CCL15	CXCL1	P09341	727
CCL15	CCL19	Q99731	726
CCL15	CCL27	Q9Y4X3	708
CCL15	CCL24	O00175	692
CCL15	CXCL2	P19875	681
CCL15	CXCL11	O14625	665
CCL15	CCR2	P41597	649
CCL15	CCR5	P51681	626

IntAct

3 interactions, top by confidence:

A	B	Type	Score
CCL15	CCL2	psi-mi:“MI:0407”(direct interaction)	0.440
CCL15	MLYCD	psi-mi:“MI:0914”(association)	0.350

BioGRID (6): CCL2 (Reconstituted Complex), MESDC1 (Affinity Capture-MS), MLYCD (Affinity Capture-MS), COL6A1 (Affinity Capture-MS), BLK (Affinity Capture-MS), WDR45B (Affinity Capture-MS)

ESM2 similar proteins: A8YXX7, B4X8D9, O46655, O75711, O76095, O77049, O88745, O88823, O88824, P01186, P01359, P04155, P08163, P08833, P0CW02, P18406, P21743, P21744, P22934, P24593, P24594, P25118, P35455, P47876, P47879, P55773, Q03191, Q03403, Q05717, Q07079, Q07654, Q08423, Q16663, Q28985, Q29183, Q62395, Q63467, Q66IA6, Q6DGP8, Q6Q484

Diamond homologs: F5HET8, O00175, O00585, O00626, O55145, O88430, O97919, P10147, P10148, P10855, P13236, P13500, P13501, P14097, P14844, P16619, P27784, P28291, P28292, P30882, P42831, P46632, P47993, P49873, P50229, P50230, P50231, P51670, P51671, P52203, P55773, P55774, P61274, P61275, P78423, P80075, P80098, P80343, P82943, P97272

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

13 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	12
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

3702 predictions. Top by Δscore:

Variant	Effect	Δscore
17:35997719:A:AC	donor_gain	1.0000
17:35997720:C:CC	donor_gain	1.0000
17:35998864:A:AC	donor_gain	1.0000
17:35998865:C:CA	donor_gain	1.0000
17:35998865:C:CC	donor_gain	1.0000
17:35998865:CT:C	donor_gain	1.0000
17:35998865:CTG:C	donor_gain	1.0000
17:35998865:CTGTT:C	donor_gain	1.0000
1:169849600:CTGAG:C	donor_loss	1.0000
1:169849601:TGAGG:T	donor_loss	1.0000
1:169849603:AGG:A	donor_loss	1.0000
1:169849604:GG:G	donor_loss	1.0000
1:169849605:GTA:G	donor_loss	1.0000
1:169849606:T:A	donor_loss	1.0000
1:169851794:T:TA	acceptor_gain	1.0000
1:169851803:A:AG	acceptor_gain	1.0000
1:169851803:AT:A	acceptor_gain	1.0000
1:169851803:ATG:A	acceptor_gain	1.0000
1:169851804:T:G	acceptor_gain	1.0000
1:169851804:T:TA	acceptor_gain	1.0000
1:169851805:G:A	acceptor_gain	1.0000
1:169852788:A:AG	acceptor_gain	1.0000
1:169852789:G:GG	acceptor_gain	1.0000
1:169852948:G:GT	donor_gain	1.0000
1:169852952:GA:G	donor_gain	1.0000
1:169852953:A:G	donor_gain	1.0000
1:169852958:C:G	donor_gain	1.0000
1:169854961:TCGC:T	acceptor_gain	1.0000
1:169854962:CGC:C	acceptor_gain	1.0000
1:169854962:CGCC:C	acceptor_gain	1.0000

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000482890 (17:36000008 G>A,T), RS1000682867 (17:36001289 C>A), RS1000714950 (17:36001049 A>G), RS1001084167 (17:35998576 G>C), RS1001687580 (17:35999845 T>C,G), RS1001700848 (17:36002951 T>G), RS1002678709 (17:36003445 CATTCTATTTTAAGTGCTTATTT>C), RS1002705134 (17:36001550 C>T), RS1003641411 (17:36002554 T>A), RS1003684440 (17:35997195 G>A), RS1004001430 (17:36000427 C>A,T), RS1004720236 (17:35998651 T>C), RS1005186840 (17:36003313 ACT>A), RS1005220963 (17:36002941 A>G,T), RS1005250133 (17:35998471 T>A,C)

Disease associations

OMIM: gene MIM:601393 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST006522_7	Upper eyelid sagging severity	3.000000e-06
GCST006622_13	Neonatal cytokine/chemokine levels (fetal genetic effect)	5.000000e-25

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0004747	protein measurement
EFO:0007959	fetal genotype effect measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

29 total (human), top 29 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, increases expression, increases methylation	3
Aflatoxin B1	affects expression, increases expression	3
2,2’-methylenebis(4-methyl-6-tert-butylphenol)	affects expression, affects response to substance	1
zinc chloride	decreases expression	1
ferrous sulfate	decreases expression	1
1-nitropyrene	decreases expression	1
ciglitazone	affects binding, increases expression	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression, affects cotreatment	1
deguelin	decreases expression	1
4-chloro-N-((4-(1,1-dimethylethyl)phenyl)methyl)-3-ethyl-1-methyl-1H-pyrazole-5-carboxamide	decreases expression	1
picoxystrobin	decreases expression	1
Arsenic Trioxide	increases expression	1
Acetaminophen	decreases expression	1
Air Pollutants	increases abundance, increases expression	1
Antimycin A	decreases expression	1
Azathioprine	increases expression	1
Cadmium	increases abundance, increases expression	1
Estradiol	decreases expression	1
Lipopolysaccharides	increases expression, affects response to substance, affects cotreatment	1
Paraquat	affects cotreatment, increases expression	1
Phthalic Acids	increases methylation	1
Quercetin	decreases expression	1
Smoke	increases abundance, increases expression	1
Valproic Acid	decreases methylation	1
Cyclosporine	decreases expression	1
Cadmium Chloride	increases abundance, increases expression	1
Okadaic Acid	decreases expression	1
Nanotubes, Carbon	increases expression	1
Antigens, Dermatophagoides	affects cotreatment, increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.