CDK7

Summary

CDK7 (cyclin dependent kinase 7, HGNC:1778) is a protein-coding gene on chromosome 5q13.2, encoding Cyclin-dependent kinase 7 (P50613). Serine/threonine kinase involved in cell cycle control and in RNA polymerase II-mediated RNA transcription. It is a common-essential gene (DepMap: required in 99.9% of cancer cell lines).

The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This protein forms a trimeric complex with cyclin H and MAT1, which functions as a Cdk-activating kinase (CAK). It is an essential component of the transcription factor TFIIH, that is involved in transcription initiation and DNA repair. This protein is thought to serve as a direct link between the regulation of transcription and the cell cycle.

Source: NCBI Gene 1022 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 35 total
• Druggable target: yes — 69 molecules with ChEMBL bioactivity
• Cancer dependency (DepMap): dependent in 99.9% of screened cell lines (common-essential)
• MANE Select transcript: NM_001799

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:1778
Approved symbol	CDK7
Name	cyclin dependent kinase 7
Location	5q13.2
Locus type	gene with protein product
Status	Approved
Aliases	CAK1, CDKN7, MO15, STK1, CAK
Ensembl gene	ENSG00000134058
Ensembl biotype	protein_coding
OMIM	601955
Entrez	1022

Gene structure

Transcript identifiers

Ensembl transcripts: 23 — 14 protein_coding, 6 nonsense_mediated_decay, 2 retained_intron, 1 protein_coding_CDS_not_defined

ENST00000256443, ENST00000502604, ENST00000504147, ENST00000506563, ENST00000506789, ENST00000508726, ENST00000510106, ENST00000512687, ENST00000512985, ENST00000513629, ENST00000514676, ENST00000515180, ENST00000515391, ENST00000626796, ENST00000629350, ENST00000890326, ENST00000890327, ENST00000890328, ENST00000933539, ENST00000933540, ENST00000933541, ENST00000933542, ENST00000933543

RefSeq mRNA: 9 — MANE Select: NM_001799 NM_001324069, NM_001324070, NM_001324071, NM_001324072, NM_001324074, NM_001324075, NM_001324077, NM_001324078, NM_001799

CCDS: CCDS3999, CCDS83002

Canonical transcript exons

ENST00000256443 — 12 exons

Exon	Start	End
ENSE00000912295	69234886	69235041
ENSE00001008516	69276543	69276690
ENSE00001008520	69277107	69277430
ENSE00003496132	69259818	69259936
ENSE00003547056	69252418	69252451
ENSE00003553964	69258043	69258153
ENSE00003565111	69255460	69255528
ENSE00003619171	69269207	69269293
ENSE00003634170	69272892	69273041
ENSE00003648869	69254602	69254669
ENSE00003662371	69262205	69262304
ENSE00003685113	69235394	69235453

Expression profiles

Bgee: expression breadth ubiquitous, 141 present calls, max score 94.55.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 31.6139 / max 501.4537, expressed in 1807 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
56843	16.9944	1788
56844	10.3099	1716
56842	4.2722	1671
56840	0.0229	7
56841	0.0145	5

Top tissues by expression

141 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
placenta	UBERON:0001987	94.55	gold quality
lower esophagus mucosa	UBERON:0035834	94.13	gold quality
esophagus mucosa	UBERON:0002469	92.85	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	92.09	gold quality
islet of Langerhans	UBERON:0000006	91.36	gold quality
testis	UBERON:0000473	91.26	gold quality
left testis	UBERON:0004533	91.24	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	91.19	gold quality
right testis	UBERON:0004534	90.87	gold quality
stromal cell of endometrium	CL:0002255	90.43	gold quality
endometrium	UBERON:0001295	90.40	gold quality
zone of skin	UBERON:0000014	90.28	gold quality
skin of leg	UBERON:0001511	90.27	gold quality
skin of abdomen	UBERON:0001416	90.23	gold quality
rectum	UBERON:0001052	89.97	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	89.81	gold quality
right uterine tube	UBERON:0001302	89.80	gold quality
gastrocnemius	UBERON:0001388	89.72	gold quality
esophagus	UBERON:0001043	89.54	gold quality
right adrenal gland	UBERON:0001233	89.29	gold quality
muscle of leg	UBERON:0001383	89.15	gold quality
left adrenal gland	UBERON:0001234	89.10	gold quality
right adrenal gland cortex	UBERON:0035827	89.10	gold quality
skeletal muscle organ	UBERON:0014892	89.08	gold quality
bone marrow	UBERON:0002371	88.97	gold quality
adrenal gland	UBERON:0002369	88.95	gold quality
left adrenal gland cortex	UBERON:0035825	88.71	gold quality
adenohypophysis	UBERON:0002196	88.66	gold quality
ventricular zone	UBERON:0003053	88.27	gold quality
adrenal tissue	UBERON:0018303	88.21	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-MTAB-6524	no	88.64
E-ANND-3	no	0.00

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

2 targets.

Target	Regulation
ANKRD37
STC2

miRNA regulators (miRDB)

27 targeting CDK7, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-1250-3P	99.96	70.04	4038
HSA-MIR-1305	99.91	71.43	3443
HSA-MIR-548AC	99.84	70.77	4351
HSA-MIR-548H-3P	99.84	70.80	4349
HSA-MIR-548Z	99.84	70.80	4349
HSA-MIR-498-5P	99.76	69.64	1807
HSA-MIR-199A-3P	99.75	70.48	929
HSA-MIR-199B-3P	99.75	70.48	929
HSA-MIR-3129-5P	99.75	70.46	914
HSA-MIR-4446-5P	99.72	69.19	2544
HSA-MIR-4755-5P	99.71	70.34	2716
HSA-MIR-5006-3P	99.71	70.26	2728
HSA-MIR-4699-3P	99.71	70.15	3142
HSA-MIR-5580-3P	99.70	69.41	2052
HSA-MIR-33A-3P	99.70	70.27	3362
HSA-MIR-7157-5P	99.66	69.33	1829
HSA-MIR-5700	99.64	69.88	2280
HSA-MIR-4310	99.59	68.84	2527
HSA-MIR-141-5P	99.57	67.86	897
HSA-MIR-642A-5P	99.51	65.10	1152
HSA-MIR-4666A-5P	99.41	69.72	1887
HSA-MIR-2115-3P	99.31	69.68	2026
HSA-MIR-4477A	98.83	69.75	2952
HSA-MIR-4490	98.51	68.47	943
HSA-MIR-10226	98.25	66.50	811
HSA-MIR-7703	97.64	67.00	965
HSA-MIR-582-3P	96.69	67.38	1019

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 99.9% of screened cell lines, common-essential.

Literature-anchored findings (GeneRIF, showing 40)

• The cyclin H/cdk7/Mat1 kinase activity is regulated by CK2 phosphorylation of cyclin H. (PMID:12140753)
• determined the crystal structure of human CDK7 in complex with ATP at 3 A resolution (PMID:15530371)
• Confocal microscopy revealed the co-localization of PKC-iota with CAK/cdk7 in both the cytoplasm and nucleus of U-373 MG glioma cells, supporting its role in cell signaling (PMID:15695176)
• Cdk7 accomplishes dual functions in cell-cycle control and transcription not through promiscuity but through distinct, stringent modes of substrate recognition. (PMID:16327805)
• The reduced CDK7 kinase activity is responsible for the inactivation of CDC2/p34 kinase and the irreversible G(2)/M phase cell-cycle arrest of a human gastric carcinoma cell line. (PMID:17012222)
• Different modes of CDK activation by Cdk7 at two distinct execution points in the cell cycle. (PMID:17386261)
• Retinoic-acid-induced RAR-CAK signaling events appear to proceed intrinsically during granulocytic development of normal primitive hematopoietic cells. ALDH-governed RA availability may mediate this process by initiating RAR-CAK signaling. (PMID:17628022)
• These results suggested that genetic variants in CAK genes, Cdk7, cyclin H, MAT1, might modulate the risk of lung cancer in a gene-gene interaction mode, which consist to the biochemical interaction of corresponding proteins. (PMID:17707548)
• Data revealed that SF1 and CDK7 reside in the same complex and CDK inhibitor roscovitine blocked phosphorylation of SF1, and an inactive form of CDK7 repressed the phosphorylation level and the transactivation capacity of SF1. (PMID:17901130)
• The expression of cyclin H and CDK7 protein in proliferating hemangiomas was significantly higher than that in involuting hemangiomas and normal skin tissues. (PMID:18950027)
• Results suggest that CDK4 might not be phosphorylated by CDK7 in intact cells but is more likely phosphorylated by another, presumably proline-directed kinase(s). (PMID:19487459)
• A role of Cdk7 in regulating elongation is further suggested by enhanced histone H4 acetylation and diminished histone H4 trimethylation on lysine 36-two marks of elongation-within genes when the kinase was inhibited. (PMID:19667075)
• Our findings suggest that the CDK7 TT genotype and the combined genetic polymorphisms of CDK7 and ESR1P325P are associated with breast cancer in Korean women. (PMID:19941161)
• glioma cells may be proliferating through a novel PI (3)-kinase-/PKC-iota/Cdk7/cdk2-mediated pathway. (PMID:22021906)
• Data show that the cyclin-dependent kinase 7/9 inhibitor (CDK7/9 inhibitor) potently inhibits FIP1L1-PDGFRalpha-positive Bcr-Abl-positive chronic myeloid leukemia (CML) cells. (PMID:22447844)
• three CTD kinases, CDK7, CDK9, and BRD4, engage in cross-talk, modulating their subsequent C-terminal domain phosphorylation, and also phosphorylate TAF7 (PMID:23027873)
• Cdk7 thus acts through TFIIE and DSIF to establish, and through P-TEFb to relieve, barriers to elongation: incoherent feedforward that might create a window to recruit RNA-processing machinery. (PMID:23064645)
• Interaction with cyclin H/cyclin-dependent kinase 7 (CCNH/CDK7) stabilizes C-terminal binding protein 2 (CtBP2) and promotes cancer cell migration (PMID:23393140)
• CCNH and CDK7 may play an important role in the tumorigenesis and development of esophageal squamous cell carcinoma. (PMID:23456497)
• Data indicate that TG02 blocked signaling by CDKs 1, 2, 7, and 9 and ERK5, leading to potent and highly consistent antimyeloma activity. (PMID:23532886)
• Activating phosphorylation of Cdk7 rises concurrently with that of Cdk4 as cells exit quiescence and accelerates Cdk4 activation in vitro. (PMID:23622515)
• CDK7 involved in phosphorylation/activation of CDK4 and CDK6; existence of CDK4-activating kinase(s) other than CDK7; and novel CDK7-dependent positive feedbacks mediated by p21 phosphorylation by CDK4 and CDK2 to sustain CDK4 activation. (PMID:23737759)
• Data suggest a quantitative contribution of CDK7 to mRNA synthesis, which is critical for cellular homeostasis. (PMID:25047832)
• Our results indicated that CCNH/CDK7-CtBP2 axis may augment ESCC cell migration, and targeting the interaction of both may provide a novel therapeutic target of esophageal squamous cell carcinoma . (PMID:25820824)
• Cdk7 broadly influences transcription and capping. (PMID:26257281)
• Study shows that triple-negative but not hormone receptor-positive breast cancer cells are exceptionally dependent on CDK7, a transcriptional cyclin-dependent kinase. (PMID:26406377)
• Data indicate that cyclin dependent kinase 7 (CDK7) is overexpressed in gastric cancer cell lines and tissues. (PMID:27155449)
• Expressions of components of the CAK complex, CDK7, MAT1, and Cyclin H are elevated in breast cancer. (PMID:27301701)
• High expression of MMP14 and CDK7 was independent prognostic factors for overall survival in patients with gastric cancer. (PMID:27562173)
• MYC promotes mRNA cap methylation and protein production of Wnt/beta-catenin signaling transcripts through recruitment of cyclin-dependent kinase 7 (CDK7) and consequently RNMT to gene promoters. (PMID:27899423)
• Study demonstrate that CDK7 activity is necessary to maintain the transcriptional program induced by STAT proteins that are activated both aberrantly by mutation and by extracellular cues in T-cell lymphomas. (PMID:28134252)
• Taken together, these findings elucidated a novel mechanism of prostate cancer progression. Thus, SNHG1 might serve as a potential target for prostate cancer therapies. (PMID:28400279)
• Our studies have demonstrated the essential role of endogenous PRL and CDK7 in the upregulation of PRLR by E2 and provide insights for therapeutic approaches that will mitigate the transcription/expression of PRLR and its participation in breast cancer progression fueled by E2 and PRL via their cognate receptors. (PMID:28423697)
• these results implicate a CDK7-dependent “CTD code” that regulates chromatin marks in addition to RNA processing and pol II pausing. (PMID:28768201)
• In this study Hep3B and Huh7 cells were infected with two CDK7 shRNAs, both of which reduced CDK7 levels. Inhibition of CDK7 impaired proliferation of Hep3B and Huh7 cells in both short-term IncuCyte(R) cell proliferation assays and long-term colony formation assays. (PMID:29507396)
• CDK7-mediated Ser-175 phosphorylation is a downstream nuclear event essential for facilitating CDK9 T-loop interactions with Tat (PMID:29743242)
• the oncogenic roles of CDK7 in hepatocellular carcinoma and suggested that CDK7 might be a promising therapeutic target (PMID:29981747)
• Targeting CDK7 increases the stability of Snail to promote the dissemination of colorectal cancer. (PMID:30451989)
• Our findings indicate that aberrant CDK7 overexpression associates with T-stage and reduced survival in oral squamous cell carcinoma. (PMID:30473182)
• combining THZ1 with a BCL2/BCL-XL inhibitor ABT-263 synergized in impairing cell growth and driving apoptosis. Our results demonstrate CDK7 as a potential target in treating CCA. Combinations of CDK7 inhibition and BCL2/BCL-XL inhibition may offer a novel therapeutic strategy for CCA. (PMID:31399555)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	cdk7	ENSDARG00000051916
mus_musculus	Cdk7	ENSMUSG00000069089
rattus_norvegicus	Cdk7	ENSRNOG00000018510
drosophila_melanogaster	Cdk7	FBGN0263237
caenorhabditis_elegans	cdk-7	WBGENE00000408

Paralogs (26): CDKL3 (ENSG00000006837), CDKL5 (ENSG00000008086), CDK11A (ENSG00000008128), CDK14 (ENSG00000058091), CDK17 (ENSG00000059758), CDK13 (ENSG00000065883), CDKL1 (ENSG00000100490), CDK16 (ENSG00000102225), CDK6 (ENSG00000105810), PRP4K (ENSG00000112739), CDK18 (ENSG00000117266), CDK2 (ENSG00000123374), CDK8 (ENSG00000132964), CDK4 (ENSG00000135446), CDK9 (ENSG00000136807), CDK15 (ENSG00000138395), CDKL2 (ENSG00000138769), CDK19 (ENSG00000155111), CDK20 (ENSG00000156345), CDK5 (ENSG00000164885), CDK12 (ENSG00000167258), CDK1 (ENSG00000170312), CDK10 (ENSG00000185324), CDKL4 (ENSG00000205111), CDK11B (ENSG00000248333), CDK3 (ENSG00000250506)

Protein

Protein identifiers

Cyclin-dependent kinase 7 — P50613 (reviewed: P50613)

Alternative names: 39 kDa protein kinase, CDK-activating kinase 1, Cell division protein kinase 7, Serine/threonine-protein kinase 1, TFIIH basal transcription factor complex kinase subunit

All UniProt accessions (11): A0A0S2Z3F9, D6R9G1, D6R9Z2, D6RAD4, P50613, D6REC6, D6RF14, D6RFL0, D6RGG9, D6RI01, D6RIG9

UniProt curated annotations — full annotation on UniProt →

Function. Serine/threonine kinase involved in cell cycle control and in RNA polymerase II-mediated RNA transcription. Cyclin-dependent kinases (CDKs) are activated by the binding to a cyclin and mediate the progression through the cell cycle. Each different complex controls a specific transition between 2 subsequent phases in the cell cycle. Required for both activation and complex formation of CDK1/cyclin-B during G2-M transition, and for activation of CDK2/cyclins during G1-S transition (but not complex formation). CDK7 is the catalytic subunit of the CDK-activating kinase (CAK) complex. Phosphorylates SPT5/SUPT5H, SF1/NR5A1, POLR2A, p53/TP53, CDK1, CDK2, CDK4, CDK6 and CDK11B/CDK11. Initiates transcription by RNA polymerase II by mediating phosphorylation of POLR2A at ‘Ser-5’ of the repetitive C-terminal domain (CTD) when POLR2A is in complex with DNA, promoting dissociation from DNA and initiation. CAK activates the cyclin-associated kinases CDK1, CDK2, CDK4 and CDK6 by threonine phosphorylation, thus regulating cell cycle progression. CAK complexed to the core-TFIIH basal transcription factor activates RNA polymerase II by serine phosphorylation of the CTD of POLR2A, allowing its escape from the promoter and elongation of the transcripts. Its expression and activity are constant throughout the cell cycle. Upon DNA damage, triggers p53/TP53 activation by phosphorylation, but is inactivated in turn by p53/TP53; this feedback loop may lead to an arrest of the cell cycle and of the transcription, helping in cell recovery, or to apoptosis. Required for DNA-bound peptides-mediated transcription and cellular growth inhibition.

Subunit / interactions. Associates primarily with cyclin-H (CCNH) and MAT1 to form the CAK complex. CAK can further associate with the core-TFIIH to form the TFIIH basal transcription factor; this complex is sensitive to UV light. The CAK complex binds to p53/TP53 in response to DNA damage. Interacts with CDK2, SF1/NR5A1, PUF60 and PRKCI. Interacts with HINT1.

Subcellular location. Nucleus. Cytoplasm. Perinuclear region.

Tissue specificity. Ubiquitous.

Post-translational modifications. Phosphorylation of Ser-164 during mitosis inactivates the enzyme. Phosphorylation of Thr-170 is required for activity. Phosphorylated at Ser-164 and Thr-170 by CDK2.

Activity regulation. Inactivated by phosphorylation. Repressed by roscovitine (seliciclib, CYC202), R547 (Ro-4584820) and SNS-032 (BMS-387032). The association of p53/TP53 to the CAK complex in response to DNA damage reduces kinase activity toward CDK2 and RNA polymerase II repetitive C-terminal domain (CTD), thus stopping cell cycle progression. The inactivation by roscovitine promotes caspase-mediated apoptosis in leukemic cells. Specifically inactivated by THZ1.

Induction. Repressed by DNA-bound peptides.

Similarity. Belongs to the protein kinase superfamily. CMGC Ser/Thr protein kinase family. CDC2/CDKX subfamily.

RefSeq proteins (9): NP_001310998, NP_001310999, NP_001311000, NP_001311001, NP_001311003, NP_001311004, NP_001311006, NP_001311007, NP_001790* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000719	Prot_kinase_dom	Domain
IPR008271	Ser/Thr_kinase_AS	Active_site
IPR011009	Kinase-like_dom_sf	Homologous_superfamily
IPR017441	Protein_kinase_ATP_BS	Binding_site
IPR037770	CDK7	Family
IPR050108	CDK	Family

Pfam: PF00069

Enzyme classification (BRENDA):

• EC 2.7.11.22 — cyclin-dependent kinase (BRENDA: 49 organisms, 441 substrates, 555 inhibitors, 8 Km, 4 kcat entries)
• EC 2.7.11.23 — [RNA-polymerase]-subunit kinase (BRENDA: 12 organisms, 155 substrates, 47 inhibitors, 15 Km, 0 kcat entries)

Substrate kinetics (BRENDA)

11 substrates with measured Km, best-characterized 11. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
ATP	0.01–0.06	6
ADAQHATPPKKKRKVEDPKDF	0.046–0.521	2
ATP	0.0052–0.017	2
HEPTA-SIX PEPTIDE	0.189–0.2	2
L-ARG-HEPTA PEPTIDE	0.212–0.243	2
FIN1	0.003	1
PKTPKKAKKL	0.0029	1
CTD-CONTAINING FUSION PROTEIN	0.0002	1
GTP	0.18	1
SYNTHETIC PEPTIDE	0.15	1
[DNA-DIRECTED RNA POLYMERASE]	0.0001	1

Catalyzed reactions (Rhea), 3 shown:

• [DNA-directed RNA polymerase] + ATP = phospho-[DNA-directed RNA polymerase] + ADP + H(+) (RHEA:10216)
• L-seryl-[protein] + ATP = O-phospho-L-seryl-[protein] + ADP + H(+) (RHEA:17989)
• L-threonyl-[protein] + ATP = O-phospho-L-threonyl-[protein] + ADP + H(+) (RHEA:46608)

UniProt features (59 total): strand 18, helix 15, mutagenesis site 6, modified residue 5, turn 4, sequence conflict 3, sequence variant 2, binding site 2, initiator methionine 1, chain 1, domain 1, active site 1

Structure

Experimental structures (PDB)

54 structures, top 30 by resolution.

PDB	Method	Resolution (Å)
8P79	ELECTRON MICROSCOPY	1.7
8R9A	X-RAY DIFFRACTION	1.71
8P77	ELECTRON MICROSCOPY	1.8
8R99	X-RAY DIFFRACTION	1.81
8ORM	ELECTRON MICROSCOPY	1.9
8P6V	ELECTRON MICROSCOPY	1.9
8P6W	ELECTRON MICROSCOPY	1.9
8P6X	ELECTRON MICROSCOPY	1.9
8P6Y	ELECTRON MICROSCOPY	1.9
8P72	ELECTRON MICROSCOPY	1.9
8P78	ELECTRON MICROSCOPY	1.9
8PLZ	ELECTRON MICROSCOPY	1.9
8R9U	X-RAY DIFFRACTION	1.94
8P70	ELECTRON MICROSCOPY	2
8P71	ELECTRON MICROSCOPY	2
8P73	ELECTRON MICROSCOPY	2
8P75	ELECTRON MICROSCOPY	2
8P76	ELECTRON MICROSCOPY	2
8P6Z	ELECTRON MICROSCOPY	2.1
8P7L	ELECTRON MICROSCOPY	2.1
8PYR	X-RAY DIFFRACTION	2.15
8P74	ELECTRON MICROSCOPY	2.2
8R9B	X-RAY DIFFRACTION	2.21
8R9O	X-RAY DIFFRACTION	2.22
8S0T	ELECTRON MICROSCOPY	2.3
9HIY	ELECTRON MICROSCOPY	2.3
8S0R	ELECTRON MICROSCOPY	2.4
9I9K	ELECTRON MICROSCOPY	2.4
9QJN	ELECTRON MICROSCOPY	2.4
7B5O	ELECTRON MICROSCOPY	2.5

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P50613-F1	82.29	0.62

Antibody-complex structures (SAbDab): 1 — 8PYR

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 137 (proton acceptor)

Ligand- & substrate-binding residues (2): 18–26; 41

Post-translational modifications (5): 321, 2, 7, 164, 170

Mutagenesis-validated functional residues (6):

Position	Phenotype
41	total loss of activity.
41	no effect on interaction with hint1.
91	enhanced capacity to bind atp analogs.
164	no mitotic repression of transcriptional activity of the reconstituted tfiih complex.
170	total loss of activity. total loss of transcriptional activity of the reconstituted tfiih complex.
170	no effect on interaction with hint1.

Function

Pathways and Gene Ontology

Reactome pathways

62 pathways

ID	Pathway
R-HSA-112382	Formation of RNA Pol II elongation complex
R-HSA-113418	Formation of the Early Elongation Complex
R-HSA-167152	Formation of HIV elongation complex in the absence of HIV Tat
R-HSA-167158	Formation of the HIV-1 Early Elongation Complex
R-HSA-167160	RNA Pol II CTD phosphorylation and interaction with CE during HIV infection
R-HSA-167161	HIV Transcription Initiation
R-HSA-167162	RNA Polymerase II HIV Promoter Escape
R-HSA-167172	Transcription of the HIV genome
R-HSA-167200	Formation of HIV-1 elongation complex containing HIV-1 Tat
R-HSA-167246	Tat-mediated elongation of the HIV-1 transcript
R-HSA-427413	NoRC negatively regulates rRNA expression
R-HSA-5696395	Formation of Incision Complex in GG-NER
R-HSA-674695	RNA Polymerase II Pre-transcription Events
R-HSA-6781823	Formation of TC-NER Pre-Incision Complex
R-HSA-6781827	Transcription-Coupled Nucleotide Excision Repair (TC-NER)
R-HSA-6782135	Dual incision in TC-NER
R-HSA-6782210	Gap-filling DNA repair synthesis and ligation in TC-NER
R-HSA-6796648	TP53 Regulates Transcription of DNA Repair Genes
R-HSA-6807505	RNA polymerase II transcribes snRNA genes
R-HSA-69202	Cyclin E associated events during G1/S transition
R-HSA-69231	Cyclin D associated events in G1
R-HSA-69273	Cyclin A/B1/B2 associated events during G2/M transition
R-HSA-69656	Cyclin A:Cdk2-associated events at S phase entry
R-HSA-72086	mRNA Capping
R-HSA-73762	RNA Polymerase I Transcription Initiation
R-HSA-73772	RNA Polymerase I Promoter Escape
R-HSA-73776	RNA Polymerase II Promoter Escape
R-HSA-73779	RNA Polymerase II Transcription Pre-Initiation And Promoter Opening
R-HSA-73863	RNA Polymerase I Transcription Termination
R-HSA-75953	RNA Polymerase II Transcription Initiation

MSigDB gene sets: 229 (showing top): REACTOME_FORMATION_OF_INCISION_COMPLEX_IN_GG_NER, SA_G2_AND_M_PHASES, BORCZUK_MALIGNANT_MESOTHELIOMA_UP, RODRIGUES_THYROID_CARCINOMA_ANAPLASTIC_UP, FLECHNER_PBL_KIDNEY_TRANSPLANT_REJECTED_VS_OK_UP, DORSAM_HOXA9_TARGETS_UP, REACTOME_RNA_POLYMERASE_I_TRANSCRIPTION_INITIATION, GOBP_CELL_CYCLE_PHASE_TRANSITION, LINDGREN_BLADDER_CANCER_CLUSTER_3_DN, KAUFFMANN_DNA_REPAIR_GENES, PATIL_LIVER_CANCER, WANG_ESOPHAGUS_CANCER_VS_NORMAL_DN, GOBP_NUCLEOTIDE_EXCISION_REPAIR, MUELLER_PLURINET, REACTOME_HIV_INFECTION

GO Biological Process (30): DNA repair (GO:0006281), transcription by RNA polymerase II (GO:0006366), transcription initiation at RNA polymerase II promoter (GO:0006367), snRNA transcription by RNA polymerase II (GO:0042795), positive regulation of transcription by RNA polymerase II (GO:0045944), protein stabilization (GO:0050821), cell division (GO:0051301), regulation of cell cycle (GO:0051726), regulation of G1/S transition of mitotic cell cycle (GO:2000045), RNA polymerase II promoter clearance (GO:0001111), regulation of transcription by RNA polymerase II (GO:0006357), transcription elongation by RNA polymerase II (GO:0006368), protein phosphorylation (GO:0006468), DNA damage response (GO:0006974), epidermal growth factor receptor signaling pathway (GO:0007173), positive regulation of macrophage chemotaxis (GO:0010759), positive regulation of telomere maintenance (GO:0032206), regulation of stress-activated MAPK cascade (GO:0032872), positive regulation of transcription elongation by RNA polymerase II (GO:0032968), cellular response to amino acid starvation (GO:0034198), proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161), stress-activated MAPK cascade (GO:0051403), regulation of cytoskeleton organization (GO:0051493), response to epidermal growth factor (GO:0070849), caveolin-mediated endocytosis (GO:0072584), regulation of Golgi inheritance (GO:0090170), positive regulation of macrophage proliferation (GO:0120041), transcription pausing by RNA polymerase II (GO:0160239), RNA polymerase II transcription initiation surveillance (GO:0160240), regulation of early endosome to late endosome transport (GO:2000641)

GO Molecular Function (14): protein kinase activity (GO:0004672), protein serine/threonine kinase activity (GO:0004674), cyclin-dependent protein serine/threonine kinase activity (GO:0004693), ATP binding (GO:0005524), ATP-dependent activity, acting on DNA (GO:0008094), RNA polymerase II CTD heptapeptide repeat kinase activity (GO:0008353), protein serine kinase activity (GO:0106310), RNA polymerase II CTD heptapeptide repeat S5 kinase activity (GO:0140836), nucleotide binding (GO:0000166), MAP kinase activity (GO:0004707), protein binding (GO:0005515), kinase activity (GO:0016301), transferase activity (GO:0016740), phosphatase binding (GO:0019902)

GO Cellular Component (18): cyclin-dependent protein kinase holoenzyme complex (GO:0000307), transcription factor TFIIH core complex (GO:0000439), fibrillar center (GO:0001650), male germ cell nucleus (GO:0001673), nucleus (GO:0005634), nucleoplasm (GO:0005654), transcription factor TFIIH holo complex (GO:0005675), cytoplasm (GO:0005737), cytosol (GO:0005829), plasma membrane (GO:0005886), perinuclear region of cytoplasm (GO:0048471), CAK-ERCC2 complex (GO:0070516), transcription factor TFIIK complex (GO:0070985), early endosome (GO:0005769), late endosome (GO:0005770), Golgi apparatus (GO:0005794), caveola (GO:0005901), focal adhesion (GO:0005925)

Reactome top-level categories

Rollup of top-12 pathways:

Category	Pathways
Transcription of the HIV genome	4
Transcription-Coupled Nucleotide Excision Repair (TC-NER)	3
RNA Polymerase II Transcription Elongation	2
HIV Transcription Elongation	2
RNA Polymerase II Transcription	2
Late Phase of HIV Life Cycle	1
Tat-mediated elongation of the HIV-1 transcript	1
Negative epigenetic regulation of rRNA expression	1
Global Genome Nucleotide Excision Repair (GG-NER)	1
Nucleotide Excision Repair	1
Transcriptional Regulation by TP53	1
G1/S Transition	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
transcription by RNA polymerase II	6
cellular anatomical structure	5
protein serine/threonine kinase activity	3
RNA polymerase II transcription regulator complex	3
cytoplasm	3
protein kinase activity	2
intracellular membrane-bounded organelle	2
endosome	2
DNA metabolic process	1
DNA damage response	1
DNA-templated transcription	1
DNA-templated transcription initiation	1
snRNA transcription	1
regulation of transcription by RNA polymerase II	1
positive regulation of DNA-templated transcription	1
regulation of protein stability	1
cellular process	1
cell cycle	1
regulation of cellular process	1
G1/S transition of mitotic cell cycle	1
regulation of mitotic cell cycle phase transition	1
regulation of cell cycle G1/S phase transition	1
promoter clearance during DNA-templated transcription	1
regulation of DNA-templated transcription	1
DNA-templated transcription elongation	1
phosphorylation	1
protein modification process	1
cellular response to stress	1
ERBB signaling pathway	1
positive regulation of leukocyte chemotaxis	1
regulation of macrophage chemotaxis	1
macrophage chemotaxis	1
regulation of granulocyte chemotaxis	1
positive regulation of macrophage migration	1
telomere maintenance	1
regulation of telomere maintenance	1
positive regulation of DNA metabolic process	1
positive regulation of chromosome organization	1
regulation of MAPK cascade	1
stress-activated MAPK cascade	1

Protein interactions and networks

STRING

2206 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CDK7	CCNH	P51946	999
CDK7	MNAT1	P51948	998
CDK7	ERCC2	P18074	994
CDK7	ERCC3	P19447	991
CDK7	BRD4	O60885	938
CDK7	CCNT1	O60563	930
CDK7	CCNC	P24863	924
CDK7	GTF2H1	P32780	921
CDK7	GTF2H4	Q92759	885
CDK7	GTF2H2	Q13888	878
CDK7	GTF2H5	Q6ZYL4	862
CDK7	GTF2H3	Q13889	854
CDK7	POLR2A	P24928	832
CDK7	CCNK	O75909	821
CDK7	CCNL2	Q96S94	821

IntAct

100 interactions, top by confidence:

A	B	Type	Score
CDK9	CCNT1	psi-mi:“MI:0914”(association)	0.980
CDK7	CCNH	psi-mi:“MI:0914”(association)	0.950
CCNH	CDK7	psi-mi:“MI:0915”(physical association)	0.950
CDK7	ERCC2	psi-mi:“MI:0914”(association)	0.890
CCNH	CDK2	psi-mi:“MI:0217”(phosphorylation reaction)	0.860
GTF2H1	CDK7	psi-mi:“MI:0915”(physical association)	0.820
CDKN1B	CCNE2	psi-mi:“MI:0914”(association)	0.790
CCNH	ERCC2	psi-mi:“MI:0915”(physical association)	0.750
CCNH	ERCC2	psi-mi:“MI:0914”(association)	0.750
CETN2	SFI1	psi-mi:“MI:0914”(association)	0.740
CDK2	CDK7	psi-mi:“MI:0217”(phosphorylation reaction)	0.710
CDK7	CDK2	psi-mi:“MI:0407”(direct interaction)	0.710
HSP90AB1	CDK7	psi-mi:“MI:0915”(physical association)	0.670
MNAT1	ERCC2	psi-mi:“MI:0914”(association)	0.640
GNG8	GNB5	psi-mi:“MI:0914”(association)	0.640
CDK2	GMNN	psi-mi:“MI:0914”(association)	0.640
GTF2H2	ERCC2	psi-mi:“MI:0914”(association)	0.620
CDK7	SRPK2	psi-mi:“MI:0217”(phosphorylation reaction)	0.590
CDK7	SRPK1	psi-mi:“MI:0217”(phosphorylation reaction)	0.590
ERCC3	BCR	psi-mi:“MI:0914”(association)	0.530
EVL	VASP	psi-mi:“MI:0914”(association)	0.530

BioGRID (766): CDK7 (Affinity Capture-MS), CDK7 (Affinity Capture-MS), CDK7 (Affinity Capture-MS), CCNA2 (Affinity Capture-MS), HSP90AA1 (Affinity Capture-MS), HSP90AB1 (Affinity Capture-MS), HSP90AB4P (Affinity Capture-MS), HSP90AB3P (Affinity Capture-MS), HSP90AA5P (Affinity Capture-MS), HSP90AA4P (Affinity Capture-MS), FKBP5 (Affinity Capture-MS), CDK20 (Affinity Capture-MS), CDC37 (Affinity Capture-MS), ERCC2 (Affinity Capture-MS), CCNB1 (Affinity Capture-MS)

ESM2 similar proteins: A8WIP6, A8XA58, G5EFV5, O13958, O61847, P06242, P17157, P20911, P23573, P25859, P34556, P50613, P50750, P51952, P51953, P54664, P54665, Q00534, Q00646, Q03147, Q06309, Q0J4I1, Q12126, Q2V419, Q38775, Q3TZA2, Q4KM34, Q4V862, Q5EAB2, Q5R7I7, Q5ZKN1, Q641Z4, Q64261, Q6FKD4, Q6GLD8, Q6ZAG3, Q7ZX42, Q8IZL9, Q8L4P8, Q8LF80

Diamond homologs: A0QQK3, A8WUG4, A8X5H5, A8X6H1, A8XJQ6, A8XW88, F1M7Y5, F4HYG2, F4J6F6, G4NH08, O02827, O76360, O88664, P00517, P0DPS8, P10421, P10830, P11799, P16054, P16912, P17612, P18431, P18654, P20911, P21137, P22216, P22694, P25321, P27636, P27791, P29294, P32490, P34099, P34103, P36887, P38070, P40376, P41743, P49673, P50613

SIGNOR signaling

65 interactions.

A	Effect	B	Mechanism
CDK7	unknown	RARA	phosphorylation
CDK7	down-regulates	POLR2A	phosphorylation
CDK7	up-regulates	NR5A1	phosphorylation
CDK7	down-regulates	AR	phosphorylation
“BS-181 hydrochloride”	down-regulates	CDK7	“chemical inhibition”
alvocidib	down-regulates	CDK7	“chemical inhibition”
PHA-767491	down-regulates	CDK7	“chemical inhibition”
N-[6,6-dimethyl-5-[(1-methyl-4-piperidinyl)-oxomethyl]-1,4-dihydropyrrolo[3,4-c]pyrazol-3-yl]-3-methylbutanamide	down-regulates	CDK7	“chemical inhibition”

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 99 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
RNA Pol II CTD phosphorylation and interaction with CE during HIV infection	11	56.8×	9e-16
RNA Pol II CTD phosphorylation and interaction with CE	11	56.8×	9e-16
mRNA Capping	11	53.0×	2e-15
Formation of the Early Elongation Complex	11	46.8×	8e-15
Formation of the HIV-1 Early Elongation Complex	11	46.8×	8e-15
HIV Transcription Elongation	11	46.8×	8e-15
Formation of HIV-1 elongation complex containing HIV-1 Tat	14	46.0×	5e-18
Tat-mediated elongation of the HIV-1 transcript	14	46.0×	5e-18

GO biological processes:

GO term	Partners	Fold	FDR
nucleotide-excision repair	12	51.6×	3e-15
regulation of cyclin-dependent protein serine/threonine kinase activity	5	41.2×	2e-05
transcription initiation at RNA polymerase II promoter	9	37.9×	6e-10
G1/S transition of mitotic cell cycle	8	18.0×	3e-06
transcription by RNA polymerase II	13	10.3×	1e-07
DNA repair	11	7.9×	2e-05
protein folding	6	7.0×	7e-03
protein phosphorylation	9	6.9×	6e-04

Disease & clinical

Clinical variants and AI predictions

ClinVar

35 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	17
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1787 predictions. Top by Δscore:

Variant	Effect	Δscore
5:69235038:ACAG:A	donor_loss	1.0000
5:69235039:CAGGT:C	donor_loss	1.0000
5:69235040:AGGTG:A	donor_loss	1.0000
5:69235043:T:A	donor_loss	1.0000
5:69235390:CTAGT:C	acceptor_loss	1.0000
5:69235391:TAGTT:T	acceptor_loss	1.0000
5:69235392:A:AG	acceptor_gain	1.0000
5:69235392:AG:A	acceptor_loss	1.0000
5:69235393:G:GA	acceptor_gain	1.0000
5:69235393:GT:G	acceptor_gain	1.0000
5:69235393:GTT:G	acceptor_gain	1.0000
5:69235393:GTTT:G	acceptor_gain	1.0000
5:69235449:AGAAA:A	donor_gain	1.0000
5:69235450:GAAA:G	donor_gain	1.0000
5:69235450:GAAAG:G	donor_gain	1.0000
5:69235451:A:T	donor_gain	1.0000
5:69235451:AAA:A	donor_gain	1.0000
5:69235452:AA:A	donor_gain	1.0000
5:69235452:AAG:A	donor_loss	1.0000
5:69235453:AG:A	donor_loss	1.0000
5:69235454:G:GG	donor_gain	1.0000
5:69235454:GT:G	donor_loss	1.0000
5:69252406:C:A	acceptor_gain	1.0000
5:69254665:TTGGT:T	donor_gain	1.0000
5:69254668:GT:G	donor_gain	1.0000
5:69258038:TACA:T	acceptor_loss	1.0000
5:69258040:CA:C	acceptor_loss	1.0000
5:69258041:A:AG	acceptor_gain	1.0000
5:69258041:AGGT:A	acceptor_loss	1.0000
5:69258042:G:GG	acceptor_gain	1.0000

AlphaMissense

2262 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
5:69235030:G:A	G19R	1.000
5:69235030:G:C	G19R	1.000
5:69235036:G:A	G21R	1.000
5:69235036:G:C	G21R	1.000
5:69235037:G:A	G21E	1.000
5:69235394:T:C	F23L	1.000
5:69235395:T:G	F23C	1.000
5:69235396:T:A	F23L	1.000
5:69235396:T:G	F23L	1.000
5:69235398:C:A	A24D	1.000
5:69235404:T:A	V26D	1.000
5:69235440:T:A	V38D	1.000
5:69235443:C:A	A39D	1.000
5:69235448:A:G	K41E	1.000
5:69235449:A:T	K41M	1.000
5:69235450:G:C	K41N	1.000
5:69235450:G:T	K41N	1.000
5:69254617:C:A	A59D	1.000
5:69254623:G:T	R61I	1.000
5:69254624:A:C	R61S	1.000
5:69254624:A:T	R61S	1.000
5:69254625:G:A	E62K	1.000
5:69254626:A:C	E62A	1.000
5:69254626:A:T	E62V	1.000
5:69254627:G:C	E62D	1.000
5:69254627:G:T	E62D	1.000
5:69255497:T:C	L89P	1.000
5:69255500:T:A	V90D	1.000
5:69258152:G:C	R136T	1.000
5:69258152:G:T	R136M	1.000

dbSNP variants (sampled 300 via entrez): RS1000026517 (5:69271306 A>G,T), RS1000309175 (5:69270255 G>A), RS1000319513 (5:69245107 A>T), RS1000352636 (5:69263109 TA>T,TAA), RS1000361272 (5:69249887 C>T), RS1000398516 (5:69255863 ACCCAGCCTGGAGTGCAATGG>A), RS1000448808 (5:69250986 G>A), RS1000653935 (5:69244812 C>T), RS1000682523 (5:69259503 A>C), RS1000719721 (5:69261915 G>T), RS1000748312 (5:69257932 T>C), RS1000782115 (5:69252286 A>C,G), RS1000787376 (5:69263363 A>G), RS1000815147 (5:69252662 A>C), RS1000979739 (5:69236758 TCTC>T)

Disease associations

OMIM: gene MIM:601955 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (6): CHEMBL2111288 (PROTEIN COMPLEX), CHEMBL3038473 (PROTEIN COMPLEX), CHEMBL3055 (SINGLE PROTEIN), CHEMBL3559691 (PROTEIN FAMILY), CHEMBL4523696 (PROTEIN-PROTEIN INTERACTION), CHEMBL6066142 (PROTEIN-PROTEIN INTERACTION)

Molecules with ChEMBL bioactivity

69 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 463,333 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL3301610	ABEMACICLIB	4	7,045
CHEMBL576982	QUIZARTINIB	4	4,432
CHEMBL4594350	ADAGRASIB	4	2,814
CHEMBL1287853	FEDRATINIB	4	3,554
CHEMBL1336	SORAFENIB	4	86,060
CHEMBL1789941	RUXOLITINIB	4	11,547
CHEMBL180022	NERATINIB	4	9,404
CHEMBL1983268	ENTRECTINIB	4	3,510
CHEMBL24828	VANDETANIB	4	42,230
CHEMBL288441	BOSUTINIB	4	12,255
CHEMBL477772	PAZOPANIB	4	15,540
CHEMBL502835	NINTEDANIB	4	8,545
CHEMBL535	SUNITINIB	4	79,020
CHEMBL601719	CRIZOTINIB	4	14,403
CHEMBL939	GEFITINIB	4	117,814
CHEMBL428690	ALVOCIDIB	3	27,781
CHEMBL2103840	DINACICLIB	3	2,257
CHEMBL1879463	DACTOLISIB	3	7,988
CHEMBL223360	LINIFANIB	3	3,925
CHEMBL300138	ENZASTAURIN	3	3,209
CHEMBL3137331	DEFACTINIB	3
CHEMBL38380	FASUDIL	3
CHEMBL522892	DOVITINIB	3
CHEMBL603469	LESTAURTINIB	3
CHEMBL91829	RUBOXISTAURIN	3
CHEMBL14762	SELICICLIB	2
CHEMBL2347597	ASNUCICLIB	2
CHEMBL3655762	CYC-065	2
CHEMBL4067549	ULECACICLIB	2
CHEMBL4442620	RONICICLIB	2

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — CDK7 subfamily

Most potent curated ligand interactions (19 total), top 19:

Ligand	Action	Affinity	Parameter
THZ1	Inhibition	8.49	pIC50
mevociclib	Inhibition	7.76	pKi
zeltociclib	Inhibition	7.7	pIC50
BS-181	Inhibition	7.68	pIC50
samuraciclib	Inhibition	7.4	pIC50
RGB-286638	Inhibition	7.36	pIC50
SY-5609	Inhibition	7.15	pKd
Cdk/Crk inhibitor	Inhibition	7.15	pIC50
asnuciclib	Inhibition	7.04	pKi
LY3405105	Inhibition	7.03	pIC50
mocaciclib	Inhibition	7.0	pIC50
BS-194	Inhibition	6.6	pIC50
milciclib	Inhibition	6.57	pIC50
CGP74514A	Inhibition	6.55	pIC50
THAL-SNS-032	Inhibition	6.4	pIC50
SU9516	Inhibition	6.04	pIC50
Cdk2 inhibitor IV	Inhibition	5.41	pIC50
trilaciclib	Inhibition	5.33	pIC50
CDK12 inhibitor 2	Inhibition	5.0	pIC50

Binding affinities (BindingDB)

99 measured of 226 human assays (227 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
28-dimethylphosphoryl-11-methyl-25-(trifluoromethyl)-4,11,16,21,23,26-hexazapentacyclo[20.3.1.15,9.116,20.02,6]octacosa-1(26),2,5,7,9(28),22,24-heptaen-10-one	IC50	1 nM	US-20250109156: INDOLE-CONTAINING MACROCYCLIC COMPOUNDS AND USES THEREOF
(20S)-28-dimethylphosphoryl-25-(trifluoromethyl)-4,11,16,21,23,26-hexazapentacyclo[20.3.1.15,9.116,20.02,6]octacosa-1(26),2,5,7,9(28),22,24-heptaen-10-one	IC50	1.2 nM	US-20250109156: INDOLE-CONTAINING MACROCYCLIC COMPOUNDS AND USES THEREOF
(1S)-28-dimethylphosphoryl-6-(trifluoromethyl)-2,4,10,17,22,29-hexazapentacyclo[20.4.1.13,7.111,15.08,12]nonacosa-3,5,7(29),8,11,13,15(28)-heptaen-16-one	IC50	1.4 nM	US-20250109156: INDOLE-CONTAINING MACROCYCLIC COMPOUNDS AND USES THEREOF
(21S)-29-dimethylphosphoryl-26-(trifluoromethyl)-10-oxa-4,17,22,24,27-pentazapentacyclo[21.3.1.15,9.117,21.02,6]nonacosa-1(27),2,5,7,9(29),23,25-heptaene	IC50	1.6 nM	US-20250109156: INDOLE-CONTAINING MACROCYCLIC COMPOUNDS AND USES THEREOF
Staurosporine	KD	1.7 nM
CDK Inhibitor, 13	KI	3 nM
CDK Inhibitor, 11	KI	4.1 nM
(19R)-24-(trifluoromethyl)-4,11,16,20,22,25-hexazapentacyclo[19.3.1.15,9.116,19.02,6]heptacosa-1(25),2,5,7,9(27),21,23-heptaen-10-one	IC50	4.58 nM	US-20250145632: Pyrimidine Heterocyclic Compound, Preparation Method Thereof and use Thereof in Medicine
3-[5-(morpholin-4-ylmethyl)-1H-indol-2-yl]-1H-indazole-6-carbonitrile	IC50	11 nM
[(6R)-6-methyl-2-[(2-methyl-1H-imidazol-5-yl)methylamino]-6,8-dihydro-5H-pyrido[3,4-d]pyrimidin-7-yl]-[(3S,4S)-1-methyl-3-phenylpiperidin-4-yl]methanone	IC50	11 nM	WO-2022064009: CYCLIN-DEPENDENT KINASE 7 (CDK7) NON-COVALENT INHIBITORS
(20R)-25-(trifluoromethyl)-14-oxa-4,11,17,21,23,26-hexazapentacyclo[20.3.1.15,9.117,20.02,6]octacosa-1(26),2,5,7,9(28),22,24-heptaen-10-one	IC50	11 nM	US-20250145632: Pyrimidine Heterocyclic Compound, Preparation Method Thereof and use Thereof in Medicine
4-{3-[5-(piperidin-1-ylmethyl)-1H-indol-2-yl]-1H-indazol-6-yl}-1,2-thiazole	IC50	18 nM
4-({2-[6-(1H-pyrazol-4-yl)-1H-indazol-3-yl]-1H-indol-5-yl}methyl)morpholine	IC50	25 nM
4-({2-[6-(1H-pyrazol-5-yl)-1H-indazol-3-yl]-1H-indol-5-yl}methyl)morpholine	IC50	34 nM
GP0210	IC50	40 nM
(5-{3-[5-(piperidin-1-ylmethyl)-1H-indol-2-yl]-1H-indazol-6-yl}-1H-1,2,3-triazol-4-yl)methanol	IC50	56 nM
3-[5-(piperidin-1-ylmethyl)-1H-indol-2-yl]-6-(1H-1,2,3-triazol-1-yl)-1H-indazole	IC50	57 nM
3-[2-(cyclopropanecarbonylamino)-[1,3]thiazolo[5,4-b]pyridin-5-yl]-N-[4-[(4-ethylpiperazin-1-yl)methyl]-3-(trifluoromethyl)phenyl]benzamide	KD	57 nM	US-8765747: Fused 2-aminothiazole compounds
(2R)-2-({4-[(3-chlorophenyl)amino]-8-(propan-2-yl)pyrazolo[1,5-a][1,3,5]triazin-2-yl}amino)-3-methylbutan-1-ol	IC50	60 nM
(E)-N-[4-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]phenyl]-4-(dimethylamino)but-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-N-[4-[3-[(2S)-1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]phenyl]-4-(dimethylamino)but-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
N-(5-cyclopropyl-1H-pyrazol-3-yl)-2-[3-[4-[[(E)-4-(dimethylamino)but-2-enoyl]amino]phenyl]phenyl]butanamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-N-[6-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-3-pyridinyl]-4-(dimethylamino)but-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
N-(5-cyclopropyl-1H-pyrazol-3-yl)-2-[3-[3-fluoro-4-(prop-2-enoylamino)phenyl]phenyl]propanamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
N-(5-cyclopropyl-1H-pyrazol-3-yl)-2-[4-fluoro-3-[3-fluoro-4-(prop-2-enoylamino)phenyl]phenyl]propanamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
N-(5-cyclopropyl-1H-pyrazol-3-yl)-2-[3-[5-(prop-2-enoylamino)-2-pyridinyl]phenyl]propanamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
N-(5-cyclopropyl-1H-pyrazol-3-yl)-2-[3-[3-fluoro-4-(prop-2-enoylamino)phenyl]phenyl]-3-methylbutanamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-N-[4-[3-[1-[(5-cyclopentyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-2-fluorophenyl]-4-(dimethylamino)but-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-N-[4-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-2-fluorophenyl]-4-pyrrolidin-1-ylbut-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-N-[5-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-6-fluoro-2-pyridinyl]-4-morpholin-4-ylbut-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-N-[5-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-3-pyridinyl]-4-morpholin-4-ylbut-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-N-[5-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-3-fluoro-2-pyridinyl]-4-morpholin-4-ylbut-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-N-[6-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-2-fluoro-3-pyridinyl]-4-(3-fluoropyrrolidin-1-yl)but-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-N-[5-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-2-pyridinyl]-4-imidazol-1-ylbut-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-N-[5-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-2-pyridinyl]-4-[(2S)-2-(methoxymethyl)pyrrolidin-1-yl]but-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-N-[5-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-2-pyridinyl]-4-[(2S,4S)-4-fluoro-2-(methoxymethyl)pyrrolidin-1-yl]but-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-4-(3-cyanopyrrolidin-1-yl)-N-[5-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-2-pyridinyl]but-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-N-[4-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-2-fluorophenyl]-4-[(3S)-3-fluoropyrrolidin-1-yl]but-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
methyl (2S)-1-[(E)-4-[[5-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-2-pyridinyl]amino]-4-oxobut-2-enyl]pyrrolidine-2-carboxylate	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-4-[(2S)-2-(cyanomethyl)pyrrolidin-1-yl]-N-[5-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]-2-pyridinyl]but-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
(E)-N-[6-[3-[1-[(5-cyclopropyl-1H-pyrazol-3-yl)amino]-1-oxopropan-2-yl]phenyl]pyrazin-2-yl]-4-pyrrolidin-1-ylbut-2-enamide	IC50	62.5 nM	US-11174232: Substituted heterocyclyl derivatives as CDK inhibitors
CDK Inhibitor, 3	KI	67 nM
CDK Inhibitor, 6	KI	86 nM
cis-(1S,3R)-3-acetamido-N-[4-(4-fluoro-2-methoxyphenyl)-2-pyridinyl]cyclohexane-1-carboxamide	IC50	94 nM	US-9067888: Inhibitors of protein kinases
[5-(3-{5-[(4-fluoropiperidin-1-yl)methyl]-1H-indol-2-yl}-1H-indazol-6-yl)-1H-1,2,3-triazol-4-yl]methanol	IC50	180 nM
(2R)-2-{[4-(benzylamino)-7-(propan-2-yl)imidazo[1,2-a][1,2,4]triazin-2-yl]amino}butan-1-ol	IC50	220 nM
CDK Inhibitor, 5	KI	233 nM
(2R)-2-[[6-(benzylamino)-9-isopropyl-purin-2-yl]amino]butan-1-ol	KD	260 nM
[5-(3-{5-[(4-fluoropiperidin-1-yl)methyl]-1H-indol-2-yl}-1H-indazol-6-yl)-1H-1,2,3-triazol-4-yl]methanamine	IC50	300 nM
N-[(1S)-2-(dimethylamino)-1-phenylethyl]-6,6-dimethyl-3-[4-(prop-2-enoylamino)anilino]-1,2,3,3a,4,6a-hexahydropyrrolo[3,4-c]pyrazole-5-carboxamide	IC50	300 nM	US-10870651: Inhibitors of cyclin-dependent kinase 7 (CDK7)

ChEMBL bioactivities

1756 potent at pChembl≥5 of 1884 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
10.52	Kd	0.03	nM	CHEMBL5088381
10.22	Kd	0.06	nM	CHEMBL5080711
10.22	Kd	0.06	nM	CHEMBL6144858
10.15	Kd	0.07	nM	CHEMBL4791134
10.15	Kd	0.07	nM	SY-5609
10.10	Kd	0.08	nM	CHEMBL4786592
10.10	Kd	0.08	nM	CHEMBL4782954
10.05	Kd	0.09	nM	CHEMBL5083688
10.00	Kd	0.1	nM	CHEMBL4779443
10.00	Kd	0.1	nM	CHEMBL4790490
9.96	Kd	0.11	nM	SY-5609
9.92	Kd	0.12	nM	CHEMBL6143916
9.89	IC50	0.13	nM	CHEMBL4562323
9.85	Kd	0.14	nM	CHEMBL6152747
9.82	Kd	0.15	nM	CHEMBL4786320
9.82	Kd	0.15	nM	CHEMBL4798916
9.80	Kd	0.16	nM	CHEMBL6149443
9.74	Kd	0.18	nM	CHEMBL6144731
9.68	Kd	0.21	nM	CHEMBL4786555
9.51	Kd	0.31	nM	CHEMBL4632717
9.48	Kd	0.33	nM	CHEMBL4555799
9.48	IC50	0.33	nM	CHEMBL4555799
9.47	Kd	0.34	nM	CHEMBL4786843
9.40	Kd	0.4	nM	CHEMBL4800180
9.34	IC50	0.46	nM	SELICICLIB
9.24	Kd	0.58	nM	RG-547
9.21	IC50	0.623	nM	QUIZARTINIB
9.21	IC50	0.623	nM	CHEMBL3683258
9.00	IC50	0.996	nM	CHEMBL256570
9.00	IC50	0.996	nM	CHEMBL3683258
8.89	Kd	1.3	nM	BTX-A51
8.89	IC50	1.3	nM	ADAGRASIB
8.89	IC50	1.3	nM	BTX-A51
8.77	Ki	1.7	nM	CHEMBL5573062
8.72	Ki	1.9	nM	CHEMBL4450322
8.70	IC50	2	nM	RGB-286638
8.68	Ki	2.1	nM	CHEMBL5571052
8.66	Ki	2.2	nM	CHEMBL5571158
8.66	Ki	2.2	nM	CHEMBL5612622
8.64	Ki	2.3	nM	CHEMBL3932121
8.64	IC50	2.3	nM	SY-5609
8.60	Kd	2.5	nM	CHEMBL393525
8.60	IC50	2.5	nM	SY-5609
8.55	Ki	2.8	nM	CHEMBL5570901
8.55	Kd	2.8	nM	AT-7519
8.54	Ki	2.9	nM	CHEMBL5573958
8.52	IC50	3	nM	ZOTIRACICLIB
8.52	Kd	3	nM	PF-03758309
8.52	IC50	3	nM	CHEMBL5573062
8.52	Ki	3	nM	CHEMBL5569632

PubChem BioAssay actives

916 with measured affinity, of 2917 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-[6-(3,5-dimethyl-1,2-oxazol-4-yl)-1H-pyrrolo[2,3-b]pyridin-3-yl]-N-[(3S)-piperidin-3-yl]-5-(trifluoromethyl)pyrimidin-2-amine;hydrochloride	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	<0.0001	uM
4-[6-(3,5-dimethyl-1,2-oxazol-4-yl)-1H-indol-3-yl]-N-[(3S)-piperidin-3-yl]-5-(trifluoromethyl)pyrimidin-2-amine	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0001	uM
4-(7-dimethylphosphoryl-1H-indol-3-yl)-N-[(3S)-piperidin-3-yl]-5-(trifluoromethyl)pyrimidin-2-amine	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0001	uM
3-[5-ethyl-2-[[(3S)-piperidin-3-yl]amino]pyrimidin-4-yl]-7-methylsulfonyl-1H-indole-6-carbonitrile	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0001	uM
7-methylsulfonyl-3-[2-[[(3S)-piperidin-3-yl]amino]-5-(trifluoromethyl)pyrimidin-4-yl]-1H-indole-6-carbonitrile	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0001	uM
4-(6-methylsulfonyl-1H-indol-3-yl)-N-[(3S)-piperidin-3-yl]-5-(trifluoromethyl)pyrimidin-2-amine	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0001	uM
7-dimethylphosphoryl-3-[2-[[(3S)-6,6-dimethylpiperidin-3-yl]amino]-5-(trifluoromethyl)pyrimidin-4-yl]-1H-indole-6-carbonitrile	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0001	uM
7-dimethylphosphoryl-3-[2-[[(3S)-5,5-dimethylpiperidin-3-yl]amino]-5-(trifluoromethyl)pyrimidin-4-yl]-1H-indole-6-carbonitrile	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0001	uM
4-(7-methylsulfonyl-1H-indol-3-yl)-N-[(3S)-piperidin-3-yl]-5-(trifluoromethyl)pyrimidin-2-amine	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0001	uM
4-(1H-indol-3-yl)-N-[(3S)-piperidin-3-yl]-5-(trifluoromethyl)pyrimidin-2-amine	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0001	uM
3-[2-[[(3S)-piperidin-3-yl]amino]-5-(trifluoromethyl)pyrimidin-4-yl]-1H-indole-6-carbonitrile	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0001	uM
2-piperidin-3-yloxy-8-propan-2-yl-N-[(2-pyrazol-1-ylphenyl)methyl]pyrazolo[1,5-a][1,3,5]triazin-4-amine	1604149: Inhibition of CDK7 (unknown origin)	ic50	0.0001	uM
N-[(3S)-5,5-dimethylpiperidin-3-yl]-4-(1H-indol-3-yl)-5-(trifluoromethyl)pyrimidin-2-amine	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0002	uM
4-N-[4-[5-(cyclopropylmethyl)-1-methylpyrazol-4-yl]-5-fluoropyrimidin-2-yl]cyclohexane-1,4-diamine	1653043: Binding affinity to CDK7 (unknown origin)	kd	0.0003	uM
N-[(3S)-6,6-dimethylpiperidin-3-yl]-4-(1H-indol-3-yl)-5-(trifluoromethyl)pyrimidin-2-amine	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0003	uM
5-chloro-4-(1H-indol-3-yl)-N-[(3S)-piperidin-3-yl]pyrimidin-2-amine	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0003	uM
5-ethyl-4-(1H-indol-3-yl)-N-[(3S)-piperidin-3-yl]pyrimidin-2-amine	1820461: Binding affinity to full length CDK7 (1 to 346 residues) /N-terminal TEV cleavable 6His tagged full length cyclinH (1 to 323 residues) (unknown origin) expressed in baculovirus infected Sf9 cells by Surface plasmon resonance assay	kd	0.0004	uM
(2R)-2-[[6-(benzylamino)-9-propan-2-ylpurin-2-yl]amino]butan-1-ol	1868068: Inhibition of CDK7/Cyclin H (unknown origin)	ic50	0.0005	uM
3,4-dimethyl-5-[2-(4-methyl-3-nitroanilino)pyrimidin-4-yl]-1,3-thiazol-2-one	1799550: In Vitro Kinase Assay from Article 10.1016/j.chembiol.2010.07.016: “Discovery and characterization of 2-anilino-4- (thiazol-5-yl)pyrimidine transcriptional CDK inhibitors as anticancer agents.”	ki	0.0006	uM
[4-amino-2-[(1-methylsulfonylpiperidin-4-yl)amino]pyrimidin-5-yl]-(2,3-difluoro-6-methoxyphenyl)methanone	624845: Binding constant for CDK7 kinase domain	kd	0.0006	uM
N-[(16E)-14-methyl-20-oxa-5,7,14,27-tetrazatetracyclo[19.3.1.12,6.18,12]heptacosa-1(25),2(27),3,5,8,10,12(26),16,21,23-decaen-10-yl]-4-(prop-2-enoylamino)benzamide	1651625: Binding affinity to CDK7 (unknown origin)	kd	0.0010	uM
4-N-[5-chloro-4-[5-(cyclopropylmethyl)-1-methylpyrazol-4-yl]pyrimidin-2-yl]cyclohexane-1,4-diamine	1696653: Binding affinity to wild-type human full length CDK7 (M1 to L344 residues) expressed in mammalian expression system by Kinomescan method	kd	0.0013	uM
Adagrasib	1853202: Inhibition of CDK7/Cyclin H/MAT1 (unknown origin) in leukemia cells	ic50	0.0013	uM
22-propan-2-ylspiro[10-oxa-2,18,20,24,25,26-hexazatetracyclo[17.6.1.04,9.021,25]hexacosa-1(26),4,6,8,19,21,23-heptaene-16,3’-azetidine]	2104174: Inhibition of CDK7/cyclin H/MNAT1 (unknown origin) preincubated for 10 mins followed by substrate addition and measured after 60 mins in presence of ATP by ADP-Glo reagent based luminescence microtiter plate reader analysis	ki	0.0017	uM
1-[3-[4-[[4-(2-methoxyethyl)piperazin-1-yl]methyl]phenyl]-4-oxo-1H-indeno[2,1-d]pyrazol-5-yl]-3-morpholin-4-ylurea	1317365: Inhibition of CDK7/cyclin H (unknown origin)	ic50	0.0020	uM
23-propan-2-ylspiro[10-oxa-2,19,21,25,26,27-hexazatetracyclo[18.6.1.04,9.022,26]heptacosa-1(27),4,6,8,20,22,24-heptaene-17,4’-piperidine]	2104174: Inhibition of CDK7/cyclin H/MNAT1 (unknown origin) preincubated for 10 mins followed by substrate addition and measured after 60 mins in presence of ATP by ADP-Glo reagent based luminescence microtiter plate reader analysis	ki	0.0021	uM
N-[(1R)-2-(dimethylamino)-1-phenylethyl]-6,6-dimethyl-3-[[4-(prop-2-enoylamino)benzoyl]amino]-1,4-dihydropyrrolo[3,4-d]pyrazole-5-carboxamide	2125276: Inhibition of recombinant GST-tagged CDK7/CycH/MAT1 (unknown origin) extracted from baculo-virus infected Sf9 insect cells assessed as inhibition constant using ATP containing 32P measured after 15 mins by Beckman liquid scintillation counter analysis	ki	0.0022	uM
(12R)-22-propan-2-ylspiro[10-oxa-2,18,20,24,25,26-hexazatetracyclo[17.6.1.04,9.021,25]hexacosa-1(26),4,6,8,19,21,23-heptaene-16,4’-piperidine]-12-ol	2104174: Inhibition of CDK7/cyclin H/MNAT1 (unknown origin) preincubated for 10 mins followed by substrate addition and measured after 60 mins in presence of ATP by ADP-Glo reagent based luminescence microtiter plate reader analysis	ki	0.0022	uM
3,4-dimethyl-5-[2-(4-piperazin-1-ylanilino)pyrimidin-4-yl]-1,3-thiazol-2-one	1317341: Inhibition of CDK7 (unknown origin) using (biotinyl-Ahx-(Tyr-Ser-ProThr-Ser-Pro-Ser)4-NH2 as substrate after 45 mins by [gamma-32P]ATP based microbeta scintillation counting analysis	ki	0.0023	uM
N-[(E)-(6-bromoimidazo[1,2-a]pyridin-3-yl)methylideneamino]-N,2-dimethyl-5-nitrobenzenesulfonamide	1317368: Binding affinity to full length human CDK7 (1 to 344 residues) expressed in mammalian expression system by KINOMEscan competition assay	kd	0.0025	uM
4-[(2,6-dichlorobenzoyl)amino]-N-piperidin-4-yl-1H-pyrazole-5-carboxamide	624845: Binding constant for CDK7 kinase domain	kd	0.0028	uM
(3S,4S)-4-[(20-propan-2-yl-10-oxa-2,16,18,22,23,24-hexazatetracyclo[15.6.1.04,9.019,23]tetracosa-1(24),4,6,8,17,19,21-heptaen-16-yl)methyl]pyrrolidin-3-ol	2107679: Inhibition of recombinant human His-tagged CDK7/cyclin H/MNAT1 expressed in baculovirus expression system using histone H1 as substrate preincubated for 10 mins followed by substrate and ATP addition and measured after 60 mins by ADP-Glo reagent based microplate reader assay	ki	0.0028	uM
12-methoxy-22-propan-2-ylspiro[10-oxa-2,18,20,24,25,26-hexazatetracyclo[17.6.1.04,9.021,25]hexacosa-1(26),4,6,8,19,21,23-heptaene-16,4’-piperidine]	2104174: Inhibition of CDK7/cyclin H/MNAT1 (unknown origin) preincubated for 10 mins followed by substrate addition and measured after 60 mins in presence of ATP by ADP-Glo reagent based luminescence microtiter plate reader analysis	ki	0.0029	uM
(16E)-14-methyl-20-oxa-5,7,14,27-tetrazatetracyclo[19.3.1.12,6.18,12]heptacosa-1(25),2(27),3,5,8,10,12(26),16,21,23-decaene	1317353: Inhibition of recombinant human full length C-terminal His6-tagged CDK7/cyclin H/N-terminal GST-tagged MAT1 expressed in baculovirus infected Sf21 insect cells using cdk7 substrate peptide	ic50	0.0030	uM
(12S)-22-propan-2-ylspiro[10-oxa-2,18,20,24,25,26-hexazatetracyclo[17.6.1.04,9.021,25]hexacosa-1(26),4,6,8,19,21,23-heptaene-16,4’-piperidine]-12-ol	2104174: Inhibition of CDK7/cyclin H/MNAT1 (unknown origin) preincubated for 10 mins followed by substrate addition and measured after 60 mins in presence of ATP by ADP-Glo reagent based luminescence microtiter plate reader analysis	ki	0.0030	uM
N-[(1S)-2-(dimethylamino)-1-phenylethyl]-6,6-dimethyl-3-[(2-methylthieno[3,2-d]pyrimidin-4-yl)amino]-1,4-dihydropyrrolo[3,4-d]pyrazole-5-carboxamide	1424949: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	0.0030	uM
N-[3-[[5-chloro-4-(1H-indol-2-yl)pyrimidin-2-yl]amino]phenyl]-4-[[(E)-4-(dimethylamino)but-3-enoyl]amino]benzamide	1868091: Inhibition of CDK7 (unknown origin) incubated for 180 mins by LanthaScreen Eu kinase binding assay	ic50	0.0032	uM
N-[3-[[5-chloro-4-(1H-indol-3-yl)pyrimidin-2-yl]amino]phenyl]-4-[[(E)-4-(dimethylamino)but-2-enoyl]amino]benzamide	1239750: Competitive inhibition of human CDK7 in presence of ATP	ic50	0.0032	uM
(3R,4R)-4-[[[7-(benzylamino)-3-propan-2-ylpyrazolo[1,5-a]pyrimidin-5-yl]amino]methyl]piperidin-3-ol	2104174: Inhibition of CDK7/cyclin H/MNAT1 (unknown origin) preincubated for 10 mins followed by substrate addition and measured after 60 mins in presence of ATP by ADP-Glo reagent based luminescence microtiter plate reader analysis	ki	0.0032	uM
22-propan-2-ylspiro[10-oxa-2,18,20,24,25,26-hexazatetracyclo[17.6.1.04,9.021,25]hexacosa-1(26),4,6,8,19,21,23-heptaene-16,4’-piperidine]	2104174: Inhibition of CDK7/cyclin H/MNAT1 (unknown origin) preincubated for 10 mins followed by substrate addition and measured after 60 mins in presence of ATP by ADP-Glo reagent based luminescence microtiter plate reader analysis	ki	0.0034	uM
7-methyl-22-propan-2-ylspiro[10-oxa-2,8,18,20,24,25,26-heptazatetracyclo[17.6.1.04,9.021,25]hexacosa-1(26),4(9),5,7,19,21,23-heptaene-16,4’-piperidine]	2104174: Inhibition of CDK7/cyclin H/MNAT1 (unknown origin) preincubated for 10 mins followed by substrate addition and measured after 60 mins in presence of ATP by ADP-Glo reagent based luminescence microtiter plate reader analysis	ic50	0.0037	uM
1-N’-[3-fluoro-4-[6-methoxy-7-(3-morpholin-4-ylpropoxy)quinolin-4-yl]oxyphenyl]-1-N-(4-fluorophenyl)cyclopropane-1,1-dicarboxamide	624845: Binding constant for CDK7 kinase domain	kd	0.0037	uM
20-propan-2-ylspiro[2,16,18,22,23,24-hexazatetracyclo[15.6.1.04,9.019,23]tetracosa-1(24),4,6,8,17,19,21-heptaene-14,4’-piperidine]	2104174: Inhibition of CDK7/cyclin H/MNAT1 (unknown origin) preincubated for 10 mins followed by substrate addition and measured after 60 mins in presence of ATP by ADP-Glo reagent based luminescence microtiter plate reader analysis	ki	0.0038	uM
N-[5-[5-[[(2S)-2-hydroxy-2-phenylethyl]amino]-3-pyridinyl]-1H-indazol-3-yl]-4-(prop-2-enoylamino)benzamide	1934817: Inhibition of CDK7 (unknown origin) assessed as phosphorylation of ULight 4EBP1 peptide substrate measured after 2 hrs by FRET-based LANCE Ultra KinSelect assay	ic50	0.0040	uM
N-[(1S,3R)-3-[[5-chloro-4-(1H-indol-3-yl)pyrimidin-2-yl]amino]cyclohexyl]-5-[[(E)-4-(dimethylamino)but-2-enoyl]amino]pyridine-2-carboxamide	1609458: Competitive irreversible inhibition of CDK7/cyclinH/MAT1 (unknown origin)	ec50	0.0040	uM
N-[(1R,2S)-2-aminocyclohexyl]-4-[6-(1-methylpyrazol-4-yl)pyrazolo[1,5-a]pyrimidin-3-yl]thiophene-2-carboxamide	1637062: Inhibition of full-length recombinant human His-tagged CDK7 expressed in baculovirus expression system by Adapta assay	ic50	0.0041	uM
1-[4-[(4-ethylpiperazin-1-yl)methyl]-3-(trifluoromethyl)phenyl]-3-[4-[6-(methylamino)pyrimidin-4-yl]oxyphenyl]urea	435278: Binding constant for full-length CDK7	kd	0.0045	uM
2-[(3S)-piperidin-3-yl]oxy-8-propan-2-yl-N-[(2-pyrazol-1-ylphenyl)methyl]pyrazolo[1,5-a][1,3,5]triazin-4-amine	1651608: Inhibition of CDK7 (unknown origin)	ic50	0.0050	uM
N-[5-[5-[[(2S)-1-hydroxy-3-phenylpropan-2-yl]amino]-3-pyridinyl]-1H-indazol-3-yl]-4-(prop-2-enoylamino)benzamide	1934817: Inhibition of CDK7 (unknown origin) assessed as phosphorylation of ULight 4EBP1 peptide substrate measured after 2 hrs by FRET-based LANCE Ultra KinSelect assay	ic50	0.0050	uM
(2R,3R)-3-[2-[4-(cyclopropylsulfonimidoyl)anilino]-5-(trifluoromethyl)pyrimidin-4-yl]oxybutan-2-ol	1845580: Inhibition of CDK7 (unknown origin) expressed in baculovirus-infected Sf9 insect cells	ic50	0.0050	uM

CTD chemical–gene interactions

79 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, increases expression	3
bisphenol A	decreases expression, affects cotreatment	2
Acetaminophen	affects expression, increases expression, decreases reaction	2
Copper	affects binding, increases expression, decreases expression	2
Valproic Acid	affects expression, decreases expression	2
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression	2
Cyclosporine	increases expression	2
Paclitaxel	increases activity, affects cotreatment, decreases expression, affects binding, affects reaction	2
LL202 flavonoid	decreases expression	1
GSK-J4	increases expression	1
FR900359	increases phosphorylation	1
pradimicin-IRD	affects expression, affects response to substance	1
dicrotophos	decreases expression	1
myristicin	increases expression	1
triphenyl phosphate	affects expression	1
VX-agent	increases expression	1
trichostatin A	affects expression	1
beta-lapachone	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
vanadium pentoxide	decreases expression	1
perfluorooctane sulfonic acid	increases expression	1
wogonin	decreases activity	1
cylindrospermopsin	increases expression	1
CGP 52608	increases reaction, affects binding	1
chloropicrin	increases expression	1
7,3’-dihydroxy-4’-methoxyisoflavone	increases expression	1
monomethylarsonous acid	increases expression	1
K 7174	increases expression	1
4-chloro-N-((4-(1,1-dimethylethyl)phenyl)methyl)-3-ethyl-1-methyl-1H-pyrazole-5-carboxamide	decreases expression	1
olomoucine II	decreases activity	1

ChEMBL screening assays

786 unique, capped per target: 768 binding, 17 functional, 1 toxicity

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1004615	Binding	Inhibition of CDK7/cyclinH by IMAP florescence polarization assay	A diaminocyclohexyl analog of SNS-032 with improved permeability and bioavailability properties. — Bioorg Med Chem Lett
CHEMBL5724508	Functional	Biochemical CDK7 assay (KIapp) ( CDK7 catalyzed, ATP-dependent, phosphorylation of a peptide substrate derived from RNA Pol II (CDK7/9-tide). Coupled via lactate dehydrogenase (LDH) and pyruvate kinase (PK) to lactate and NAD+ production, w	Data for DCP probe JNJ-3738
CHEMBL5160041	Toxicity	Binding affinity to human CDK7	Discovery and Preclinical Pharmacology of INE963, a Potent and Fast-Acting Blood-Stage Antimalarial with a High Barrier to Resistance and Potential for Single-Dose Cures in Uncomplicated Malaria. — J Med Chem

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.