CDK10

Summary

CDK10 (cyclin dependent kinase 10, HGNC:1770) is a protein-coding gene on chromosome 16q24.3, encoding Cyclin-dependent kinase 10 (Q15131). Cyclin-dependent kinase that phosphorylates the transcription factor ETS2 (in vitro) and positively controls its proteasomal degradation (in cells).

The protein encoded by this gene belongs to the CDK subfamily of the Ser/Thr protein kinase family. The CDK subfamily members are highly similar to the gene products of S. cerevisiae cdc28, and S. pombe cdc2, and are known to be essential for cell cycle progression. This kinase has been shown to play a role in cellular proliferation and its function is limited to cell cycle G2-M phase. Multiple transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 8558 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Al Kaissi syndrome (Strong, GenCC)
• GWAS associations: 10
• Clinical variants (ClinVar): 195 total — 14 pathogenic, 13 likely-pathogenic
• GTEx eGene: eQTL in 50 tissues, sQTL in 40 (q < 0.05)
• Phenotypes (HPO): 56
• ChEMBL bioactivity: 3 clinical-phase molecules tested; no curated mechanism-of-action drug
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.34 (unconstrained)
• MANE Select transcript: NM_052988

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:1770
Approved symbol	CDK10
Name	cyclin dependent kinase 10
Location	16q24.3
Locus type	gene with protein product
Status	Approved
Aliases	PISSLRE
Ensembl gene	ENSG00000185324
Ensembl biotype	protein_coding
OMIM	603464
Entrez	8558

Gene structure

Transcript identifiers

Ensembl transcripts: 90 — 61 nonsense_mediated_decay, 19 protein_coding, 8 retained_intron, 2 protein_coding_CDS_not_defined

MANE Select: ENST00000353379

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 2, TSL 2: 7, TSL 3: 7, TSL 4: 1, TSL 5: 3

ENST00000353379, ENST00000331006, ENST00000378277, ENST00000472018, ENST00000502547, ENST00000503560, ENST00000504473, ENST00000505473, ENST00000505733, ENST00000507205, ENST00000508723, ENST00000510811, ENST00000511415, ENST00000512912, ENST00000514965, ENST00000561477, ENST00000564192, ENST00000565470, ENST00000567932, ENST00000568456, ENST00000851880, ENST00000851881, ENST00000851882, ENST00000851883, ENST00000851884, ENST00000941355, ENST00000992173, ENST00000992174, ENST00000992175, ENST00000992176, ENST00000992177, ENST00000992178, ENST00000992179, ENST00000992180, ENST00000992181, ENST00000992182, ENST00000992183, ENST00000992184, ENST00000992185, ENST00000992186, ENST00000992187, ENST00000992188, ENST00000992189, ENST00000992190, ENST00000992192, ENST00000992193, ENST00000992194, ENST00001032504, ENST00001032505, ENST00001032506, ENST00001032507, ENST00001032508, ENST00001032509, ENST00001032510, ENST00001032511, ENST00001032512, ENST00001032513, ENST00001032514, ENST00001032515, ENST00001032516, ENST00001032517, ENST00001032518, ENST00001032519, ENST00001032520, ENST00001032521, ENST00001032522, ENST00001032523, ENST00001032524, ENST00001032525, ENST00001032526, ENST00001032527, ENST00001032528, ENST00001032529, ENST00001032530, ENST00001032531, ENST00001085505, ENST00001085506, ENST00001085507, ENST00001085508, ENST00001085509, ENST00001085510, ENST00001085511, ENST00001085512, ENST00001085513, ENST00001085514, ENST00001085515, ENST00001085516, ENST00001097711, ENST00001106811, ENST00001112317

RefSeq mRNA: 4 — MANE Select: NM_052988 NM_001098533, NM_001160367, NM_052987, NM_052988

CCDS: CCDS10984, CCDS32514

Canonical transcript exons

ENST00000353379 — 13 exons

Exon	Start	End
ENSE00001813668	89695595	89696354
ENSE00002415535	89686689	89686797
ENSE00003501712	89694173	89694232
ENSE00003523308	89691443	89691545
ENSE00003545643	89691806	89691887
ENSE00003574345	89694665	89694788
ENSE00003592590	89695293	89695345
ENSE00003595012	89690553	89690624
ENSE00003602207	89689252	89689324
ENSE00003616794	89694931	89695070
ENSE00003629008	89693274	89693326
ENSE00003649319	89693398	89693467
ENSE00003661383	89692449	89692516

Expression profiles

Bgee: expression breadth ubiquitous, 286 present calls, max score 98.78.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 17.5845 / max 141.9341, expressed in 1740 samples.

Highest expression (Bgee): uterine tube, lobe of thyroid gland, adenohypophysis, body of pancreas, metanephros cortex.

Genetic regulation across tissues (GTEx eQTL / sQTL)

CDK10 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 50 tissues and its splicing (sQTL) in 40 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 90 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Whole Blood	eqtl	7.3e-123	-0.75	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Artery Tibial	eqtl	3.4e-96	-1.05	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Nerve Tibial	eqtl	2.8e-89	-1.00	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Muscle Skeletal	eqtl	2.2e-86	-0.83	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Cells Cultured fibroblasts	eqtl	4.5e-77	-1.23	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Adipose Subcutaneous	eqtl	6.0e-74	-0.92	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Esophagus Muscularis	eqtl	1.9e-73	-0.92	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Skin Sun Exposed Lower leg	eqtl	5.2e-71	-0.77	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Thyroid	eqtl	2.3e-69	-0.38	16:89688036:G:T
Adipose Visceral Omentum	eqtl	1.8e-68	-0.92	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Artery Aorta	eqtl	7.7e-63	-1.00	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Esophagus Mucosa	eqtl	4.1e-62	-0.70	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Skin Not Sun Exposed Suprapubic	eqtl	8.4e-62	-0.77	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Esophagus Gastroesophageal Junction	eqtl	8.9e-59	-1.11	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Lung	eqtl	3.7e-56	-0.38	16:89682328:G:A
Heart Atrial Appendage	eqtl	6.2e-53	-0.82	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Heart Left Ventricle	eqtl	4.7e-48	-0.70	16:89686659:GGGCCGTCCGCGTCTGCGCCTGCGCGCAAGAGA:G
Colon Sigmoid	eqtl	1.2e-46	-0.92	16:89641859:C:T
Breast Mammary Tissue	eqtl	2.2e-45	+0.46	16:89691317:A:G
Testis	eqtl	2.0e-40	-0.42	16:89688036:G:T

FANTOM5 promoters

2 alternative TSS:

Promoter ID	TPM avg	Samples expressed
155633	17.5392	1738
155634	0.0453	21

Top tissues by expression

showing 100 of 291 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right uterine tube	UBERON:0001302	98.78	gold quality
right lobe of thyroid gland	UBERON:0001119	98.62	gold quality
left lobe of thyroid gland	UBERON:0001120	98.48	gold quality
adenohypophysis	UBERON:0002196	98.32	gold quality
body of pancreas	UBERON:0001150	98.14	gold quality
metanephros cortex	UBERON:0010533	97.92	gold quality
right lobe of liver	UBERON:0001114	97.85	gold quality
granulocyte	CL:0000094	97.76	gold quality
thyroid gland	UBERON:0002046	97.74	gold quality
mucosa of transverse colon	UBERON:0004991	97.65	gold quality
small intestine Peyer’s patch	UBERON:0003454	97.59	gold quality
transverse colon	UBERON:0001157	97.49	gold quality
pituitary gland	UBERON:0000007	97.41	gold quality
apex of heart	UBERON:0002098	97.35	gold quality
right hemisphere of cerebellum	UBERON:0014890	97.29	gold quality
body of stomach	UBERON:0001161	97.27	gold quality
lower esophagus mucosa	UBERON:0035834	97.20	gold quality
endocervix	UBERON:0000458	97.09	gold quality
right frontal lobe	UBERON:0002810	97.01	gold quality
left ovary	UBERON:0002119	96.86	gold quality
right adrenal gland cortex	UBERON:0035827	96.83	gold quality
right ovary	UBERON:0002118	96.81	gold quality
skin of abdomen	UBERON:0001416	96.76	gold quality
right adrenal gland	UBERON:0001233	96.75	gold quality
cerebellar hemisphere	UBERON:0002245	96.68	gold quality
body of uterus	UBERON:0009853	96.61	gold quality
cerebellar cortex	UBERON:0002129	96.52	gold quality
minor salivary gland	UBERON:0001830	96.51	gold quality
upper lobe of left lung	UBERON:0008952	96.45	gold quality
left adrenal gland cortex	UBERON:0035825	96.32	gold quality
left adrenal gland	UBERON:0001234	96.27	gold quality
skin of leg	UBERON:0001511	96.16	gold quality
right lung	UBERON:0002167	96.12	gold quality
spleen	UBERON:0002106	96.08	gold quality
small intestine	UBERON:0002108	96.01	gold quality
left testis	UBERON:0004533	95.91	gold quality
right testis	UBERON:0004534	95.91	gold quality
muscle layer of sigmoid colon	UBERON:0035805	95.81	gold quality
adrenal cortex	UBERON:0001235	95.79	gold quality
ectocervix	UBERON:0012249	95.63	gold quality
esophagus mucosa	UBERON:0002469	95.61	gold quality
stomach	UBERON:0000945	95.56	gold quality
nucleus accumbens	UBERON:0001882	95.53	gold quality
left uterine tube	UBERON:0001303	95.50	gold quality
upper lobe of lung	UBERON:0008948	95.50	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	95.49	gold quality
tibial nerve	UBERON:0001323	95.43	gold quality
omental fat pad	UBERON:0010414	95.41	gold quality
lower esophagus muscularis layer	UBERON:0035833	95.39	gold quality
lower esophagus	UBERON:0013473	95.38	gold quality
peritoneum	UBERON:0002358	95.37	gold quality
fundus of stomach	UBERON:0001160	95.30	gold quality
esophagus	UBERON:0001043	95.21	gold quality
stromal cell of endometrium	CL:0002255	95.00	gold quality
adrenal gland	UBERON:0002369	95.00	gold quality
endometrium epithelium	UBERON:0004811	94.96	gold quality
gall bladder	UBERON:0002110	94.86	gold quality
saliva-secreting gland	UBERON:0001044	94.62	gold quality
rectum	UBERON:0001052	94.61	gold quality
cingulate cortex	UBERON:0003027	94.61	gold quality
mouth mucosa	UBERON:0003729	94.55	gold quality
Brodmann (1909) area 9	UBERON:0013540	94.54	gold quality
anterior cingulate cortex	UBERON:0009835	94.48	gold quality
cerebellum	UBERON:0002037	94.46	gold quality
left coronary artery	UBERON:0001626	94.44	gold quality
tendon of biceps brachii	UBERON:0008188	94.43	gold quality
right coronary artery	UBERON:0001625	94.40	gold quality
vagina	UBERON:0000996	94.35	gold quality
adipose tissue of abdominal region	UBERON:0007808	94.31	gold quality
amygdala	UBERON:0001876	94.22	gold quality
right atrium auricular region	UBERON:0006631	94.17	gold quality
putamen	UBERON:0001874	94.09	gold quality
coronary artery	UBERON:0001621	94.08	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	94.02	gold quality
caudate nucleus	UBERON:0001873	93.94	gold quality
lymph node	UBERON:0000029	93.92	gold quality
pancreas	UBERON:0001264	93.91	gold quality
ascending aorta	UBERON:0001496	93.91	gold quality
thoracic aorta	UBERON:0001515	93.88	gold quality
descending thoracic aorta	UBERON:0002345	93.61	gold quality
sural nerve	UBERON:0015488	93.57	gold quality
intestine	UBERON:0000160	93.52	gold quality
colon	UBERON:0001155	93.41	gold quality
zone of skin	UBERON:0000014	93.16	gold quality
aorta	UBERON:0000947	93.12	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	93.08	gold quality
ovary	UBERON:0000992	92.96	gold quality
large intestine	UBERON:0000059	92.83	gold quality
prostate gland	UBERON:0002367	92.80	gold quality
popliteal artery	UBERON:0002250	92.63	gold quality
tibial artery	UBERON:0007610	92.63	gold quality
mucosa of stomach	UBERON:0001199	92.62	gold quality
testis	UBERON:0000473	92.58	gold quality
subcutaneous adipose tissue	UBERON:0002190	92.42	gold quality
sigmoid colon	UBERON:0001159	92.39	gold quality
adrenal tissue	UBERON:0018303	92.32	gold quality
cardiac atrium	UBERON:0002081	92.18	gold quality
heart left ventricle	UBERON:0002084	92.15	gold quality
vermiform appendix	UBERON:0001154	92.03	gold quality
adult mammalian kidney	UBERON:0000082	91.84	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	6.20

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 80 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Putamen	tissue	66.2
Cerebral cortex	tissue	59.7	medium
Somatosensory cortex	tissue	59.7
Basal ganglia	tissue	58.6	high
Insular cortex	tissue	55.9
Motor cortex	tissue	55.1
Frontal cortex	tissue	54.2
Occipital cortex	tissue	54.0
Prefrontal cortex	tissue	51.5
Ventral forebrain	tissue	50.5
Pituitary gland	tissue	49.4
Retrosplenial and cingulate cortex	tissue	48.4
Temporal cortex	tissue	48.4
Retrosplenial cortex	tissue	47.4
Hippocampal formation	tissue	44.8
Entorhinal cortex	tissue	44.8
Corpus callosum	tissue	41.5
Amygdala	tissue	40.1
Midbrain	tissue	37.9
Superior colliculi	tissue	37.6
Medulla oblongata	tissue	36.8
Caudate putamen	tissue	36.4
Cerebellum	tissue	36.3	not detected
Spinal cord	tissue	36.3
Septum	tissue	36.3
Thalamus	tissue	35.6
Pons	tissue	35.4
Periaqueductal gray	tissue	35.2
Vagina	tissue	35.0	low
Substantia nigra	tissue	33.7
Olfactory bulb	tissue	31.8
Hypothalamus	tissue	29.8
Liver	tissue	23.8	high
Duodenum	tissue	21.3	medium
Small intestine	tissue	19.4	medium
Pancreas	tissue	19.0	medium
Kidney	tissue	19.0	medium
Choroid plexus	tissue	18.5
Thyroid gland	tissue	18.5	high
Bone marrow	tissue	18.4	medium
Adrenal gland	tissue	17.9	high
Stomach 1	tissue	17.1	medium
Skeletal muscle	tissue	16.6	low
Salivary gland	tissue	15.1	low
Lymph node	tissue	13.7	medium
Spleen	tissue	13.3	medium
Skin 1	tissue	13.2	medium
Colon	tissue	12.7	high
Parathyroid gland	tissue	12.6	medium
Hippocampus	tissue	12.6	medium
Fallopian tube	tissue	12.3	medium
Placenta	tissue	11.8	not detected
Adipose tissue	tissue	10.8	medium
Rectum	tissue	10.6	high
Postcentral gyrus	tissue	10.4
Nucleus accumbens	tissue	10.3
Lung	tissue	10.2	medium
Prostate	tissue	10.2	medium
Thymus	tissue	10.0
Appendix	tissue	9.9	medium

Brain sub-regions (HPA Brain Atlas): detected in 191; highest nTPM — Dorsal hippocampus (44.7), Ventral hippocampus (43.9), Subiculum (41.5), White matter (41.5), Ventral spinal cord (36.3).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting CDK10 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

11 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-10401-5P	99.99	65.79	948
HSA-MIR-4697-3P	99.89	67.09	1123
HSA-MIR-7106-5P	99.53	67.47	3574
HSA-MIR-208A-5P	99.42	70.83	1913
HSA-MIR-208B-5P	99.42	70.83	1952
HSA-MIR-7977	98.65	66.18	2590
HSA-MIR-3127-5P	97.52	65.24	786
HSA-MIR-194-3P	97.36	65.96	1027
HSA-MIR-939-5P	97.10	65.80	1579
HSA-MIR-7847-3P	96.63	64.58	952
HSA-MIR-1343-5P	96.48	66.06	1506

Functional genomics

gnomAD constraint: pLI 1.89e-20, LOEUF 1.34, missense Z -1.88 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000353379 — one region, missense o/e 1.21.

Literature-anchored findings (GeneRIF, showing 23)

• CDK10 is not a target for aberrant DNA methylation in breast cancer. (PMID:19846932)
• Data show that peptidyl-prolyl isomerase Pin1 silencing in SKBR-3 and MCF7 cells increased the cyclin-dependent kinase 10 (CDK10) expression. (PMID:22158035)
• CDK10 plays a crucial role in the growth and survivability of biliary tract cancer. (PMID:22209942)
• reduced Cdk10 expression is closely linked to hepatocellular carcinoma development and progression (PMID:22326270)
• Data suggest that reactivation of CDK10 might be utilized as a novel epigenetic strategy for the treatment of nasopharyngeal carcinomas (NPC) patients. (PMID:23740091)
• CDK10/cyclin M is a protein kinase that controls ETS2 degradation and is deficient in STAR syndrome. (PMID:24218572)
• Results found that CDK10 mRNA expression was up-regulated in advanced breast neoplasm and positively correlated with C1orf63, which was consistent with the relationship of protein expression between C1orf63 and CDK10. (PMID:26209438)
• Down-regulated CDK10 expression frequently occurs in breast cancers and correlates with disease progression and poor survival (PMID:26392360)
• CDK10/CycM is a key regulator of actin dynamics and a suppressor of ciliogenesis through phosphorylation of PKN2 and promotion of RhoA signaling. (PMID:27104747)
• The findings of this study indicate that CDK10 plays a role in the pathogenesis in colorectal cancer and may be a potential therapeutic target for treatment. (PMID:28663269)
• CDK10 Mutations are associated with Severe Growth Retardation, Spine Malformations, and Developmental Delays. (PMID:28886341)
• These findings underscore the importance of CDK10 for the regulation of ciliogenesis. CDK10 defect is likely associated with a new form of ciliopathy phenotype; additional patients may further validate this association (PMID:29130579)
• the results of the present study indicated that CDK10 expression may serve as a novel prognostic biomarker that holds therapeutic promise for gastric cancer. (PMID:29512714)
• The present study illustrated that downregulation of CDK10 expression activated Snaildriven EMT and consequently promoted glioma metastasis, suggesting that CDK10 may serve as a potential molecular target for glioma therapy. (PMID:29845196)
• Association of Cyclin Dependent Kinase 10 and Transcription Factor 2 during Human Corneal Epithelial Wound Healing in vitro model. (PMID:31413335)
• Gene expression network analysis of lymph node involvement in colon cancer identifies AHSA2, CDK10, and CWC22 as possible prognostic markers. (PMID:32345988)
• Functional characterization of CDK10 and cyclin M truncated variants causing severe developmental disorders. (PMID:34369103)
• A large Canadian cohort provides insights into the genetic architecture of human hair colour. (PMID:34737440)
• Functional characterization of the human Cdk10/Cyclin Q complex. (PMID:35291876)
• A sib-pair with Al Kaissi syndrome caused by homozygosity for a novel CDK10 splice variant. (PMID:36503922)
• CDK10, CDK11, FOXO1, and FOXO3 Gene Expression in Alzheimer’s Disease Encephalic Samples. (PMID:36988771)
• CDK10 suppresses metastasis of lung adenocarcinoma through inhibition of the ETS2/c-Raf/p-MEK/p-ERK signaling loop. (PMID:37737453)
• RNF115 aggravates tumor progression through regulation of CDK10 degradation in thyroid carcinoma. (PMID:38376606)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	cdk10	ENSDARG00000034256
mus_musculus	Cdk10	ENSMUSG00000033862
rattus_norvegicus	Cdk10	ENSRNOG00000016088
drosophila_melanogaster	Cdc2rk	FBGN0013435

Paralogs (26): CDKL3 (ENSG00000006837), CDKL5 (ENSG00000008086), CDK11A (ENSG00000008128), CDK14 (ENSG00000058091), CDK17 (ENSG00000059758), CDK13 (ENSG00000065883), CDKL1 (ENSG00000100490), CDK16 (ENSG00000102225), CDK6 (ENSG00000105810), PRP4K (ENSG00000112739), CDK18 (ENSG00000117266), CDK2 (ENSG00000123374), CDK8 (ENSG00000132964), CDK7 (ENSG00000134058), CDK4 (ENSG00000135446), CDK9 (ENSG00000136807), CDK15 (ENSG00000138395), CDKL2 (ENSG00000138769), CDK19 (ENSG00000155111), CDK20 (ENSG00000156345), CDK5 (ENSG00000164885), CDK12 (ENSG00000167258), CDK1 (ENSG00000170312), CDKL4 (ENSG00000205111), CDK11B (ENSG00000248333), CDK3 (ENSG00000250506)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:2448549) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 21 distinct phenotype terms.

Mouse phenotype (MP)	Records
abnormal heart morphology	1
mandible hypoplasia	1
abnormal liver morphology	1
abnormal spleen morphology	1
thick pulmonary interalveolar septum	1
postnatal growth retardation	1
abnormal muscle morphology	1
abnormal kidney morphology	1
abnormal bronchiole morphology	1
abnormal renal tubule morphology	1
short femur	1
renal tubular necrosis	1
fetal growth retardation	1
abnormal renal tubule epithelium morphology	1
split cervical atlas	1
split cervical axis	1
absent odontoid process	1
primary atelectasis	1
perinatal lethality, incomplete penetrance	1
renal tubule atrophy	1
decreased bone mineralization	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Oryza sativa Indica Group	A2XUW1	100.0%	Diamond
Ovis aries	B2MVY4	100.0%	Diamond
Bos taurus	Q32KY4	100.0%	Diamond
Oryza sativa Japonica Group	Q7XUF4	100.0%	Diamond
Sus scrofa	P79432	99.0%	Diamond
Xenopus laevis	Q4V862	97.9%	Diamond
Xenopus tropicalis	Q6GLD8	97.9%	Diamond
Gallus gallus	Q5ZKN1	94.9%	Diamond
Ailuropoda melanoleuca	D2H526	92.5%	Diamond
Lathyrus oleraceus	P28567	90.8%	Diamond
Arabidopsis thaliana	Q8W4P1	89.4%	Diamond
Aspergillus fumigatus Af293	Q4WTN5	87.2%	Diamond
Aspergillus nidulans FGSC A4	Q96VK3	87.2%	Diamond
Carassius auratus	P51953	84.1%	Diamond
Caenorhabditis briggsae	P0C661	80.6%	Diamond
Caenorhabditis elegans	P90866	79.0%	Diamond
Fusarium verticillioides	Q4FCZ5	78.1%	Diamond
Pyricularia oryzae 70-15	A4QXX4	73.0%	Diamond
Saccharomyces cerevisiae S288C	P23293	72.2%	Diamond
Eremothecium gossypii ATCC 10895	Q75D46	70.0%	Diamond
Kluyveromyces lactis NRRL Y-1140	Q6CRA9	68.6%	Diamond
Debaryomyces hansenii CBS767	Q6BV06	68.2%	Diamond
Candida albicans SC5314	Q9Y7W4	68.2%	Diamond
Neurospora crassa OR74A	Q871M9	67.7%	Diamond
Fusarium graminearum PH-1	Q4I5U9	67.6%	Diamond
Dictyostelium discoideum	Q54RB2	57.3%	Diamond
Suid herpesvirus 1 strain Kaplan	P17613	95.5%	Diamond
Suid herpesvirus 1 (strain NIA-3)	P24381	95.5%	Diamond
Human herpesvirus 2 strain HG52	P13287	73.8%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
LINC02166	ncRNA	105371416
SPATA2L	protein-coding	124044
FANCA	protein-coding	2175
SPIRE2	protein-coding	84501
ZNF276	protein-coding	92822
VPS9D1	protein-coding	9605
VPS9D1-AS1	ncRNA	100128881
SPATA33	protein-coding	124045
CHMP1A	protein-coding	5119
DPEP1	protein-coding	1800
CPNE7	protein-coding	27132

Protein

Protein identifiers

Cyclin-dependent kinase 10 — Q15131 (reviewed: Q15131)

Alternative names: Cell division protein kinase 10, Serine/threonine-protein kinase PISSLRE

All UniProt accessions (8): D6RA59, D6REZ2, D6RHH3, Q15131, F8W872, H3BSN8, H3BT74, Q9UHL7

UniProt curated annotations — full annotation on UniProt →

Function. Cyclin-dependent kinase that phosphorylates the transcription factor ETS2 (in vitro) and positively controls its proteasomal degradation (in cells). Involved in the regulation of actin cytoskeleton organization through the phosphorylation of actin dynamics regulators such as PKN2. Is a negative regulator of ciliogenesis through phosphorylation of PKN2 and promotion of RhoA signaling.

Subunit / interactions. Heterodimer with CCNQ, the interaction is required for kinase activity. Interacts with ETS2. Interacts with PRK2.

Subcellular location. Cytoplasm. Cytoskeleton. Cilium basal body.

Disease relevance. Al Kaissi syndrome (ALKAS) [MIM:617694] An autosomal recessive developmental disorder characterized by growth retardation, spine malformation, facial dysmorphisms, and developmental delay. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the protein kinase superfamily. CMGC Ser/Thr protein kinase family. CDC2/CDKX subfamily.

Isoforms (7)

UniProt ID	Names	Canonical?
Q15131-1	1	yes
Q15131-2	2
Q15131-3	3
Q15131-4	4
Q15131-5	5
Q15131-6	6
Q15131-7	7

RefSeq proteins (4): NP_001092003, NP_001153839, NP_443713, NP_443714* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000719	Prot_kinase_dom	Domain
IPR008271	Ser/Thr_kinase_AS	Active_site
IPR011009	Kinase-like_dom_sf	Homologous_superfamily
IPR017441	Protein_kinase_ATP_BS	Binding_site
IPR044093	STKc_CDK10	Domain
IPR050108	CDK	Family

Pfam: PF00069

Enzyme classification (BRENDA)

• EC 2.7.11.22 — cyclin-dependent kinase (BRENDA: 49 organisms, 441 substrates, 555 inhibitors, 8 Km, 4 kcat entries)

Substrate kinetics (BRENDA)

4 substrates with measured Km, best-characterized 4. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
ADAQHATPPKKKRKVEDPKDF	0.046–0.521	2
ATP	0.0052–0.017	2
FIN1	0.003	1
PKTPKKAKKL	0.0029	1

Catalyzed reactions (Rhea)

• L-seryl-[protein] + ATP = O-phospho-L-seryl-[protein] + ADP + H(+) (RHEA:17989)
• L-threonyl-[protein] + ATP = O-phospho-L-threonyl-[protein] + ADP + H(+) (RHEA:46608)

UniProt features (19 total): splice variant 8, sequence variant 4, binding site 2, chain 1, domain 1, region of interest 1, active site 1, modified residue 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q15131-F1	86.27	0.62

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Transferases, Kinases, CMGC Ser/Thr protein kinases, Predicted intracellular proteins, Disease related genes, Potential drug targets, Human disease related genes, Congenital malformations, Other congenital malformations

Protein evidence: Evidence at protein level

Antibody reliability (HPA): IH uncertain

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
163	proton acceptor

Ligand- & substrate-binding residues (2)

Position	Role
45–53	ATP
68	ATP

Post-translational modifications (1)

Type	Positions
Phosphothreonine	196

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 0; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

MSigDB gene sets: 271 (showing top): GOBP_CELL_CYCLE_PHASE_TRANSITION, GOBP_POSITIVE_REGULATION_OF_MITOTIC_CELL_CYCLE, GOBP_POSITIVE_REGULATION_OF_MAPK_CASCADE, WEIGEL_OXIDATIVE_STRESS_BY_TBH_AND_H2O2, GOBP_REGULATION_OF_CELLULAR_COMPONENT_BIOGENESIS, GOCC_MICROTUBULE_ORGANIZING_CENTER, GOBP_POSITIVE_REGULATION_OF_G1_S_TRANSITION_OF_MITOTIC_CELL_CYCLE, GOBP_NEGATIVE_REGULATION_OF_ORGANELLE_ASSEMBLY, GOBP_NEGATIVE_REGULATION_OF_CELLULAR_COMPONENT_ORGANIZATION, GOBP_REGULATION_OF_ACTIN_FILAMENT_BASED_PROCESS, GOBP_REGULATION_OF_CELL_CYCLE_G2_M_PHASE_TRANSITION, NIKOLSKY_BREAST_CANCER_16Q24_AMPLICON, GOBP_REGULATION_OF_CELL_PROJECTION_ORGANIZATION, BLALOCK_ALZHEIMERS_DISEASE_UP, GOBP_CILIUM_ORGANIZATION

GO Biological Process (10): G2/M transition of mitotic cell cycle (GO:0000086), traversing start control point of mitotic cell cycle (GO:0007089), negative regulation of cell population proliferation (GO:0008285), peptidyl-threonine phosphorylation (GO:0018107), cell projection organization (GO:0030030), regulation of actin cytoskeleton organization (GO:0032956), negative regulation of cilium assembly (GO:1902018), regulation of cell cycle G2/M phase transition (GO:1902749), protein phosphorylation (GO:0006468), regulation of mitotic cell cycle (GO:0007346)

GO Molecular Function (10): protein serine/threonine kinase activity (GO:0004674), cyclin-dependent protein serine/threonine kinase activity (GO:0004693), ATP binding (GO:0005524), protein serine kinase activity (GO:0106310), nucleotide binding (GO:0000166), protein kinase activity (GO:0004672), protein binding (GO:0005515), kinase activity (GO:0016301), transferase activity (GO:0016740), cyclin-dependent protein kinase activity (GO:0097472)

GO Cellular Component (2): nucleus (GO:0005634), ciliary basal body (GO:0036064)

GO top-level categories

38 GO namespaces:

Category	Terms
protein kinase activity	3
mitotic cell cycle	2
cell cycle G2/M phase transition	2
regulation of cell cycle	2
mitotic cell cycle phase transition	1
positive regulation of G1/S transition of mitotic cell cycle	1
cell population proliferation	1
regulation of cell population proliferation	1
negative regulation of cellular process	1
protein phosphorylation	1
cellular component organization	1
actin cytoskeleton organization	1
regulation of actin filament-based process	1
regulation of cytoskeleton organization	1
cilium assembly	1
negative regulation of plasma membrane bounded cell projection assembly	1
regulation of cilium assembly	1
negative regulation of organelle assembly	1
regulation of cell cycle phase transition	1
phosphorylation	1
protein modification process	1
protein serine/threonine kinase activity	1
cyclin-dependent protein kinase activity	1
adenyl ribonucleotide binding	1
purine ribonucleoside triphosphate binding	1
anion binding	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
kinase activity	1
phosphotransferase activity, alcohol group as acceptor	1
catalytic activity, acting on a protein	1
binding	1
transferase activity, transferring phosphorus-containing groups	1
catalytic activity	1
cyclin binding	1
intracellular membrane-bounded organelle	1
microtubule organizing center	1
cilium	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 7 of 22 annotations. The rest are phylogenetic / computational / electronic (IEA).

7 experimentally-supported GO terms:

GO term	NS	Evidence
negative regulation of cilium assembly	BP	mutant phenotype
peptidyl-threonine phosphorylation	BP	direct assay
regulation of actin cytoskeleton organization	BP	mutant phenotype
regulation of cell cycle G2/M phase transition	BP	direct assay
ciliary basal body	CC	direct assay
nucleus	CC	direct assay
protein serine/threonine kinase activity	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 838 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CDK10	ZNF276	Q8N554	773
CDK10	GALNS	P34059	738
CDK10	SPG7	Q9UQ90	694
CDK10	CCNQ	Q8N1B3	629
CDK10	APRT	P07741	552
CDK10	FANCA	O15360	529
CDK10	CCNL2	Q96S94	523
CDK10	CCNK	O75909	508
CDK10	DEF8	Q6ZN54	501
CDK10	CCNL1	Q9UK58	492
CDK10	SPATA33	Q96N06	491
CDK10	CCNC	P24863	483
CDK10	ETS2	P15036	470
CDK10	DBNDD1	Q9H9R9	439
CDK10	PRPF3	O43395	424

IntAct

Human interaction partners of CDK10 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

9 partners by confidence:

Partner	Interaction type	MIscore	Records
HSP90AB1	physical association	0.640	2
PIN1	physical association	0.590	5
ETS2	physical association	0.520	2
HSPA8	association	0.500	2
CCNQ	physical association	0.400	1
CCT2	physical association	0.400	1
SEMG2	physical association	0.400	1
CCR4	physical association	0.370	1
PDCD5	association	0.350	1

BioGRID (69 interactions; top human partners by supporting records): ETS2 (Two-hybrid; 4 records), PIN1 (Reconstituted Complex; 3 records), ACTA2 (Affinity Capture-MS; 2 records), ACTBL2 (Affinity Capture-MS; 2 records), CCT2 (Affinity Capture-MS; 2 records), HSPA8 (Affinity Capture-MS; 2 records), TTC14 (Affinity Capture-MS; 2 records), ACTB (Affinity Capture-MS), AFF3 (Affinity Capture-MS), C2CD5 (Affinity Capture-MS), CABLES1 (Affinity Capture-MS), CABLES2 (Affinity Capture-MS), CACYBP (Affinity Capture-MS), CCNA2 (Affinity Capture-MS), CCNE2 (Affinity Capture-MS)

SIGNOR signaling

showing 1 of 2 signaling interactions:

A	Effect	B	Mechanism
CDK10	“down-regulates quantity by destabilization”	ETS2	phosphorylation

Protein complexes (CORUM) (1)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

1 complexes by size:

Complex	Subunits	Members
CCNQ-CDK10 complex	2	CCNQ, CDK10

Disease & clinical

Genetic variants

Variant evidence for CDK10: 195 ClinVar records (27 pathogenic / likely pathogenic); 10 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

195 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	14
Likely pathogenic	13
Uncertain significance	100
Likely benign	31
Benign	4

Top pathogenic / likely-pathogenic (15)

Showing the 15 best-reviewed of 27 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
440757	NM_052988.5(CDK10):c.608+1G>A	Pathogenic	criteria provided, multiple submitters, no conflicts	6
916087	NM_052988.5(CDK10):c.664_665del (p.Met222fs)	Pathogenic	criteria provided, multiple submitters, no conflicts	2
986083	NM_052988.5(CDK10):c.178del (p.Gln60fs)	Pathogenic	criteria provided, single submitter	1
1706570	NM_052988.5(CDK10):c.872G>A (p.Trp291Ter)	Pathogenic	criteria provided, single submitter	1
1802200	NM_052988.5(CDK10):c.716_728del (p.Leu239fs)	Pathogenic	criteria provided, single submitter	1
2580182	NM_052988.5(CDK10):c.625CTG[1] (p.Leu211del)	Pathogenic	criteria provided, single submitter	1
2580186	NM_052988.4:c.(87+1_88-1)_(232+1_233-1)del	Pathogenic	criteria provided, single submitter	1
2580187	NM_052988.5(CDK10):c.161-1G>C	Pathogenic	criteria provided, single submitter	1
2580188	NM_052988.5(CDK10):c.226A>T (p.Lys76Ter)	Pathogenic	criteria provided, single submitter	1
2580189	NM_052988.5(CDK10):c.452T>C (p.Leu151Pro)	Pathogenic	criteria provided, single submitter	1
2580190	NM_052988.5(CDK10):c.461T>C (p.Leu154Pro)	Pathogenic	criteria provided, single submitter	1
2580191	NM_052988.5(CDK10):c.503del (p.Asn168fs)	Pathogenic	criteria provided, single submitter	1
440756	NM_052988.5(CDK10):c.139del (p.Glu47fs)	Likely pathogenic	criteria provided, single submitter	3
402153	NM_052988.5(CDK10):c.725C>G (p.Thr242Ser)	Likely pathogenic	criteria provided, single submitter	1
813896	NM_052988.5(CDK10):c.550_556del (p.Leu184fs)	Likely pathogenic	criteria provided, single submitter	1

Per-variant reference — Sugi Variant

Explore CDK10’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 31 predictions of 1,409):

Position(s)	Effect	Δscore	Sites
16:89691441–89691442	acceptor_loss	1.0000	5
16:89691546	donor_loss	1.0000	2
16:89691804–89691805	acceptor_loss	1.0000	6
16:89691888–89691889	donor_loss	1.0000	5
16:89692446	acceptor_gain	1.0000
16:89692447–89692448	acceptor_loss	1.0000	4
16:89692517–89692518	donor_loss	1.0000	5
16:89686766	donor_gain	0.9900
16:89687301	donor_gain	0.9900
16:89689447	donor_gain	0.9900

AlphaMissense

1,090 missense substitutions predicted likely pathogenic (of 2,343 scored), across 255 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M117	9	0.892	0.995
D181	8	0.997	0.999
D163	8	0.994	0.999
D221	8	0.989	0.995
D123	8	0.987	0.996
N168	8	0.982	0.998
H161	8	0.970	0.992
F182	8	0.958	0.992
H155	8	0.945	0.981
F135	8	0.934	0.992
D58	8	0.892	0.961
H95	8	0.877	0.976
F323	8	0.874	0.983
F39	7	0.996	0.999
E86	7	0.995	0.998
K68	7	0.994	1.000
F114	7	0.990	0.999
W223	7	0.985	0.997
F338	7	0.976	0.996
R311	7	0.974	0.997

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

5 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Papillary Cell Carcinoma (TCGA)	favorable	2.08e-07
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	8.98e-06
Lung Squamous Cell Carcinoma (TCGA)	unfavorable	0.000942
Colon Adenocarcinoma (TCGA)	unfavorable	0.000992
Ovary Serous Cystadenocarcinoma (validation)	favorable	0.000996

Disease associations

OMIM: gene MIM:603464 | disease phenotypes: MIM:617694, MIM:227650

GenCC curated gene-disease

1 curated gene-disease records:

Disease	Classification	Inheritance	Records
Al Kaissi syndrome	Strong	Autosomal recessive	2

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (5 panels, 5 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

5 panels:

Panel	Rating
Fetal anomalies	green
Hypotonic infant	green
Intellectual disability	green
Leukodystrophy, childhood onset	green
Paediatric disorders	green

Mondo (2): Al Kaissi syndrome (MONDO:0044324), Fanconi anemia (MONDO:0019391)

Orphanet (1): Fanconi anemia (Orphanet:84)

HPO phenotypes

56 phenotypes (HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000218	High palate
HP:0000219	Thin upper lip vermilion
HP:0000248	Brachycephaly
HP:0000252	Microcephaly
HP:0000272	Malar flattening
HP:0000286	Epicanthus
HP:0000307	Pointed chin
HP:0000316	Hypertelorism
HP:0000319	Smooth philtrum
HP:0000325	Triangular face
HP:0000331	Short chin
HP:0000343	Long philtrum
HP:0000358	Posteriorly rotated ears
HP:0000369	Low-set ears
HP:0000377	Abnormal pinna morphology
HP:0000431	Wide nasal bridge
HP:0000455	Broad nasal tip
HP:0000473	Torticollis
HP:0000486	Strabismus
HP:0000494	Downslanted palpebral fissures
HP:0000506	Telecanthus
HP:0000664	Synophrys
HP:0000750	Delayed speech and language development
HP:0000752	Hyperactivity
HP:0000960	Sacral dimple
HP:0001249	Intellectual disability
HP:0001250	Seizure
HP:0001263	Global developmental delay
HP:0001290	Generalized hypotonia
HP:0001382	Joint hypermobility
HP:0001511	Intrauterine growth retardation
HP:0001572	Macrodontia
HP:0001631	Atrial septal defect
HP:0001763	Pes planus
HP:0002079	Hypoplasia of the corpus callosum
HP:0002119	Ventriculomegaly
HP:0002136	Broad-based gait
HP:0002705	High, narrow palate
HP:0002937	Hemivertebrae
HP:0003577	Congenital onset
HP:0004322	Short stature
HP:0004325	Decreased body weight
HP:0005280	Depressed nasal bridge
HP:0006191	Deep palmar crease
HP:0007413	Nevus flammeus of the forehead
HP:0007598	Bilateral single transverse palmar creases
HP:0008897	Postnatal growth retardation
HP:0010055	Broad hallux
HP:0025300	Malar rash
HP:0030084	Clinodactyly
HP:0031936	Delayed ability to walk
HP:0033725	Thin corpus callosum
HP:0040195	Decreased head circumference
HP:0200055	Small hand
HP:0430046	Small joint hypermobility

GWAS associations

10 associations:

Study	Trait	p-value
GCST006986_11	Red vs. brown/black hair color	2e-308
GCST006988_150	Blond vs. brown/black hair color	2e-49
GCST002702_16	Height	4e-23
GCST010083_325	Hemoglobin levels	3e-22
GCST010703_232	Brain morphology (MOSTest)	2e-15
GCST010304_7	Cutaneous malignant melanoma	8e-13
GCST012226_658	Waist circumference adjusted for body mass index	3e-11
GCST004142_15	Melanoma	2e-9
GCST006989_44	Brown vs. black hair color	2e-8
GCST008759_18	Intake of total sugars	9e-6

EFO canonical traits (from GWAS)

5 canonical traits:

EFO ID	Trait name
EFO:0003924	hair color
EFO:0010158	sugar consumption measurement
EFO:0004509	hemoglobin measurement
EFO:0004346	neuroimaging measurement
EFO:0007789	BMI-adjusted waist circumference

MeSH disease descriptors

1 disease descriptors:

Descriptor	Name	Tree numbers
D005199	Fanconi Anemia	C15.378.050.085.080.280; C15.378.190.223.500.500.280; C16.320.077.280; C18.452.284.280

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (3): CHEMBL1795191 (SINGLE PROTEIN), CHEMBL3559691 (PROTEIN FAMILY), CHEMBL5483186 (PROTEIN COMPLEX)

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 3,226 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

3 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL495727	AT-9283	2	1,442
CHEMBL1276127	INDIRUBIN	2	183
CHEMBL1232461	MOLIBRESIB	2	1,601

PharmGKB: 1 entry (CPIC guideline: no)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — CDK10 subfamily

Binding affinities (BindingDB)

2 measured of 4 human assays (5 total across all organisms); most potent 2 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
CHEMBL6162267	IC50	0.35 nM
CHEMBL4445812	KD	23 nM

ChEMBL bioactivities

5 potent at pChembl≥5 of 5 total, top 5 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
8.05	Kd	9	nM	AT-9283
6.96	IC50	110	nM	MOLIBRESIB
5.77	IC50	1700	nM	CHEMBL6162267
5.66	IC50	2200	nM	INDIRUBIN
5.10	Kd	8020	nM	CHEMBL4445812

PubChem BioAssay actives

5 with measured affinity, of 191 total; 5 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
1-cyclopropyl-3-[5-[6-(morpholin-4-ylmethyl)-1H-benzimidazol-2-yl]-1H-pyrazol-4-yl]urea	1424938: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	0.0090	uM
2-[(4S)-6-(4-chlorophenyl)-8-methoxy-1-methyl-4H-[1,2,4]triazolo[4,3-a][1,4]benzodiazepin-4-yl]-N-ethylacetamide	2178578: Inhibition of CDK10 (unknown origin) incubated for 1 hr by colloidal coomassie staining based LC-MS/MS analysis	ic50	0.1100	uM
4-[5-(3-methylsulfanylprop-1-ynyl)-1H-indol-3-yl]pyrimidin-2-amine	2230257: Inhibition of CDK10 (unknown origin) expressed in HEK293 cells using NanoBRET NanoGlo substrate in presence of K10 tracer by NanoBRET assay	ic50	1.7000	uM
2-(2-hydroxy-1H-indol-3-yl)indol-3-one	1378312: Inhibition of recombinant human CDK expressed in baculovirus infected sf9 cells after 10 mins by SDS-PAGE based autoradiography	ic50	2.2000	uM
6-[(3,4-dichlorobenzoyl)amino]-N-(1,3-thiazol-2-yl)naphthalene-2-carboxamide	1577061: Binding affinity to wild-type human full-length CDK10 (M1 to P360 residues) expressed in mammalian expression system measured after 1 hr by kinomescan method	kd	8.0200	uM

CTD chemical–gene interactions

55 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, affects cotreatment, increases abundance, increases expression	4
Arsenic	affects cotreatment, decreases expression, increases abundance, increases expression	2
Doxorubicin	affects expression, increases expression	2
Cadmium Chloride	decreases expression	2
Particulate Matter	affects cotreatment, increases abundance, increases expression	2
FR900359	increases phosphorylation	1
propionaldehyde	decreases expression	1
bisphenol A	affects expression	1
methylselenic acid	decreases expression	1
kojic acid	decreases expression	1
terbufos	increases methylation	1
trichostatin A	affects expression	1
tris(2-butoxyethyl) phosphate	affects expression	1
butyraldehyde	decreases expression	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
ochratoxin A	affects cotreatment, decreases expression	1
potassium chromate(VI)	increases expression	1
nickel sulfate	increases expression	1
pentanal	decreases expression	1
tamibarotene	affects expression	1
di-n-butylphosphoric acid	affects expression	1
perfluorooctane sulfonic acid	increases expression	1
jinfukang	increases expression	1
(+)-JQ1 compound	increases expression	1
Resveratrol	affects cotreatment, increases expression	1
Sunitinib	increases expression	1
Fulvestrant	increases methylation	1
Acetaminophen	increases expression	1
Aldehydes	decreases expression	1
Benzo(a)pyrene	affects methylation	1

ChEMBL screening assays

59 unique, capped per target: 59 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1837575	Binding	Inhibition of human CDK10 in HL60 cells lysate at 10 uM using post probe-labeling by LC-MS/MS analysis relative to control	Synthesis and structure-activity relationship of 4-quinolone-3-carboxylic acid based inhibitors of glycogen synthase kinase-3β. — *Bioorg Med Chem Lett*

Cellosaurus cell lines

2 cell lines: 1 transformed cell line, 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B2TZ	Abcam HEK293T CDK10 KO	Transformed cell line	Female
CVCL_SI19	HAP1 CDK10 (-)	Cancer cell line	Male

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 88 trials:

NCT	Phase	Status	Title
NCT06465641	Phase 4	RECRUITING	Methylphenidate in KBG Syndrome: N-of-1 Series
NCT06519786	Phase 3	UNKNOWN	Safety and Efficacy of Metformin for Treatment of Cytopenia in Children and Adolescents With Fanconi Anemia
NCT00000603	Phase 2	COMPLETED	Cord Blood Stem Cell Transplantation Study (COBLT)
NCT00001749	Phase 2	COMPLETED	Medical Treatment for Diamond Blackfan Anemia
NCT00004787	Phase 2	COMPLETED	Phase II Pilot Study of Granulocyte Colony-Stimulating Factor for Inherited Bone Marrow Failure Syndromes
NCT00053989	Phase 2	COMPLETED	NMA Allogeneic Hematopoietic Cell Transplant in Hematologic Cancer/Disorders
NCT00084695	Phase 2	UNKNOWN	Umbilical Cord Blood for Stem Cell Transplantation in Treating Young Patients With Malignant or Nonmalignant Diseases
NCT00258427	Phase 2	COMPLETED	Hematopoietic Stem Cell Transplantation in High Risk Patients With Fanconi Anemia
NCT00453388	Phase 2	COMPLETED	Fludarabine Phosphate, Cyclophosphamide, and Total-Body Irradiation Followed by Donor Bone Marrow Transplant, Mycophenolate Mofetil, and Cyclosporine in Treating Patients With Fanconi Anemia
NCT01071239	Phase 2	COMPLETED	Hematopoietic Stem Cell Transplant for Fanconi Anemia
NCT02143830	Phase 2	RECRUITING	HSCT for Patients With Fanconi Anemia Using Risk-Adjusted Chemotherapy
NCT02931071	Phase 2	COMPLETED	Clinical Phase II Trial to Evaluate CD34+ Cells Mobilization and Collection in Patients With Fanconi Anemia for Subsequent Transduction With a Lentiviral Vector Carring FANCA Gene. FANCOSTEM-1
NCT03206086	Phase 2	ACTIVE_NOT_RECRUITING	Eltrombopag for Fanconi Anemia
NCT03398824	Phase 2	COMPLETED	Pilot Study of Metformin for Patients With Fanconi Anemia
NCT03476330	Phase 2	COMPLETED	Quercetin Chemoprevention for Squamous Cell Carcinoma in Patients With Fanconi Anemia
NCT03579875	Phase 2	RECRUITING	Alpha/Beta TCD HCT in Patients With Inherited BMF Disorders
NCT03600909	Phase 2	TERMINATED	A Study of the Effect of Blood Stem Cell Transplant After Chemotherapy Alone in Patients With Fanconi Anemia
NCT04232085	Phase 2	RECRUITING	Regenerative Medicine to Restore Hematopoiesis and Immune Function in Immunodeficiencies and Inherited Bone Marrow Failures
NCT06045052	Phase 2	COMPLETED	Eltrombopag for Treatment of Fanconi Anemia
NCT00001399	Phase 1	COMPLETED	Gene Therapy for the Treatment of Fanconi’s Anemia Type C
NCT00005896	Phase 1	UNKNOWN	Phase I Pilot Study of CD34 Enriched, Fanconi’s Anemia Complementation Group C Gene Transduced Autologous Peripheral Blood Stem Cell Transplantation in Patients With Fanconi’s Anemia
NCT00006127	Phase 1	UNKNOWN	Phase I Study of Amifostine in Patients With Bone Marrow Failure Related to Fanconi’s Anemia
NCT00093743	Phase 1	COMPLETED	Low-Dose Total-Body Irradiation and Fludarabine Phosphate Followed by Unrelated Donor Stem Cell Transplant in Treating Patients With Fanconi Anemia
NCT00243399	Phase 1	COMPLETED	Oxandrolone for the Treatment of Bone Marrow Aplasia in Fanconi Anemia
NCT00272857	Phase 1	COMPLETED	Bone Marrow Cell Gene Transfer in Individuals With Fanconi Anemia
NCT00317876	Phase 1	COMPLETED	Cyclophosphamide in Treating Patients Who Are Undergoing a Donor Bone Marrow Transplant for Fanconi’s Anemia
NCT00586274	Phase 1	TERMINATED	Use of Rft5-Dga to Deplete Alloreactive Cells for Pts With Fanconi Anemia After Haploidentical SCT
NCT01331018	Phase 1	TERMINATED	Gene Therapy for Fanconi Anemia
NCT01720147	Phase 1	COMPLETED	Quercetin in Children With Fanconi Anemia; a Pilot Study
NCT01917708	Phase 1	COMPLETED	Bone Marrow Transplant With Abatacept for Non-Malignant Diseases
NCT00352976	Phase 2/3	COMPLETED	TBI Dose De-escalation for Fanconi Anemia
NCT01019876	Phase 2/3	COMPLETED	Risk-Adapted Allogeneic Stem Cell Transplantation For Mixed Donor Chimerism In Patients With Non-Malignant Diseases
NCT00005898	Phase 1/2	COMPLETED	Phase I/II Study of Total Body Irradiation, Cyclophosphamide, and Fludarabine Followed by Alternate Donor Hematopoietic Cell Transplantation in Patients With Fanconi’s Anemia
NCT00167206	Phase 1/2	TERMINATED	Stem Cell Transplantation for Fanconi Anemia
NCT00305708	Phase 1/2	COMPLETED	Busulfan, Antithymocyte Globulin, and Fludarabine Followed By a Donor Stem Cell Transplant in Treating Young Patients With Blood Disorders, Bone Marrow Disorders, Chronic Myelogenous Leukemia in First Chronic Phase, or Acute Myeloid Leukemia in First Remission
NCT00479115	Phase 1/2	COMPLETED	Mobilization and Collection of Peripheral Blood Stem Cells in Patients With Fanconi Anemia Using G-CSF and AMD3100
NCT00590460	Phase 1/2	TERMINATED	Antibody Conditioning Regimen For Allogeneic Donor Stem Cell Transplantation Of Patients With Fanconi Anemia
NCT00630253	Phase 1/2	COMPLETED	Cytoxan, Fludara, and Antithymocyte Globulin Conditioning Followed By Stem Cell Transplant in Treating Fanconi Anemia
NCT01001598	Phase 1/2	TERMINATED	Safety and Efficacy Trial of Danazol in Patients With Fanconi Anemia or Dyskeratosis Congenita
NCT02065869	Phase 1/2	TERMINATED	Safety Study of Gene Modified Donor T-cells Following TCRαβ+ Depleted Stem Cell Transplant
NCT02678533	Phase 1/2	COMPLETED	Mobilization and Collection of Peripheral Blood Stem Cells in Patients With Fanconi Anemia Using G-CSF and Plerixafor
NCT03157804	Phase 1/2	COMPLETED	Lentiviral-mediated Gene Therapy of Fanconi Anemia Patients Subtype A
NCT03733249	Phase 1/2	TERMINATED	Long Term Follow-up Study for Patients Enrolled on the BP-004 Clinical Study
NCT04522375	Phase 1/2	WITHDRAWN	A Dose Escalation Study of FP-045 in Patients With Fanconi Anemia
NCT04784052	Phase 1/2	RECRUITING	Depleted Donor Stem Cell Transplant in Children and Adults With Fanconi Anemia After Being Conditioned With a Regimen Containing Briquilimab
NCT06648096	Phase 1/2	RECRUITING	Afatinib in Patients With Fanconi Anemia (FA) and Advanced Head and Neck Squamous Cell Carcinoma (HNSCC)
NCT07408583	Phase 1/2	NOT_YET_RECRUITING	Prenatal Transplantation for Fetuses With Fanconi Anemia
NCT00965666	Early Phase 1	COMPLETED	Pilot Study of Etanercept (Enbrel) in Children With Fanconi Anemia
NCT00004378	Not specified	COMPLETED	Stem Cell Transplantation (SCT) for Genetic Diseases
NCT00005891	Not specified	COMPLETED	Study of Allogeneic Bone Marrow Transplantation Following Cyclophosphamide and Radiotherapy in Patients With Fanconi’s Anemia
NCT00005892	Not specified	COMPLETED	Study of Allogeneic Bone Marrow Transplantation Following Cyclophosphamide and Radiotherapy in Patients With Myelodysplastic Syndrome and Acute Leukemia Related to Fanconi’s Anemia
NCT00027274	Not specified	RECRUITING	Cancer in Inherited Bone Marrow Failure Syndromes
NCT00271089	Not specified	COMPLETED	Blood Cell Collection for Future Use in Individuals With Fanconi Anemia
NCT00290628	Not specified	TERMINATED	Donor Umbilical Cord Blood Transplant in Treating Patients With Hematologic Cancer
NCT00499070	Not specified	COMPLETED	Assessing Immune Function in Young Patients With Cytopenia That Did Not Respond to Treatment
NCT00542373	Not specified	ACTIVE_NOT_RECRUITING	Widefield Fluorescence and Reflectance Imaging Systems and Oral Tissue Samples in Monitoring Participants at Risk for Developing Oral Cancer
NCT00595127	Not specified	COMPLETED	Hematopoietic Stem Cell Transplantation for Treatment of Patients With Fanconi Anemia Lacking a Genotypically Identical Donor, Using Total Body Irradiation, Cyclophosphamide and Fludarabine
NCT00856388	Not specified	COMPLETED	Fludarabine Phosphate, Melphalan, Total-Body Irradiation, Donor Stem Cell Transplant in Treating Patients With Hematologic Cancer or Bone Marrow Failure Disorders
NCT00896740	Not specified	TERMINATED	Gene Function in Bone Marrow Cells From Patients With Fanconi Anemia and From Healthy Participants
NCT00899522	Not specified	COMPLETED	Tissue Sample Collection From Patients With Fanconi Anemia

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for CDK10 across ~30M SureChEMBL compounds — explore on Sugi Predict.