CCNO
geneOn this page
Also known as UDG2FLJ22422UNG2
Summary
CCNO (cyclin O, HGNC:18576) is a protein-coding gene on chromosome 5q11.2, encoding Cyclin-O (P22674). Specifically required for generation of multiciliated cells, possibly by promoting a cell cycle state compatible with centriole amplification and maturation.
This gene encodes a member of the cyclin protein family, and the encoded protein is involved in regulation of the cell cycle. Disruption of this gene is associated with primary ciliary dyskinesia-19. Alternative splicing results in multiple transcript variants. This gene, which has a previous symbol of UNG2, was erroneously identified as a uracil DNA glycosylase in PubMed ID: 2001396. A later publication, PubMed ID: 8419333, identified this gene’s product as a cyclin protein family member. The UNG2 symbol is also used as a specific protein isoform name for the UNG gene (GeneID 7374), so confusion exists in the scientific literature and in some databases for these two genes.
Source: NCBI Gene 10309 — RefSeq curated summary.
At a glance
- Gene–disease (curated): primary ciliary dyskinesia 29 (Definitive, ClinGen) — +1 more curated relationship
- GWAS associations: 1
- Clinical variants (ClinVar): 272 total — 27 pathogenic, 9 likely-pathogenic
- Phenotypes (HPO): 56
- Druggable target: yes
- MANE Select transcript:
NM_021147
Identifiers
Gene identifiers
| Field | Value |
|---|---|
| HGNC ID | HGNC:18576 |
| Approved symbol | CCNO |
| Name | cyclin O |
| Location | 5q11.2 |
| Locus type | gene with protein product |
| Status | Approved |
| Aliases | UDG2, FLJ22422, UNG2 |
| Ensembl gene | ENSG00000152669 |
| Ensembl biotype | protein_coding |
| OMIM | 607752 |
| Entrez | 10309 |
Gene structure
Transcript identifiers
Ensembl transcripts: 2 — 1 protein_coding, 1 nonsense_mediated_decay
ENST00000282572, ENST00000501463
RefSeq mRNA: 1 — MANE Select: NM_021147
NM_021147
CCDS: CCDS34157
Canonical transcript exons
ENST00000282572 — 3 exons
| Exon | Start | End |
|---|---|---|
| ENSE00001006503 | 55233143 | 55233608 |
| ENSE00003521875 | 55232361 | 55232546 |
| ENSE00003526073 | 55231152 | 55231860 |
Expression profiles
Bgee: expression breadth ubiquitous, 172 present calls, max score 93.71.
FANTOM5 (CAGE): breadth broad, TPM avg 2.7184 / max 80.2956, expressed in 798 samples.
FANTOM5 promoters (4 alternative TSS)
| Promoter ID | TPM avg | Samples expressed |
|---|---|---|
| 61690 | 2.0213 | 718 |
| 61688 | 0.4163 | 235 |
| 61691 | 0.2673 | 113 |
| 61689 | 0.0134 | 1 |
Top tissues by expression
284 total, by Bgee expression score (0-100, higher = more expressed):
| Tissue | Anatomy ID | Expression score | Quality |
|---|---|---|---|
| oocyte | CL:0000023 | 93.71 | gold quality |
| secondary oocyte | CL:0000655 | 90.22 | gold quality |
| epithelium of bronchus | UBERON:0002031 | 90.03 | gold quality |
| bronchial epithelial cell | CL:0002328 | 89.32 | gold quality |
| bronchus | UBERON:0002185 | 88.96 | gold quality |
| nasal cavity epithelium | UBERON:0005384 | 88.81 | gold quality |
| primordial germ cell in gonad | CL:0000670 ∩ UBERON:0000991 | 86.99 | gold quality |
| olfactory segment of nasal mucosa | UBERON:0005386 | 86.46 | gold quality |
| right uterine tube | UBERON:0001302 | 85.51 | gold quality |
| body of pancreas | UBERON:0001150 | 83.05 | gold quality |
| right lobe of thyroid gland | UBERON:0001119 | 82.01 | gold quality |
| right testis | UBERON:0004534 | 81.54 | gold quality |
| left lobe of thyroid gland | UBERON:0001120 | 81.50 | gold quality |
| left testis | UBERON:0004533 | 81.49 | gold quality |
| thyroid gland | UBERON:0002046 | 79.66 | gold quality |
| corpus epididymis | UBERON:0004359 | 79.25 | gold quality |
| choroid plexus epithelium | UBERON:0003911 | 78.96 | gold quality |
| testis | UBERON:0000473 | 78.94 | gold quality |
| adenohypophysis | UBERON:0002196 | 78.75 | gold quality |
| endometrium epithelium | UBERON:0004811 | 78.57 | silver quality |
| pituitary gland | UBERON:0000007 | 78.45 | gold quality |
| nucleus accumbens | UBERON:0001882 | 76.95 | gold quality |
| male germ line stem cell (sensu Vertebrata) in testis | CL:0000089 ∩ UBERON:0000473 | 76.72 | gold quality |
| nasal cavity mucosa | UBERON:0001826 | 75.92 | gold quality |
| body of stomach | UBERON:0001161 | 74.53 | gold quality |
| right frontal lobe | UBERON:0002810 | 74.03 | gold quality |
| caudate nucleus | UBERON:0001873 | 73.24 | gold quality |
| cauda epididymis | UBERON:0004360 | 72.48 | gold quality |
| putamen | UBERON:0001874 | 72.45 | gold quality |
| pancreas | UBERON:0001264 | 72.41 | gold quality |
Single-cell (SCXA)
Detected in 5 experiment(s), a significant marker in 5.
| Experiment | Marker? | Max mean expression |
|---|---|---|
| E-MTAB-10283 | yes | 2754.27 |
| E-MTAB-8221 | yes | 1830.39 |
| E-CURD-114 | yes | 1315.71 |
| E-MTAB-9388 | yes | 6.75 |
| E-ANND-3 | yes | 6.54 |
Regulation
Is transcription factor: no
miRNA regulators (miRDB)
16 targeting CCNO, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):
| miRNA | Max score | Avg score | miRNA target_count |
|---|---|---|---|
| HSA-MIR-5692A | 100.00 | 74.40 | 6850 |
| HSA-MIR-548AW | 99.99 | 72.57 | 3559 |
| HSA-MIR-1468-3P | 99.96 | 72.74 | 3797 |
| HSA-MIR-548AJ-5P | 99.78 | 71.12 | 3085 |
| HSA-MIR-548F-5P | 99.78 | 71.02 | 3093 |
| HSA-MIR-548G-5P | 99.78 | 71.12 | 3085 |
| HSA-MIR-548X-5P | 99.78 | 71.12 | 3085 |
| HSA-MIR-452-5P | 99.65 | 69.63 | 1762 |
| HSA-MIR-4676-3P | 99.65 | 69.31 | 1733 |
| HSA-MIR-892C-3P | 99.65 | 69.38 | 1745 |
| HSA-MIR-4649-3P | 99.56 | 66.90 | 1783 |
| HSA-MIR-211-3P | 98.14 | 66.77 | 1052 |
| HSA-MIR-449C-3P | 97.75 | 67.86 | 462 |
| HSA-MIR-4704-5P | 96.13 | 68.67 | 608 |
| HSA-MIR-639 | 88.87 | 61.76 | 78 |
| HSA-MIR-487B-3P | 88.08 | 68.35 | 83 |
Literature-anchored findings (GeneRIF, showing 7)
- This publication initially attributed ‘uracil-DNA glycosylase’ activity to this gene and named it UNG2, but a later publication (PubMed ID: 8419333) more correctly identified UNG2/CCNO as a member of the cyclin protein family. (PMID:2001396)
- CCNO mutations have a role in congenital mucociliary clearance disorder with reduced generation of multiple motile cilia (PMID:24747639)
- CCNO is mutated more frequently than expected from the rare previous clinical case reports, leads to severe clinical manifestations, and should therefore be considered an important differential diagnosis of mucociliary clearance disorders. (PMID:26777464)
- This study presents the crystal structure of the DDB1-DCAF1-HIV-1-Vpr-uracil-DNA glycosylase (cyclin U) complex. (PMID:27571178)
- Primary ciliary dyskinesia due to CCNO mutations-A genotype-phenotype correlation contribution. (PMID:34102041)
- Bi-allelic mutations in MCIDAS and CCNO cause human infertility associated with abnormal gamete transport. (PMID:34569065)
- This publication corrected the mistaken attribution of uracil DNA glycosylase activity to this gene. (PMID:8419333)
Cross-species orthologs
11 orthologs
| Organism | Symbol | Gene ID |
|---|---|---|
| danio_rerio | ENSDARG00000099542 | |
| mus_musculus | Ccno | ENSMUSG00000042417 |
| rattus_norvegicus | Ccno | ENSRNOG00000010454 |
| drosophila_melanogaster | CycB | FBGN0000405 |
| drosophila_melanogaster | CycD | FBGN0010315 |
| drosophila_melanogaster | CycE | FBGN0010382 |
| caenorhabditis_elegans | WBGENE00000865 | |
| caenorhabditis_elegans | WBGENE00000866 | |
| caenorhabditis_elegans | cyb-2.2 | WBGENE00000867 |
| caenorhabditis_elegans | WBGENE00000870 | |
| caenorhabditis_elegans | cye-1 | WBGENE00000871 |
Paralogs (18): CCNE1 (ENSG00000105173), CCNP (ENSG00000105219), CCNJ (ENSG00000107443), CCND1 (ENSG00000110092), CCND3 (ENSG00000112576), CCNG1 (ENSG00000113328), CCNI (ENSG00000118816), CCND2 (ENSG00000118971), CCNA1 (ENSG00000133101), CCNB1 (ENSG00000134057), CCNJL (ENSG00000135083), CCNG2 (ENSG00000138764), CCNA2 (ENSG00000145386), CCNB3 (ENSG00000147082), CCNB2 (ENSG00000157456), CCNF (ENSG00000162063), CCNE2 (ENSG00000175305), CCNI2 (ENSG00000205089)
Protein
Protein identifiers
Cyclin-O — P22674 (reviewed: P22674)
All UniProt accessions (1): P22674
UniProt curated annotations — full annotation on UniProt →
Function. Specifically required for generation of multiciliated cells, possibly by promoting a cell cycle state compatible with centriole amplification and maturation. Acts downstream of MCIDAS to promote mother centriole amplification and maturation in preparation for apical docking.
Subcellular location. Cytoplasm. Nucleus. Nucleolus.
Tissue specificity. Present in respiratory cells (at protein level).
Disease relevance. Ciliary dyskinesia, primary, 29 (CILD29) [MIM:615872] A disorder characterized by abnormalities of motile cilia. Respiratory infections leading to chronic inflammation and bronchiectasis are recurrent, due to defects in the respiratory cilia. CILD29 patients do not exhibit situs inversus, a congenital abnormality in which visceral organs are opposite to their normal positions (situs solitus) due to lateral transposition. The disease is caused by variants affecting the gene represented in this entry. Marked reduction of cilia in multiciliate cells due to defective mother centriole generation and placement. Remaining cilia correctly express axonemal motor proteins, are motile and do not show beating defects. Defects are probably caused by a strong reduction in the number of multiple motile cilia covering the cell surface in respiratory epithelial cells.
Similarity. Belongs to the cyclin family.
Isoforms (2)
| UniProt ID | Names | Canonical? |
|---|---|---|
| P22674-1 | 1 | yes |
| P22674-2 | 2 |
RefSeq proteins (1): NP_066970* (*=MANE)
Domains & families (InterPro)
| ID | Name | Type |
|---|---|---|
| IPR004367 | Cyclin_C-dom | Domain |
| IPR006671 | Cyclin_N | Domain |
| IPR013763 | Cyclin-like_dom | Domain |
| IPR036915 | Cyclin-like_sf | Homologous_superfamily |
| IPR039361 | Cyclin | Family |
Pfam: PF00134, PF02984
Enzyme classification (BRENDA):
- EC 3.2.2.27 — uracil-DNA glycosylase (BRENDA: 47 organisms, 259 substrates, 76 inhibitors, 79 Km, 70 kcat entries)
Substrate kinetics (BRENDA)
15 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.
| Substrate | Km (mM) | Measurements |
|---|---|---|
| URACIL-CONTAINING CALF THYMUS DNA | 0.0004–0.0028 | 18 |
| URACIL-MISMATCHED DOUBLE-STRANDED DNA | — | 18 |
| URACIL-MISMATCHED SINGLE-STRANDED DNA | 0.0005–0.0022 | 8 |
| DOUBLE STRANDED DNA CONTAINING G-U MISMATCH | 0.0002–0.001 | 4 |
| DUMP DNA | 0.0004–0.0028 | 4 |
| URACIL-MISMATCHED DOUBLE-STRANDED DNA WITH U-G M | — | 4 |
| URACIL-CONTAINING DOUBLE-STRANDED DNA | 0.0001 | 2 |
| URACIL-CONTAINING SINGLE-STRANDED DNA | — | 2 |
| URACIL-MISMATCHED DOUBLE-STRANDED DNA WITH U-A M | 0.0007–0.004 | 2 |
| 5-HYDROXYMETHYLURACIL-MISMATCHED DOUBLE-STRANDED | 0.0046 | 1 |
| 5-HYDROXYMETHYLURACIL-MISMATCHED DOUBLE-STRANDED | 0.0027 | 1 |
| 5-HYDROXYMETHYLURACIL-MISMATCHED SINGLE-STRANDED | 0.0038 | 1 |
| GGACTTCUCTCCTTTCCAGA/TCTGGAAAGGAGGGAAGTCC DUPLEX | 0.0003 | 1 |
| TCCCTTCUCTCCTTTCCTTC/TCCCTTCUCTCCTTTCCTTC DUPLEX | 0.0004 | 1 |
| URACIL-MISMATCHED DOUBLE-STRANDED DNA WITH A-U M | — | 0 |
UniProt features (10 total): sequence variant 3, splice variant 2, chain 1, region of interest 1, compositionally biased region 1, modified residue 1, sequence conflict 1
Structure
Experimental structures (PDB)
0 structures.
Predicted structure (AlphaFold)
| Model | pLDDT | Fraction very-high |
|---|---|---|
| AF-P22674-F1 | 79.06 | 0.59 |
Functional residue map
Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.
Post-translational modifications (1): 81
Function
Pathways and Gene Ontology
Reactome pathways
0 pathways
MSigDB gene sets: 208 (showing top):
GOBP_SINGLE_FERTILIZATION, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_CELL_CYCLE_PHASE_TRANSITION, GOBP_MALE_GAMETE_GENERATION, GOCC_MICROTUBULE_ORGANIZING_CENTER, SENGUPTA_NASOPHARYNGEAL_CARCINOMA_DN, GOBP_REPRODUCTIVE_SYSTEM_DEVELOPMENT, GOBP_CILIUM_ORGANIZATION, BILD_E2F3_ONCOGENIC_SIGNATURE, MODULE_206, GOBP_CELL_CYCLE_G1_S_PHASE_TRANSITION, GOBP_ORGANELLE_ASSEMBLY, GOBP_MITOTIC_CELL_CYCLE, GOBP_COLUMNAR_CUBOIDAL_EPITHELIAL_CELL_DIFFERENTIATION, MODULE_392
GO Biological Process (9): G1/S transition of mitotic cell cycle (GO:0000082), mitotic cell cycle (GO:0000278), spermatogenesis (GO:0007283), single fertilization (GO:0007338), cell division (GO:0051301), cilium assembly (GO:0060271), seminiferous tubule development (GO:0072520), multi-ciliated epithelial cell differentiation (GO:1903251), cell projection organization (GO:0030030)
GO Molecular Function (2): cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538), protein binding (GO:0005515)
GO Cellular Component (6): cyclin-dependent protein kinase holoenzyme complex (GO:0000307), nucleus (GO:0005634), nucleolus (GO:0005730), cytoplasm (GO:0005737), microtubule organizing center (GO:0005815), centriolar satellite (GO:0034451)
GO top-level categories
Rollup of top GO terms by namespace:
| Category | Terms |
|---|---|
| cellular anatomical structure | 3 |
| mitotic cell cycle | 1 |
| mitotic cell cycle phase transition | 1 |
| cell cycle G1/S phase transition | 1 |
| cell cycle | 1 |
| mitotic nuclear division | 1 |
| developmental process involved in reproduction | 1 |
| male gamete generation | 1 |
| fertilization | 1 |
| cellular process | 1 |
| axoneme assembly | 1 |
| intraciliary transport involved in cilium assembly | 1 |
| cilium organization | 1 |
| protein localization to cilium | 1 |
| organelle assembly | 1 |
| trans-Golgi to periciliary membrane compartment transport | 1 |
| plasma membrane bounded cell projection assembly | 1 |
| ciliary transition zone assembly | 1 |
| male gonad development | 1 |
| tube development | 1 |
| reproductive structure development | 1 |
| columnar/cuboidal epithelial cell differentiation | 1 |
| cellular component organization | 1 |
| cyclin-dependent protein serine/threonine kinase activity | 1 |
| cyclin-dependent protein kinase regulator activity | 1 |
| binding | 1 |
| serine/threonine protein kinase complex | 1 |
| intracellular membrane-bounded organelle | 1 |
| nuclear lumen | 1 |
| intracellular membraneless organelle | 1 |
| intracellular anatomical structure | 1 |
| microtubule cytoskeleton | 1 |
| centrosome | 1 |
Protein interactions and networks
STRING
1811 interactions, top by confidence (×1000):
| Protein A | Protein B | Partner UniProt | Score |
|---|---|---|---|
| CCNO | MCIDAS | D6RGH6 | 888 |
| CCNO | RSPH4A | Q5TD94 | 750 |
| CCNO | CCDC39 | Q9UFE4 | 717 |
| CCNO | CCDC40 | Q4G0X9 | 702 |
| CCNO | CDC20B | Q86Y33 | 681 |
| CCNO | CDK2 | P24941 | 672 |
| CCNO | RSPH1 | Q8WYR4 | 670 |
| CCNO | GMNC | A6NCL1 | 666 |
| CCNO | DEUP1 | Q05D60 | 661 |
| CCNO | DRC2 | Q8IXS2 | 659 |
| CCNO | RSPH9 | Q9H1X1 | 659 |
| CCNO | CCNL2 | Q96S94 | 657 |
| CCNO | DNAH11 | Q96DT5 | 645 |
| CCNO | FOXJ1 | Q92949 | 633 |
| CCNO | DNAH5 | Q8TE73 | 624 |
IntAct
13 interactions, top by confidence:
| A | B | Type | Score |
|---|---|---|---|
| CDKN1A | CCNE2 | psi-mi:“MI:0914”(association) | 0.890 |
| CCNO | TLE5 | psi-mi:“MI:0915”(physical association) | 0.560 |
| Cdk1 | PHGDH | psi-mi:“MI:0914”(association) | 0.500 |
| Cdk1 | psi-mi:“MI:0915”(physical association) | 0.400 | |
| XRCC1 | CCNO | psi-mi:“MI:0915”(physical association) | 0.400 |
| CCNO | HSPB1 | psi-mi:“MI:0915”(physical association) | 0.370 |
| CCNO | FOXN3 | psi-mi:“MI:0914”(association) | 0.350 |
| TLE5 | CCNO | psi-mi:“MI:0915”(physical association) | 0.000 |
| ITSN1 | CCNO | psi-mi:“MI:0915”(physical association) | 0.000 |
| CCNO | VAV2 | psi-mi:“MI:0915”(physical association) | 0.000 |
BioGRID (35): CCNO (Two-hybrid), CCNO (Two-hybrid), PRRC2B (Affinity Capture-MS), CDK5 (Affinity Capture-MS), CDK7 (Affinity Capture-MS), CDKN1B (Affinity Capture-MS), CDKN1A (Affinity Capture-MS), CCNO (Affinity Capture-MS), CDK2 (Affinity Capture-MS), CKS2 (Affinity Capture-MS), APPBP2 (Affinity Capture-MS), MNAT1 (Affinity Capture-MS), CDK1 (Affinity Capture-MS), SKP2 (Affinity Capture-MS), SATB1 (Affinity Capture-MS)
ESM2 similar proteins: A0A0B4J1F4, A0A0G2JXN2, A4FV98, A6QPA3, C9J798, C9JJ37, D3YWP0, D3ZVU9, D4A2K4, O43374, O70277, O75382, O95294, P0C6S8, P22674, P57775, Q08DS0, Q0GA42, Q3U410, Q3UGX3, Q4G0W2, Q4V892, Q5SUV1, Q5XIU1, Q6GQU6, Q6IA17, Q6PF15, Q6TDP3, Q6TDP4, Q7TNM2, Q7Z4K8, Q86WI3, Q8CIW5, Q8IZ69, Q8K430, Q8N531, Q8N8L6, Q8NE01, Q8WXI3, Q969K4
Diamond homologs: A2YH60, O01501, O14332, O15995, O48790, P07818, P0C242, P10815, P14785, P15206, P18606, P22674, P24860, P24865, P24868, P24869, P24870, P24871, P25011, P25012, P25322, P30183, P30276, P30278, P30283, P30284, P32943, P34801, P36630, P37882, P37883, P39948, P42524, P46277, P46278, P47829, P50756, P51986, P51987, P51988
SIGNOR signaling
4 interactions.
| A | Effect | B | Mechanism |
|---|---|---|---|
| CDK2 | “up-regulates activity” | CCNO | phosphorylation |
| CCNO | “up-regulates activity” | CDK2 | binding |
| CCNO | “up-regulates activity” | CDK1 | binding |
| CCNO | “up-regulates activity” | CDK13 | binding |
Disease & clinical
Clinical variants and AI predictions
ClinVar
272 variants total. Per-class counts are floors (≥ shown; pagination cap):
| Classification | Count (floor) |
|---|---|
| Pathogenic | 27 |
| Likely pathogenic | 9 |
| Uncertain significance | 120 |
| Likely benign | 96 |
| Benign | 12 |
Top pathogenic / likely-pathogenic (30)
| Variant ID | HGVS | Classification |
|---|---|---|
| 1333420 | NM_021147.5(CCNO):c.906del (p.Leu303fs) | Pathogenic |
| 139599 | NM_021147.5(CCNO):c.248_252dup (p.Gly85fs) | Pathogenic |
| 139600 | NM_021147.5(CCNO):c.258_262dup (p.Gln88fs) | Pathogenic |
| 139601 | NM_021147.5(CCNO):c.926del (p.Pro309fs) | Pathogenic |
| 139603 | NM_021147.5(CCNO):c.263_267dup (p.Val90fs) | Pathogenic |
| 139611 | NM_021147.5(CCNO):c.481_482del (p.Leu161fs) | Pathogenic |
| 1453435 | NM_021147.5(CCNO):c.307C>T (p.Gln103Ter) | Pathogenic |
| 2025244 | NM_021147.5(CCNO):c.327dup (p.Lys110fs) | Pathogenic |
| 2822051 | NM_021147.5(CCNO):c.482_483del (p.Leu161fs) | Pathogenic |
| 2835591 | NM_021147.5(CCNO):c.476del (p.Asn159fs) | Pathogenic |
| 2963070 | NM_021147.5(CCNO):c.192del (p.Ser65fs) | Pathogenic |
| 3649618 | NM_021147.5(CCNO):c.248dup (p.Pro84fs) | Pathogenic |
| 3727869 | NM_021147.5(CCNO):c.203C>A (p.Ser68Ter) | Pathogenic |
| 411594 | NM_021147.5(CCNO):c.638T>C (p.Leu213Pro) | Pathogenic |
| 411596 | NM_021147.5(CCNO):c.775C>T (p.Gln259Ter) | Pathogenic |
| 4697405 | NM_021147.5(CCNO):c.258_262del (p.Gln88fs) | Pathogenic |
| 4717057 | NM_021147.5(CCNO):c.617dup (p.Ala207fs) | Pathogenic |
| 4725916 | NM_021147.5(CCNO):c.619_620dup (p.Phe208fs) | Pathogenic |
| 4727414 | NM_021147.5(CCNO):c.910dup (p.Arg304fs) | Pathogenic |
| 4755437 | NM_021147.5(CCNO):c.379C>T (p.Gln127Ter) | Pathogenic |
| 645504 | NM_021147.5(CCNO):c.165del (p.Gly56fs) | Pathogenic |
| 665010 | NM_021147.5(CCNO):c.302del (p.Tyr101fs) | Pathogenic |
| 665170 | NM_021147.5(CCNO):c.259_268dup (p.Val90fs) | Pathogenic |
| 800814 | NM_021147.5(CCNO):c.425del (p.Pro142fs) | Pathogenic |
| 838130 | NM_021147.5(CCNO):c.793del (p.Val265fs) | Pathogenic |
| 839570 | NM_021147.5(CCNO):c.746del (p.Gln249fs) | Pathogenic |
| 861050 | NM_021147.5(CCNO):c.875_897del (p.Asp292fs) | Pathogenic |
| 139602 | NM_021147.5(CCNO):c.961C>T (p.Gln321Ter) | Likely pathogenic |
| 2441875 | NM_021147.5(CCNO):c.564_567+1delinsTCATCGCTTGCATCGCTTGCATCGCTTGCATCGC | Likely pathogenic |
| 2502875 | NM_021147.5(CCNO):c.548T>A (p.Leu183Ter) | Likely pathogenic |
SpliceAI
435 predictions. Top by Δscore:
| Variant | Effect | Δscore |
|---|---|---|
| 5:55231857:CCAC:C | acceptor_gain | 1.0000 |
| 5:55231858:CACC:C | acceptor_gain | 1.0000 |
| 5:55231859:ACCTG:A | acceptor_loss | 1.0000 |
| 5:55231862:T:G | acceptor_loss | 1.0000 |
| 5:55233141:A:AC | donor_gain | 1.0000 |
| 5:55233142:C:CC | donor_gain | 1.0000 |
| 5:55231856:TCCAC:T | acceptor_gain | 0.9900 |
| 5:55231857:CCACC:C | acceptor_gain | 0.9900 |
| 5:55231858:CAC:C | acceptor_gain | 0.9900 |
| 5:55231859:AC:A | acceptor_gain | 0.9900 |
| 5:55231860:CC:C | acceptor_gain | 0.9900 |
| 5:55231861:C:CC | acceptor_gain | 0.9900 |
| 5:55233186:T:A | donor_gain | 0.9900 |
| 5:55231867:C:CT | acceptor_gain | 0.9800 |
| 5:55232361:C:G | donor_loss | 0.9800 |
| 5:55233406:T:TA | donor_gain | 0.9800 |
| 5:55231864:C:CT | acceptor_gain | 0.9500 |
| 5:55231949:T:TA | donor_gain | 0.9500 |
| 5:55232543:TCACC:T | acceptor_loss | 0.9500 |
| 5:55232545:ACCT:A | acceptor_loss | 0.9500 |
| 5:55232546:CCTGC:C | acceptor_loss | 0.9500 |
| 5:55232547:C:CA | acceptor_loss | 0.9500 |
| 5:55232548:T:A | acceptor_loss | 0.9500 |
| 5:55233139:T:TA | donor_gain | 0.9500 |
| 5:55232549:G:C | acceptor_loss | 0.9400 |
| 5:55231579:C:CT | acceptor_gain | 0.9300 |
| 5:55231938:T:A | donor_gain | 0.9300 |
| 5:55232552:G:T | acceptor_gain | 0.9300 |
| 5:55232640:C:A | donor_gain | 0.9300 |
| 5:55233165:T:TA | donor_gain | 0.9300 |
AlphaMissense
2246 scored. Top likely-pathogenic:
| Variant | Protein change | am_pathogenicity |
|---|---|---|
| 5:55232365:T:A | K188I | 0.999 |
| 5:55231804:G:C | F208L | 0.998 |
| 5:55231804:G:T | F208L | 0.998 |
| 5:55231806:A:G | F208L | 0.998 |
| 5:55232364:T:A | K188N | 0.998 |
| 5:55232364:T:G | K188N | 0.998 |
| 5:55231621:A:C | S269R | 0.997 |
| 5:55231621:A:T | S269R | 0.997 |
| 5:55231623:T:G | S269R | 0.997 |
| 5:55231750:G:C | F226L | 0.997 |
| 5:55231750:G:T | F226L | 0.997 |
| 5:55231752:A:G | F226L | 0.997 |
| 5:55232436:G:C | F164L | 0.996 |
| 5:55232436:G:T | F164L | 0.996 |
| 5:55232438:A:G | F164L | 0.996 |
| 5:55232440:C:G | R163P | 0.996 |
| 5:55231781:A:G | L216P | 0.995 |
| 5:55231777:C:A | E217D | 0.994 |
| 5:55231777:C:G | E217D | 0.994 |
| 5:55231778:T:A | E217V | 0.994 |
| 5:55231790:A:G | L213P | 0.993 |
| 5:55232513:A:G | W139R | 0.993 |
| 5:55232513:A:T | W139R | 0.993 |
| 5:55232531:G:T | R133S | 0.993 |
| 5:55232371:G:T | A186D | 0.992 |
| 5:55232437:A:G | F164S | 0.992 |
| 5:55232465:A:G | C155R | 0.992 |
| 5:55232509:A:G | L140P | 0.992 |
| 5:55232443:T:A | D162V | 0.991 |
| 5:55231805:A:G | F208S | 0.990 |
dbSNP variants (sampled 300 via entrez): RS1000117529 (5:55233517 T>C,G), RS1000287085 (5:55231577 G>A,T), RS1001263882 (5:55233209 G>A,C), RS1001557714 (5:55231082 C>T), RS1001695267 (5:55232912 C>A), RS1002298395 (5:55233854 G>A,C), RS1003713410 (5:55234980 A>G), RS1004276809 (5:55233742 G>A,T), RS1005251615 (5:55231046 C>T), RS1005422574 (5:55234925 T>C), RS1005930703 (5:55233633 A>G), RS1006324769 (5:55231156 G>C), RS1006403591 (5:55231996 T>C,G), RS1006446744 (5:55230844 C>T), RS1006522076 (5:55234533 C>T)
Disease associations
OMIM: gene MIM:607752 | disease phenotypes: MIM:244400, MIM:615872
GenCC curated gene-disease
| Disease | Classification | Inheritance |
|---|---|---|
| primary ciliary dyskinesia 29 | Definitive | Autosomal recessive |
| primary ciliary dyskinesia | Supportive | Autosomal dominant |
ClinGen Gene-Disease Validity (1)
Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.
| Disease | Classification | Inheritance |
|---|---|---|
| primary ciliary dyskinesia 29 | Definitive | AR |
Mondo (2): primary ciliary dyskinesia (MONDO:0016575), primary ciliary dyskinesia 29 (MONDO:0014378)
Orphanet (1): Primary ciliary dyskinesia (Orphanet:244)
HPO phenotypes
56 total (30 of 56 shown, HPO-id order):
| HPO | Term |
|---|---|
| HP:0000007 | Autosomal recessive inheritance |
| HP:0000119 | Abnormality of the genitourinary system |
| HP:0000238 | Hydrocephalus |
| HP:0000365 | Hearing impairment |
| HP:0000389 | Chronic otitis media |
| HP:0000403 | Recurrent otitis media |
| HP:0000405 | Conductive hearing impairment |
| HP:0000510 | Rod-cone dystrophy |
| HP:0000750 | Delayed speech and language development |
| HP:0000789 | Infertility |
| HP:0000924 | Abnormality of the skeletal system |
| HP:0001217 | Clubbing |
| HP:0001627 | Abnormal heart morphology |
| HP:0001669 | Transposition of the great arteries |
| HP:0001696 | Situs inversus totalis |
| HP:0001719 | Double outlet right ventricle |
| HP:0001742 | Nasal congestion |
| HP:0001746 | Asplenia |
| HP:0001748 | Polysplenia |
| HP:0002011 | Morphological central nervous system abnormality |
| HP:0002110 | Bronchiectasis |
| HP:0002119 | Ventriculomegaly |
| HP:0002205 | Recurrent respiratory infections |
| HP:0002257 | Chronic rhinitis |
| HP:0002566 | Intestinal malrotation |
| HP:0002643 | Neonatal respiratory distress |
| HP:0002878 | Respiratory failure |
| HP:0003251 | Male infertility |
| HP:0003676 | Progressive |
| HP:0004313 | Decreased circulating immunoglobulin concentration |
GWAS associations
1 associations (top):
| Study | Trait | p-value |
|---|---|---|
| GCST008399_7 | Cocaine dependence | 8.000000e-06 |
MeSH disease descriptors (2)
| Descriptor | Name | Tree numbers |
|---|---|---|
| D002925 | Ciliary Motility Disorders | C08.200; C09.150; C16.131.077.245.500; C16.320.184.500 |
| D007619 | Kartagener Syndrome | C08.127.384.500; C08.200.531; C08.695.501; C09.150.531; C14.240.400.280.500; C14.280.400.280.500; C16.131.077.245.500.531; C16.131.240.400.280.500; C16.131.740.501; C16.131.810.250.500; C16.320.184.500.531; C16.320.480 |
Drugs & pharmacology
Drug and pharmacology data
Is drug target: yes
ChEMBL targets (2): CHEMBL4105895 (SINGLE PROTEIN), CHEMBL4106152 (PROTEIN COMPLEX)
PharmGKB: 1 entry (VIP=true, CPIC=false)
ChEMBL bioactivities
10 potent at pChembl≥5 of 10 total, top 10 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).
| pChembl | Type | Value | Unit | Molecule |
|---|---|---|---|---|
| 8.84 | IC50 | 1.46 | nM | STAUROSPORINE |
| 8.83 | IC50 | 1.48 | nM | STAUROSPORINE |
| 8.82 | IC50 | 1.51 | nM | STAUROSPORINE |
| 8.81 | IC50 | 1.54 | nM | STAUROSPORINE |
| 8.76 | IC50 | 1.72 | nM | STAUROSPORINE |
| 7.48 | IC50 | 33.1 | nM | CHEMBL1708376 |
| 7.38 | IC50 | 41.6 | nM | CHEMBL4763182 |
| 6.97 | IC50 | 108 | nM | CHEMBL1906448 |
| 6.86 | IC50 | 138 | nM | CHEMBL4079206 |
| 5.22 | Kd | 6000 | nM | CHEMBL1213412 |
PubChem BioAssay actives
10 with measured affinity, of 28 total; 6 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.
| Compound | Assay | Type | Value | Unit |
|---|---|---|---|---|
| (2S,3R,4R,6R)-3-methoxy-2-methyl-4-(methylamino)-29-oxa-1,7,17-triazaoctacyclo[12.12.2.12,6.07,28.08,13.015,19.020,27.021,26]nonacosa-8,10,12,14,19,21,23,25,27-nonaen-16-one | 1612678: Inhibition of human CDK2/cyclin-O using histone H1 as substrate by [gamma-33P]-ATP assay | ic50 | 0.0015 | uM |
| 7-bromo-3,6,6-trimethyl-1-(1,3-thiazol-2-yl)-5,7-dihydroindazol-4-one | 1731528: Inhibition of CDK2/Cyclin-O (unknown origin) using histone H1 as substrate preincubated for 20 mins followed by 33P-ATP addition and measured after 2 hrs by filter binding method | ic50 | 0.0331 | uM |
| 7-bromo-3,6,6-trimethyl-1-pyrimidin-4-yl-5,7-dihydroindazol-4-one | 1731528: Inhibition of CDK2/Cyclin-O (unknown origin) using histone H1 as substrate preincubated for 20 mins followed by 33P-ATP addition and measured after 2 hrs by filter binding method | ic50 | 0.0416 | uM |
| 7-bromo-3,6,6-trimethyl-1-pyridin-2-yl-5,7-dihydroindazol-4-one | 1731528: Inhibition of CDK2/Cyclin-O (unknown origin) using histone H1 as substrate preincubated for 20 mins followed by 33P-ATP addition and measured after 2 hrs by filter binding method | ic50 | 0.1080 | uM |
| 2-[(E)-2-(2,6-dichlorophenyl)ethenyl]-5,7-dihydroxy-8-[(3S,4R)-3-hydroxy-1-methylpiperidin-4-yl]chromen-4-one | 1479306: Inhibition of CDK2/cyclin O (unknown origin) after 30 mins in presence of [33P]-gamma-ATP by filter binding assay | ic50 | 0.1380 | uM |
| 4-[(E)-2-[(E)-(2,4-dioxo-1H-pyrimidin-6-yl)methylideneamino]oxyethoxyiminomethyl]benzoic acid | 498726: Binding affinity to human uracil DNA glycosylase 2 | kd | 6.0000 | uM |
CTD chemical–gene interactions
36 total (human), top 30 by PubMed support.
| Chemical | Actions (top 5) | PubMed papers |
|---|---|---|
| sodium arsenite | decreases expression | 2 |
| Benzo(a)pyrene | increases expression, decreases methylation | 2 |
| Smoke | decreases expression, increases abundance, increases expression | 2 |
| methylmercuric chloride | increases expression | 1 |
| pirinixic acid | affects binding, decreases expression, increases activity | 1 |
| terbufos | increases methylation | 1 |
| potassium bromate | decreases expression | 1 |
| S-(1,2-dichlorovinyl)cysteine | affects response to substance, increases expression | 1 |
| pentabromodiphenyl ether | increases expression | 1 |
| CPG-oligonucleotide | increases expression | 1 |
| abrine | decreases expression | 1 |
| 2,2’,4,4’-tetrabromodiphenyl ether | increases expression | 1 |
| riccardin D | increases expression | 1 |
| Resveratrol | decreases expression, affects cotreatment | 1 |
| Decitabine | affects expression | 1 |
| Arsenic Trioxide | decreases response to substance | 1 |
| Acetaminophen | decreases expression | 1 |
| Air Pollutants | increases abundance, increases expression | 1 |
| Arsenic | increases methylation | 1 |
| Cisplatin | affects expression | 1 |
| Fonofos | increases methylation | 1 |
| Folic Acid | decreases expression | 1 |
| Hydrogen Peroxide | decreases expression | 1 |
| Lipopolysaccharides | affects response to substance, increases expression | 1 |
| Parathion | increases methylation | 1 |
| Plant Extracts | affects cotreatment, decreases expression | 1 |
| Silicon Dioxide | increases expression | 1 |
| Thiram | decreases expression | 1 |
| Tobacco Smoke Pollution | decreases expression | 1 |
| Tretinoin | increases expression | 1 |
ChEMBL screening assays
22 unique, capped per target: 22 binding
Representative assays (with source publication via chembl_document):
| Assay ID | Type | Description | Source paper |
|---|---|---|---|
| CHEMBL1220464 | Binding | Binding affinity to human uracil DNA glycosylase 2 | Impact of linker strain and flexibility in the design of a fragment-based inhibitor. — Nat Chem Biol |
Cellosaurus cell lines
5 cell lines: 3 induced pluripotent stem cell, 2 cancer cell line
First 10 cell lines (id-ordered, not curated):
| Cellosaurus | Name | Category | Sex |
|---|---|---|---|
| CVCL_A8KW | AMUFAHi001-A | Induced pluripotent stem cell | Female |
| CVCL_SH46 | HAP1 CCNO (-) 1 | Cancer cell line | Male |
| CVCL_SH47 | HAP1 CCNO (-) 2 | Cancer cell line | Male |
| CVCL_ZJ20 | MHHi016-A | Induced pluripotent stem cell | Male |
| CVCL_ZJ21 | MHHi016-B | Induced pluripotent stem cell | Male |
Clinical trials (associated diseases)
71 trials via MONDO — disease-level, not drug-specific.
| Trial | Phase | Status | Title |
|---|---|---|---|
| NCT02871778 | PHASE2 | COMPLETED | Clearing Lungs With ENaC Inhibition in Primary Ciliary Dyskinesia |
| NCT07318974 | PHASE2 | ACTIVE_NOT_RECRUITING | Melatonin Therapy for Improving ICSI Outcomes in Women With Diminished Ovarian Reserve |
| NCT05737485 | PHASE1 | COMPLETED | Study Evaluating the Safety and Tolerability of RCT1100 in Healthy and PCD Subjects |
| NCT06600425 | PHASE1 | COMPLETED | A Study to Assess the Safety, Tolerability, Ciliary Rescue, and Pharmacodynamics of RCT1100 in Adults With PCD |
| NCT06633757 | PHASE1 | COMPLETED | Study of Inhaled RCT1100 in Adults With PCD Caused by Pathogenic Mutations in the DNAI1 Gene to Measure Mucociliary Clearance |
| NCT04901715 | EARLY_PHASE1 | COMPLETED | Functional Studies of Novel Genes Mutated in Primary Ciliary Dyskinesia II: Genotype to Phenotype |
| NCT00005650 | Not specified | COMPLETED | Genetic Study of Patients With Primary Ciliary Dyskinesia |
| NCT00323167 | Not specified | COMPLETED | Rare Genetic Disorders of the Breathing Airways |
| NCT00368446 | Not specified | COMPLETED | Genetic Disorders of Mucociliary Clearance in Nontuberculous Mycobacterial Lung Disease |
| NCT00450918 | Not specified | COMPLETED | Evaluating Progression of and Diagnostic Tools for Primary Ciliary Dyskinesia in Children and Adolescents |
| NCT00608556 | Not specified | COMPLETED | Dyskinesia, Heterotaxy and Congenital Heart Disease |
| NCT00686309 | Not specified | UNKNOWN | Comparison of On-line and Off-line Measurements of Exhaled Nitric Oxide (NO) |
| NCT00722878 | Not specified | COMPLETED | Long-term Lung Function and Disease Progression in Children With Early Onset Primary Ciliary Dyskinesia Lung Disease |
| NCT00739817 | Not specified | UNKNOWN | Screening for Primary Ciliary Dyskinesia Using Nasal Nitric Oxide |
| NCT00783887 | Not specified | COMPLETED | Diagnosis of Primary Ciliary Dyskinesia |
| NCT00807482 | Not specified | RECRUITING | Pathogenesis of Primary Ciliary Dyskinesia (PCD) Lung Disease |
| NCT01070914 | Not specified | UNKNOWN | Early Detection and Characterization of Primary Ciliary Dyskinesia |
| NCT01155115 | Not specified | COMPLETED | Inflammatory and Microbiologic Markers in Sputum: Comparing Cystic Fibrosis With Primary Ciliary Dyskinesia |
| NCT01246258 | Not specified | COMPLETED | Otolith Function in Patients With Primary Ciliary Dyskinesia |
| NCT01929356 | Not specified | RECRUITING | Chest Physiotherapy and Lung Function in Primary Ciliary Dyskinesia |
| NCT02389049 | Not specified | COMPLETED | Genetics of Primary Ciliary Dyskinesia |
| NCT02419365 | Not specified | RECRUITING | International Primary Ciliary Dyskinesia (PCD) Registry |
| NCT02699177 | Not specified | UNKNOWN | In Vivo Measurements of Nasal Ciliary Beat Frequency by Using Interferometry |
| NCT02704455 | Not specified | NOT_YET_RECRUITING | Registry Study on Primary Ciliary Dyskinesia in Chinese Children |
| NCT03271840 | Not specified | COMPLETED | Registry for Primary Ciliary Dyskinesia |
| NCT03279965 | Not specified | UNKNOWN | MRI in Cystic Fibrosis and Primary Ciliary Dyskinesia |
| NCT03320382 | Not specified | UNKNOWN | Multiple Breath Washout, a Clinimetric Dataset |
| NCT03370029 | Not specified | COMPLETED | Respiratory Muscle Strength, Exercise Capacity and Physical Activity Levels in Children Primary Ciliary Dyskinesia |
| NCT03494894 | Not specified | COMPLETED | Bacteriological Link Between Upper and Lower Airways in Cystic Fibrosis and Primary Ciliary Dyskinesia |
| NCT03517865 | Not specified | ACTIVE_NOT_RECRUITING | International Primary Ciliary Dyskinesia Cohort |
| NCT03606200 | Not specified | RECRUITING | Swiss Primary Ciliary Dyskinesia Registry |
| NCT03704207 | Not specified | RECRUITING | Utility of PCD Diagnostics to Improve Clinical Care |
| NCT03704896 | Not specified | UNKNOWN | PRospective Observational Multicentre Study on VAriability of Lung Function in Stable PCD Patients |
| NCT03801395 | Not specified | COMPLETED | PCD New Gene Discovery |
| NCT03809091 | Not specified | UNKNOWN | WGS of Korean Idiopathic Bronchiectasis |
| NCT03832491 | Not specified | COMPLETED | Effect of Game Based Approach on Oxygenation, Functional Capacity and Quality of Life in Primary Ciliary Dyskinesia |
| NCT04161313 | Not specified | COMPLETED | Respiratory Function, Exercise Capacity and Peripheral Muscle Strength Among Patients With CF, PCD and Healthy Children |
| NCT04476433 | Not specified | COMPLETED | Intervention in Chronic Pediatric Patients and Their Families. |
| NCT04489472 | Not specified | UNKNOWN | The Effect of a Dietary Supplement Rich in Nitric Oxide in Patients Diagnosed With Primary Ciliary Dyskinesia. |
| NCT04602481 | Not specified | RECRUITING | Living With Primary Ciliary Dyskinesia (Living With PCD) |
Related Atlas pages
- Associated diseases: primary ciliary dyskinesia 29, primary ciliary dyskinesia
- Disease cohort memberships (association, not causation — diseases whose associated-gene cohort lists this gene; a subset are also under Associated diseases): cocaine dependence, primary ciliary dyskinesia, primary ciliary dyskinesia 29