CDKN2A

Summary

CDKN2A (cyclin dependent kinase inhibitor 2A, HGNC:1787) is a protein-coding gene on chromosome 9p21.3, encoding Cyclin-dependent kinase inhibitor 2A (P42771). Acts as a negative regulator of the proliferation of normal cells by interacting strongly with CDK4 and CDK6. In precision oncology, CDKN2A Deletion confers sensitivity to Palbociclib in Gastrointestinal Stromal Tumor (CIViC Level B); 23 further curated variant–drug associations are listed below. It is haploinsufficient (ClinGen: sufficient evidence).

This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene.

Source: NCBI Gene 1029 — RefSeq curated summary.

At a glance

• Gene–disease (curated): melanoma-pancreatic cancer syndrome (Definitive, ClinGen) — +3 more curated relationships
• GWAS associations: 93
• Clinical variants (ClinVar): 1,611 total — 112 pathogenic, 41 likely-pathogenic
• Phenotypes (HPO): 96
• Druggable target: yes
• Precision-oncology evidence (CIViC): 24 curated variant–drug associations
• Cancer driver (intOGen): loss-of-function (tumor-suppressor-like) across 29 cancer types
• Dosage sensitivity (ClinGen): haploinsufficiency sufficient evidence, triplosensitivity no evidence
• MANE Select transcript: NM_000077

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:1787
Approved symbol	CDKN2A
Name	cyclin dependent kinase inhibitor 2A
Location	9p21.3
Locus type	gene with protein product
Status	Approved
Aliases	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf, p14ARF, P16-INK4A, CAI2
Ensembl gene	ENSG00000147889
Ensembl biotype	protein_coding
OMIM	600160
Entrez	1029

Gene structure

Transcript identifiers

Ensembl transcripts: 14 — 10 protein_coding, 3 protein_coding_CDS_not_defined, 1 nonsense_mediated_decay

ENST00000304494, ENST00000380150, ENST00000380151, ENST00000470819, ENST00000479692, ENST00000494262, ENST00000497750, ENST00000498124, ENST00000498628, ENST00000530628, ENST00000577854, ENST00000578845, ENST00000579122, ENST00000579755

RefSeq mRNA: 5 — MANE Select: NM_000077 NM_000077, NM_001195132, NM_001363763, NM_058195, NM_058197

CCDS: CCDS56565, CCDS6510, CCDS6511, CCDS87644

Canonical transcript exons

ENST00000304494 — 3 exons

Exon	Start	End
ENSE00001833804	21974678	21974857
ENSE00003496053	21970902	21971208
ENSE00003529527	21967752	21968242

Expression profiles

Bgee: expression breadth ubiquitous, 220 present calls, max score 93.57.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 54.4197 / max 1162.1676, expressed in 1490 samples.

FANTOM5 promoters (21 alternative TSS)

Promoter ID	TPM avg	Samples expressed
100259	38.4734	1340
100250	6.8579	800
100262	1.5292	639
100252	1.5134	471
100255	1.0692	451
100265	0.8411	407
100254	0.6740	345
100258	0.5880	302
100261	0.5544	314
100257	0.4185	215

Top tissues by expression

276 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
parotid gland	UBERON:0001831	93.57	silver quality
cervix squamous epithelium	UBERON:0006922	92.83	silver quality
pituitary gland	UBERON:0000007	92.49	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	92.11	gold quality
adenohypophysis	UBERON:0002196	91.60	gold quality
vena cava	UBERON:0004087	91.22	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	90.42	gold quality
cardia of stomach	UBERON:0001162	89.74	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	88.92	silver quality
pons	UBERON:0000988	88.91	silver quality
subthalamic nucleus	UBERON:0001906	88.38	silver quality
tongue	UBERON:0001723	88.36	silver quality
ventral tegmental area	UBERON:0002691	88.11	silver quality
pharyngeal mucosa	UBERON:0000355	87.98	gold quality
superior surface of tongue	UBERON:0007371	87.97	gold quality
lateral globus pallidus	UBERON:0002476	87.93	silver quality
dorsal plus ventral thalamus	UBERON:0001897	87.71	silver quality
pericardium	UBERON:0002407	87.62	gold quality
inferior vagus X ganglion	UBERON:0005363	87.61	silver quality
substantia nigra pars reticulata	UBERON:0001966	87.51	gold quality
nipple	UBERON:0002030	87.43	silver quality
substantia nigra pars compacta	UBERON:0001965	87.34	silver quality
lower esophagus mucosa	UBERON:0035834	87.34	gold quality
saphenous vein	UBERON:0007318	87.05	silver quality
myocardium	UBERON:0002349	86.88	gold quality
trigeminal ganglion	UBERON:0001675	86.57	gold quality
dorsal root ganglion	UBERON:0000044	86.51	gold quality
renal medulla	UBERON:0000362	86.08	gold quality
nasal cavity epithelium	UBERON:0005384	85.99	silver quality
trachea	UBERON:0003126	85.88	silver quality

Single-cell (SCXA)

Detected in 5 experiment(s), a significant marker in 4.

Experiment	Marker?	Max mean expression
E-GEOD-84465	yes	655.14
E-MTAB-6911	yes	93.81
E-GEOD-81383	yes	23.89
E-ANND-3	yes	5.83
E-MTAB-5061	no	4.01

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

1 targets.

Target	Regulation
FANCD2	Repression

Upstream regulators (CollecTRI, top): AFF4, AHR, AP1, ASXL1, ATF2, ATF6, BCL11A, BCL3, BCL6, BMI1, CDX2, CEBPB, CREB1, CREB3, CTBP1, CTBP2, CTCF, CTNNBL1, DBP, DDB1, DLX2, DMRTA1, DMTF1, DNMT1, DNMT3A, DNMT3B, E2F1, E2F2, E2F3, EAPP, EGR2, EHF, ELF4, ERG, ESR1, ETS1, ETS2, ETV1, EZH2, FLI1

miRNA regulators (miRDB)

29 targeting CDKN2A, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-3662	99.99	73.82	5684
HSA-MIR-128-3P	99.95	71.17	2484
HSA-MIR-216A-3P	99.95	71.19	2505
HSA-MIR-153-5P	99.89	73.86	6317
HSA-MIR-4302	99.89	67.94	1187
HSA-MIR-3681-3P	99.88	70.46	2254
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-4799-5P	99.82	70.60	2663
HSA-MIR-1296-3P	99.72	64.04	636
HSA-MIR-3714	99.71	70.74	2671
HSA-MIR-4519	99.48	66.10	859
HSA-MIR-365A-3P	99.43	70.02	836
HSA-MIR-365B-3P	99.43	70.02	836
HSA-MIR-6507-5P	99.36	70.46	2524
HSA-MIR-190B-3P	99.33	68.29	1382
HSA-MIR-4727-5P	99.23	67.55	1154
HSA-MIR-1286	99.09	66.23	1046
HSA-MIR-1257	98.97	68.02	1133
HSA-MIR-6796-3P	98.68	65.49	689
HSA-MIR-4769-3P	97.95	68.17	1002
HSA-MIR-6817-5P	97.95	67.86	1026
HSA-MIR-6787-5P	97.54	63.85	457
HSA-MIR-134-5P	97.11	66.52	976
HSA-MIR-3118	97.11	66.58	984
HSA-MIR-1291	96.28	65.89	1224
HSA-MIR-6775-3P	95.76	65.91	982

Functional genomics

ClinGen dosage: haploinsufficiency 3 (sufficient evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 40)

• penetrance of mutations causing melanoma modified by MC1R genotype (PMID:11500805)
• expression is related to apoptosis in thymus (PMID:11642719)
• A method of detecting deletions in the INK4A gene is described in detail. (PMID:11692873)
• p16INK4a reversibly inhibited cell growth. CDKIs mediate growth arrest in human osteosarcoma cell lines and provides further evidence of the existence of molecular links between cellular mortality and immortality. (PMID:11695244)
• inhibits Plasmodium falciparum cyclin dependent protein kinases (PMID:11700040)
• Up-regulated p16 expression may represent a unique feature of aggressive neuroblastoma. (PMID:11705866)
• protein interaction mapping with Hdm2 (PMID:11718560)
• p16(INK4a) lesions are common, early abnormalities that undergo clonal expansion in Barrett’s metaplastic epithelium (PMID:11719461)
• The mutation creates a false GT splice donor site 105 bases 5’ of exon 3 and has been demonstrated to result in aberrant splicing of the mRNA. (PMID:11726555)
• In the ovarian cancer cell lines studied, cell growth was inhibited after transfection with p16(INK4a), p21(WAF1/Cip-1), and p53. (PMID:11733969)
• P16 gene silencing by hypermethylation is more common in null cell adenomas. The role of p16 in the pathogenesis of pituitary adenomas is restricted to specific tumor subtypes. (PMID:11740049)
• Aberrations of the p14(ARF) and p16(INK4a) genes in renal cell carcinomas (PMID:11749694)
• p16 protein was up-regulated in A549 cells treated with ATRA. (PMID:11758167)
• inactivation may not play an important role in the malignant transformation of ependymomas (PMID:11763427)
• Study suggested that p16 overexpression might play a role in the development and progression of pituitary adenomas. (PMID:11775544)
• Homozygous deletion of ink4A is associated with poor survival in primary central nervous system lymphoma patients (PMID:11804283)
• The percentage of families with two melanoma cases/family harboring a mutation was low (7%, 2/27), but rose to 45% (9/20) if one of the melanoma patients carried multiple melanomas or if pancreatic cancer was present in that family. (PMID:11807902)
• Analysis of the p16 gene status of non-familial dysplastic nevus syndrome patients. (PMID:11820732)
• p14(ARF) nuclear overexpression in aggressive B-cell lymphomas is a sensor of malfunction of the common tumor suppressor pathways. (PMID:11830494)
• Expression of wild-type p16(INK4a) and p53 genes in K562 cells results in reduced proliferation and apoptosis. Co-transfection with both genes significantly inhibited cell proliferation when compared to transfection with either p16(INK4a) or p53 gene. (PMID:11836163)
• Down-regulated p16 expression predicts poor prognosis in patients with extrahepatic biliary tract carcinomas (PMID:11836554)
• increased nucleolar expression of p14ARF and an absence of nucleolar or nucleoplasmic p14ARF/Hdm2 complexes in Reed Sternberg cells in Hodgkin’s lymphoma (PMID:11839577)
• distinct methylation pattern in bladder cancer with frequent methylation of RARbeta, DAPK, E-cadherin, and p16. (PMID:11839665)
• role in progession of mycosis fungoides (PMID:11850526)
• Transgenic expression leads to enhanced apoptosis and differentiation arrest of immature thymocytes (PMID:11859122)
• Losses of INK4a/INK4b gene products play a big role in meningioma formation & malignant progression. Inactivation of p16/p15 and pl4ARF pendent pathways possibly along with telomerase activation might be critical for meningioma immortalization. (PMID:11859969)
• Lower expression of p16 protein and overexpression of Cyclin D1 protein may be considered as prognostic biomarkers to skin carcinogenesis. (PMID:11860939)
• Human tumor suppressor ARF impedes S-phase progression independent of p53. (PMID:11861400)
• There was a statistically significant association between p16 gene deletion and early stage, well differentiated bladder transitional cell carcinoma. (PMID:11869511)
• Abnormal expression of p16 gene then becomes involved in the development and metastasis of breast cancer. (PMID:11869517)
• Frequent abnormalities of the p16 gene in mycosis fungoides and sezary syndrome. polymorphisms promoter methylation (PMID:11874489)
• ARF promoter is regulated by E2F through both direct binding to the promoter sequences and indirectly, probably by being tethered to the ARF promoter by Sp1-like factors. (PMID:11883935)
• Overexpression of p16INK4a can be used as an early marker of cervical cancer (PMID:11889694)
• that the tumor suppressor p16 may exert its antitumor effects through modulation of multiple aspects of glioblastoma phenotypes, including proliferation, invasiveness, and responsiveness to extracellular growth stimuli. (PMID:11908877)
• p16/INK4a gene inactivation by hypermethylation is associated with aggressive variants of monoclonal gammopathies. (PMID:11920239)
• loss of P16 protein by promoter methylation results in non small cell lung tumorigenesis (PMID:11920642)
• Alterations in genetic and epigenetic status of p14ARF is associated with osteosarcoma growth (PMID:11943335)
• Results indicate that p14ARF aberrant promoter methylation could be involved in bladder carcinogenesis and that plasma DNA is a potential prognostic marker in urinary bladder cancer. (PMID:11948103)
• Cirrhotic livers reveal genetic changes in the MDM2-P14ARF system of cell cycle regulators. (PMID:11953887)
• Glutathione S-transferase P1 and NADPH quinone oxidoreductase polymorphisms are associated with aberrant promoter methylation of P16(INK4a) and O(6)-methylguanine-DNA methyltransferase in sputum. (PMID:11956078)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Cdkn2a	ENSMUSG00000044303
rattus_norvegicus	Cdkn2a	ENSRNOG00000059837

Paralogs (1): CDKN2B (ENSG00000147883)

Protein

Protein identifiers

Cyclin-dependent kinase inhibitor 2A — P42771 (reviewed: P42771, Q8N726)

Alternative names: Cyclin-dependent kinase 4 inhibitor A, Multiple tumor suppressor 1, p16-INK4a

All UniProt accessions (6): P42771, Q8N726, J3QRG6, K7ENC6, K7ES20, K7PML8

UniProt curated annotations — full annotation on UniProt →

Function. Acts as a negative regulator of the proliferation of normal cells by interacting strongly with CDK4 and CDK6. This inhibits their ability to interact with cyclins D and to phosphorylate the retinoblastoma protein.

Subunit / interactions. Heterodimer with CDK4 or CDK6. Predominant p16 complexes contained CDK6. Interacts with CDK4 (both ‘T-172’-phosphorylated and non-phosphorylated forms); the interaction inhibits cyclin D-CDK4 kinase activity. Interacts with ISCO2.

Subcellular location. Cytoplasm. Nucleus.

Tissue specificity. Widely expressed but not detected in brain or skeletal muscle. Isoform 3 is pancreas-specific.

Post-translational modifications. Phosphorylation seems to increase interaction with CDK4.

Disease relevance. The association between cutaneous and uveal melanomas in some families suggests that mutations in CDKN2A may account for a proportion of uveal melanomas. However, CDKN2A mutations are rarely found in uveal melanoma patients. Melanoma, cutaneous malignant 2 (CMM2) [MIM:155601] A malignant neoplasm of melanocytes, arising de novo or from a pre-existing benign nevus, which occurs most often in the skin but may also involve other sites. Disease susceptibility is associated with variants affecting the gene represented in this entry. Familial atypical multiple mole melanoma-pancreatic carcinoma syndrome (FAMMMPC) [MIM:606719] An inherited cancer predisposition syndrome characterized by an increased risk of developing malignant melanoma and/or pancreatic cancer. Mutation carriers within families may develop either or both types of cancer. The disease is caused by variants affecting the gene represented in this entry. Melanoma-astrocytoma syndrome (MASTS) [MIM:155755] Characterized by a dual predisposition to melanoma and neural system tumors, commonly astrocytoma. The disease is caused by variants affecting the gene represented in this entry.

Miscellaneous. Barely detectable in non-tumor cells.

Similarity. Belongs to the CDKN2 cyclin-dependent kinase inhibitor family.

Isoforms (6)

UniProt ID	Names	Canonical?
P42771-1	1, p16INK4a	yes
P42771-2	2
P42771-3	3, p12
Q8N726-1	tumor suppressor ARF, p14ARF, p19ARF
P42771-4	5, p16gamma
Q8N726-2	smARF

RefSeq proteins (5): NP_000068, NP_001182061, NP_001350692, NP_478102, NP_478104 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR036770	Ankyrin_rpt-contain_sf	Homologous_superfamily
IPR050776	Ank_Repeat/CDKN_Inhibitor	Family
IPR010868	Tumor_suppres_ARF	Family

Pfam: PF07392

UniProt features (146 total): sequence variant 103, helix 7, turn 6, splice variant 5, strand 5, modified residue 5, repeat 4, sequence conflict 4, compositionally biased region 3, chain 2, region of interest 2

Structure

Experimental structures (PDB)

5 structures.

PDB	Method	Resolution (Å)
7OZT	X-RAY DIFFRACTION	1.74
1BI7	X-RAY DIFFRACTION	3.4
1A5E	SOLUTION NMR
1DC2	SOLUTION NMR
2A5E	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P42771-F1	77.02	0.01
AF-Q8N726-F1	64.69	0.02

Antibody-complex structures (SAbDab): 1 — 7OZT

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (5): 1, 7, 8, 140, 152

Function

Pathways and Gene Ontology

Reactome pathways

58 pathways

ID	Pathway
R-HSA-2559580	Oxidative Stress Induced Senescence
R-HSA-2559582	Senescence-Associated Secretory Phenotype (SASP)
R-HSA-2559585	Oncogene Induced Senescence
R-HSA-69231	Cyclin D associated events in G1
R-HSA-8853884	Transcriptional Regulation by VENTX
R-HSA-9630791	Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4
R-HSA-9630794	Evasion of Oncogene Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6
R-HSA-9632697	Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4
R-HSA-9632700	Evasion of Oxidative Stress Induced Senescence Due to Defective p16INK4A binding to CDK4 and CDK6
R-HSA-9825892	Regulation of MITF-M-dependent genes involved in cell cycle and proliferation
R-HSA-111471	Apoptotic factor-mediated response
R-HSA-3108214	SUMOylation of DNA damage response and repair proteins
R-HSA-3232118	SUMOylation of transcription factors
R-HSA-6804757	Regulation of TP53 Degradation
R-HSA-69541	Stabilization of p53
R-HSA-8941858	Regulation of RUNX3 expression and activity
R-HSA-9645722	Defective Intrinsic Pathway for Apoptosis Due to p14ARF Loss of Function
R-HSA-9646303	Evasion of Oncogene Induced Senescence Due to p14ARF Defects
R-HSA-9646304	Evasion of Oxidative Stress Induced Senescence Due to p14ARF Defects
R-HSA-9759194	Nuclear events mediated by NFE2L2
R-HSA-8951936	RUNX3 regulates p14-ARF
R-HSA-109581	Apoptosis
R-HSA-109606	Intrinsic Pathway for Apoptosis
R-HSA-1266738	Developmental Biology
R-HSA-1640170	Cell Cycle
R-HSA-1643685	Disease
R-HSA-212436	Generic Transcription Pathway
R-HSA-2262752	Cellular responses to stress
R-HSA-2559583	Cellular Senescence
R-HSA-2990846	SUMOylation

MSigDB gene sets: 745 (showing top): GOBP_REGULATION_OF_CELL_ACTIVATION, MODULE_52, GOBP_MEMBRANE_DEPOLARIZATION, GOBP_RIBOSOME_BIOGENESIS, GOBP_REGULATION_OF_LEUKOCYTE_PROLIFERATION, RODRIGUES_THYROID_CARCINOMA_ANAPLASTIC_UP, GOBP_NEGATIVE_REGULATION_OF_CELL_DEVELOPMENT, GOBP_POSITIVE_REGULATION_OF_DNA_DAMAGE_RESPONSE_SIGNAL_TRANSDUCTION_BY_P53_CLASS_MEDIATOR, GOBP_NEGATIVE_REGULATION_OF_PROTEOLYSIS, GOBP_REGULATION_OF_PHOSPHORYLATION, GOBP_POSITIVE_REGULATION_OF_LEUKOCYTE_APOPTOTIC_PROCESS, GOBP_NEGATIVE_REGULATION_OF_KINASE_ACTIVITY, GOBP_INTRACELLULAR_PROTEIN_TRANSPORT, GOBP_REGULATION_OF_LEUKOCYTE_APOPTOTIC_PROCESS, GOBP_B_CELL_ACTIVATION

GO Biological Process (60): negative regulation of transcription by RNA polymerase II (GO:0000122), negative regulation of cell-matrix adhesion (GO:0001953), Ras protein signal transduction (GO:0007265), negative regulation of cell population proliferation (GO:0008285), rRNA transcription (GO:0009303), keratinocyte differentiation (GO:0030216), negative regulation of cell growth (GO:0030308), mammary gland epithelial cell proliferation (GO:0033598), negative regulation of mammary gland epithelial cell proliferation (GO:0033600), positive regulation of smooth muscle cell apoptotic process (GO:0034393), somatic stem cell population maintenance (GO:0035019), glucose homeostasis (GO:0042593), keratinocyte proliferation (GO:0043616), negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736), negative regulation of DNA-templated transcription (GO:0045892), regulation of nucleocytoplasmic transport (GO:0046822), regulation of cell cycle (GO:0051726), apoptotic process involved in mammary gland involution (GO:0060057), positive regulation of apoptotic process involved in mammary gland involution (GO:0060058), cellular response to hydrogen peroxide (GO:0070301), cellular senescence (GO:0090398), replicative senescence (GO:0090399), oncogene-induced cell senescence (GO:0090402), regulation of G1/S transition of mitotic cell cycle (GO:2000045), negative regulation of ubiquitin-dependent protein catabolic process (GO:2000059), positive regulation of macrophage apoptotic process (GO:2000111), protein polyubiquitination (GO:0000209), autophagy of mitochondrion (GO:0000422), rRNA processing (GO:0006364), protein sumoylation (GO:0016925), nuclear body organization (GO:0030575), negative regulation of B cell proliferation (GO:0030889), regulation of protein stability (GO:0031647), protein destabilization (GO:0031648), negative regulation of immature T cell proliferation in thymus (GO:0033088), positive regulation of protein sumoylation (GO:0033235), protein localization to nucleus (GO:0034504), positive regulation of apoptotic process (GO:0043065), positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517), positive regulation of DNA-templated transcription (GO:0045893)

GO Molecular Function (14): RNA binding (GO:0003723), cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861), protein kinase binding (GO:0019901), NF-kappaB binding (GO:0051059), p53 binding (GO:0002039), DNA binding (GO:0003677), SUMO transferase activity (GO:0019789), ligase inhibitor activity (GO:0055104), ubiquitin-protein transferase inhibitor activity (GO:0055105), RNA polymerase II-specific DNA-binding transcription factor binding (GO:0061629), MDM2/MDM4 family protein binding (GO:0097371), disordered domain specific binding (GO:0097718), ubiquitin ligase inhibitor activity (GO:1990948), protein binding (GO:0005515)

GO Cellular Component (10): nucleus (GO:0005634), nucleolus (GO:0005730), cytoplasm (GO:0005737), cytosol (GO:0005829), senescence-associated heterochromatin focus (GO:0035985), nucleoplasm (GO:0005654), mitochondrion (GO:0005739), mitochondrial matrix (GO:0005759), protein-containing complex (GO:0032991), nuclear body (GO:0016604)

Reactome top-level categories

Rollup of top-14 pathways:

Category	Pathways
Cellular Senescence	3
Evasion of Oncogene Induced Senescence Due to p16INK4A Defects	2
Evasion of Oxidative Stress Induced Senescence Due to p16INK4A Defects	2
SUMO E3 ligases SUMOylate target proteins	2
Diseases of Cellular Senescence	2
G1 Phase	1
Generic Transcription Pathway	1
MITF-M-dependent gene expression	1
Intrinsic Pathway for Apoptosis	1
Regulation of TP53 Expression and Degradation	1
p53-Dependent G1 DNA Damage Response	1
Transcriptional regulation by RUNX3	1
Defective Intrinsic Pathway for Apoptosis	1
KEAP1-NFE2L2 pathway	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
negative regulation of cellular process	2
DNA-templated transcription	2
epithelial cell proliferation	2
cyclin-dependent protein serine/threonine kinase activity	2
nucleic acid binding	2
protein binding	2
enzyme inhibitor activity	2
intracellular membrane-bounded organelle	2
nuclear lumen	2
intracellular membraneless organelle	2
cytoplasm	2
regulation of transcription by RNA polymerase II	1
transcription by RNA polymerase II	1
negative regulation of DNA-templated transcription	1
regulation of cell-matrix adhesion	1
cell-matrix adhesion	1
negative regulation of cell-substrate adhesion	1
small GTPase-mediated signal transduction	1
cell population proliferation	1
regulation of cell population proliferation	1
rRNA metabolic process	1
epidermal cell differentiation	1
skin development	1
regulation of cell growth	1
cell growth	1
negative regulation of growth	1
mammary gland epithelium development	1
mammary gland epithelial cell proliferation	1
regulation of mammary gland epithelial cell proliferation	1
negative regulation of epithelial cell proliferation	1
negative regulation of multicellular organismal process	1
positive regulation of muscle cell apoptotic process	1
smooth muscle cell apoptotic process	1
regulation of smooth muscle cell apoptotic process	1
stem cell population maintenance	1
carbohydrate homeostasis	1
regulation of cyclin-dependent protein serine/threonine kinase activity	1
negative regulation of cell cycle	1
negative regulation of protein serine/threonine kinase activity	1

Protein interactions and networks

STRING

8510 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CDKN2A	CDK4	P11802	999
CDKN2A	MDM2	Q00987	999
CDKN2A	CDK6	Q00534	999
CDKN2A	NPM1	P06748	995
CDKN2A	CDK2	P24941	993
CDKN2A	CYTH1	Q15438	976
CDKN2A	TP53	P04637	970
CDKN2A	CCNL2	Q96S94	962
CDKN2A	CCND1	P24385	947
CDKN2A	ARF1	P10947	936
CDKN2A	CDKN1A	P38936	934
CDKN2A	MYC	P01106	929
CDKN2A	HIF1A	Q16665	928
CDKN2A	E2F1	Q01094	921
CDKN2A	KRAS	P01116	918

IntAct

146 interactions, top by confidence:

A	B	Type	Score
CDK4	CCND1	psi-mi:“MI:0914”(association)	0.990
CDK4	CCND3	psi-mi:“MI:0914”(association)	0.980
CDKN2A	CDK4	psi-mi:“MI:0915”(physical association)	0.960
CDK4	CDKN2A	psi-mi:“MI:0915”(physical association)	0.960
CDKN2A	CDK4	psi-mi:“MI:0914”(association)	0.960
CDK4	CDKN2A	psi-mi:“MI:0407”(direct interaction)	0.960
CDK4	CDKN2A	psi-mi:“MI:0914”(association)	0.960
CDKN2A	CDK4	psi-mi:“MI:0403”(colocalization)	0.960
CDKN2A	CDK4	psi-mi:“MI:0407”(direct interaction)	0.960
CDKN2A	CDK6	psi-mi:“MI:0407”(direct interaction)	0.950
CDK6	CDKN2A	psi-mi:“MI:0915”(physical association)	0.950
CDKN2A	CDK6	psi-mi:“MI:0915”(physical association)	0.950
CDK6	CDKN2A	psi-mi:“MI:0407”(direct interaction)	0.950
CDKN2A	CDK6	psi-mi:“MI:0403”(colocalization)	0.950
CDK6	CCND1	psi-mi:“MI:0914”(association)	0.880
YWHAB	PIK3C2A	psi-mi:“MI:0914”(association)	0.800
nef	ACOT8	psi-mi:“MI:0914”(association)	0.710
CDK4	HSP90AA1	psi-mi:“MI:0914”(association)	0.640
YWHAG	BLTP3B	psi-mi:“MI:0914”(association)	0.640
CDKN2A	PCNA	psi-mi:“MI:0914”(association)	0.610

BioGRID (655): BCL2L1 (Affinity Capture-MS), HSPA9 (Affinity Capture-MS), C1QBP (Affinity Capture-MS), CDKN2A (Affinity Capture-Western), CDKN2A (Affinity Capture-Western), BCL2L1 (Reconstituted Complex), MDM2 (Reconstituted Complex), BECN1 (Reconstituted Complex), CDKN2A (Affinity Capture-Western), CDKN2A (Reconstituted Complex), CDKN2A (Affinity Capture-RNA), CDKN2A (Affinity Capture-RNA), MDM2 (Affinity Capture-Western), CDKN2A (Affinity Capture-MS), CDKN2A (Affinity Capture-MS)

ESM2 similar proteins: A7E2S9, B9EHT4, O65020, O77617, O83617, P0AD37, P0AD38, P0AD39, P0DV51, P27238, P39492, P42570, P42771, P42772, P51480, P55271, P55272, P55273, P64930, P9WLM2, P9WLM3, Q00150, Q02184, Q05823, Q05921, Q07739, Q29RV0, Q2FUA9, Q2KJD8, Q2TXF6, Q3MHJ7, Q3SX00, Q5I149, Q5I156, Q5R686, Q5R8C8, Q6AY47, Q6TNT2, Q76K24, Q86W74

Diamond homologs: F1M5M3, O77617, P42771, P42772, P42773, P51480, P55271, P55272, P55273, Q29RV0, Q2KJD8, Q38998, Q60772, Q60773, Q91ZU1, Q9R0Z3, Q18297, Q28FJ2, Q6ZVH7, Q5R4M7, Q69ZR2, Q9NWX5, Q9ULT8, Q9VL06, A0A084B9Z8, Q25338, Q5ZLC8, Q8BTI7, Q8NB46, Q9J5I7, P53356, Q14161, Q3SX00, Q5R8C8, Q66H91, Q68FF6, Q76K24, Q86W74, Q8BTZ5, Q9JLQ2

SIGNOR signaling

26 interactions.

A	Effect	B	Mechanism
MYC	“down-regulates quantity by repression”	CDKN2A	“transcriptional regulation”
CDKN2A	down-regulates	CDK4	binding
CDKN2A	down-regulates	CDK6	binding
IKBKB	down-regulates	CDKN2A	phosphorylation
BMI1	“down-regulates quantity by repression”	CDKN2A	“transcriptional regulation”
CDKN2A	“down-regulates activity”	CyclinD/CDK4	binding
“UV stress”	up-regulates	CDKN2A
POMC	“up-regulates quantity by expression”	CDKN2A	“transcriptional regulation”
NDN	up-regulates	CDKN2A
TBX5	“up-regulates quantity by expression”	CDKN2A	“transcriptional regulation”
DNMT3A	“down-regulates quantity by repression”	CDKN2A	“transcriptional regulation”
“Polycomb repressive complex 2”	“down-regulates quantity by repression”	CDKN2A	“transcriptional regulation”
“SWI/SNF complex”	“up-regulates quantity by expression”	CDKN2A	“transcriptional regulation”
CTBP1	“down-regulates quantity by repression”	CDKN2A	“transcriptional regulation”
CDKN2A	down-regulates	Immortality
CDKN2A	down-regulates	Proliferation
CDKN2A	down-regulates	CyclinD1/CDK6	binding
PBX1	“up-regulates quantity by expression”	CDKN2A	“transcriptional regulation”
MEIS2	“up-regulates quantity by expression”	CDKN2A	“transcriptional regulation”
CDKN2A	down-regulates	CDK2	binding
ASXL1	“up-regulates quantity by expression”	CDKN2A	“transcriptional regulation”

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 117 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Defective binding of RB1 mutants to E2F1,(E2F2, E2F3)	6	42.8×	1e-07
Activation of BAD and translocation to mitochondria	5	42.8×	2e-06
Activation of the pre-replicative complex	11	40.3×	2e-13
Chk1/Chk2(Cds1) mediated inactivation of Cyclin B:Cdk1 complex	5	37.7×	3e-06
SARS-CoV-1 targets host intracellular signalling and regulatory pathways	5	37.7×	3e-06
Signaling by high-kinase activity BRAF mutants	10	35.6×	1e-11
Activation of ATR in response to replication stress	10	33.8×	2e-11
MAP2K and MAPK activation	10	32.1×	3e-11

GO biological processes:

GO term	Partners	Fold	FDR
DNA replication initiation	8	48.5×	3e-09
positive regulation of fibroblast proliferation	6	17.2×	2e-04
regulation of mitotic cell cycle	6	14.0×	6e-04
epidermal growth factor receptor signaling pathway	5	12.0×	5e-03
Ras protein signal transduction	6	12.0×	1e-03
G1/S transition of mitotic cell cycle	6	11.7×	1e-03
DNA replication	6	9.6×	4e-03
MAPK cascade	6	8.9×	5e-03

Disease & clinical

Cancer significance

From CIViC — curated cancer-variant interpretation:

CDKN2A loss has been shown to be a significant event in a number of cancer types. While no targeted therapeutic has been engaged in clinical trials, the prognostic impact has been studied by a number of meta-analyses. In majority of cases CDKN2A is inactivated by homozygous deletions. One of the mechanisms by which loss of CDKN2A can occur is by hypermethylation of the promoter region for the gene. However, the prognostic impact of promoter hypermethylation has been relatively ambiguous. Many studies have suggesting poorer prognostic outcome for patients with hypermethylation in colorectal, liver, and younger lung cancer patients. This being said, there is still research to be done before this becomes a widely-accepted prognostic indicator. Additionally, CDKN2A (p16) expression is a surrogate marker for HPV infection. As such, CDKN2A expression is prognostic in Oropharyngeal and probably also non-oropharyngeal head and neck squamous cell carcinomas.

From intOGen — cancer-driver classification: loss-of-function (tumor-suppressor-like) across 29 cancer types — ACYC, BLCA, BRCA, CHOL, COAD, COADREAD, CSCC, EGC, ESCA, ESCC, GBM, HCC…(+17 more).

Clinical variants and AI predictions

ClinVar

1611 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	112
Likely pathogenic	41
Uncertain significance	722
Likely benign	275
Benign	120

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1068946	NM_000077.5(CDKN2A):c.34del (p.Ser12fs)	Pathogenic
1069074	NM_000077.5(CDKN2A):c.126dup (p.Ser43Ter)	Pathogenic
1070481	NC_000009.11:g.(?21968228)(22160087_?)del	Pathogenic
1072356	NM_058195.4(CDKN2A):c.126_127insCA (p.Val43fs)	Pathogenic
1075589	NM_000077.5(CDKN2A):c.204_205delinsTT (p.Glu69Ter)	Pathogenic
1076895	NC_000009.11:g.(?21994128)(21994330_?)del	Pathogenic
1171238	NM_000077.5(CDKN2A):c.106del (p.Ala36fs)	Pathogenic
1409909	NM_000077.5(CDKN2A):c.95_112del (p.Leu32_Leu37del)	Pathogenic
142061	NM_000077.5(CDKN2A):c.47_50del (p.Leu16fs)	Pathogenic
1454814	NM_000077.5(CDKN2A):c.76G>T (p.Glu26Ter)	Pathogenic
1456941	NM_000077.5(CDKN2A):c.151-861_252del	Pathogenic
1457805	NC_000009.11:g.(?21970891)(21975027_?)del	Pathogenic
1510258	NM_000077.5(CDKN2A):c.457+2T>G	Pathogenic
1527514	GRCh37/hg19 9p21.3(chr9:21902071-22015434)	Pathogenic
1735064	NM_000077.5(CDKN2A):c.38_68del (p.Ala13fs)	Pathogenic
1752844	NM_000077.5(CDKN2A):c.122_123delinsT (p.Pro41fs)	Pathogenic
1768251	NM_000077.5(CDKN2A):c.97dup (p.Glu33fs)	Pathogenic
1781307	NM_000077.5(CDKN2A):c.185_196delinsA (p.Leu62fs)	Pathogenic
1782299	NM_000077.5(CDKN2A):c.19_22dup (p.Ser8fs)	Pathogenic
1789081	NM_000077.5(CDKN2A):c.228del (p.Thr77fs)	Pathogenic
1797039	NM_000077.5(CDKN2A):c.286del (p.Val96fs)	Pathogenic
1801528	NM_000077.5(CDKN2A):c.458-521G>T	Pathogenic
182409	NM_000077.5(CDKN2A):c.131_132insAA (p.Tyr44Ter)	Pathogenic
182410	NM_000077.4:c.206_229delAGCCCAACTGCGCCGACCCCGinsCAG	Pathogenic
182412	NM_000077.5(CDKN2A):c.240_253del (p.Pro81fs)	Pathogenic
182414	NM_058195.4(CDKN2A):c.194-3653G>T	Pathogenic
182416	NM_000077.5(CDKN2A):c.151-1G>C	Pathogenic
183759	NM_000077.5(CDKN2A):c.335_337dup (p.Arg112dup)	Pathogenic
2000623	NM_000077.5(CDKN2A):c.287_291del (p.Val96fs)	Pathogenic
2000887	NM_000077.5(CDKN2A):c.28G>T (p.Glu10Ter)	Pathogenic

SpliceAI

1710 predictions. Top by Δscore:

Variant	Effect	Δscore
9:21969645:C:CA	donor_gain	1.0000
9:21971204:ATGAC:A	acceptor_gain	1.0000
9:21971205:TGAC:T	acceptor_gain	1.0000
9:21971206:GACCT:G	acceptor_loss	1.0000
9:21971207:AC:A	acceptor_gain	1.0000
9:21971208:CC:C	acceptor_gain	1.0000
9:21971208:CCT:C	acceptor_loss	1.0000
9:21971209:C:CC	acceptor_gain	1.0000
9:21971209:CTGC:C	acceptor_loss	1.0000
9:21968240:TGT:T	acceptor_gain	0.9900
9:21968243:C:CC	acceptor_gain	0.9900
9:21969679:AGC:A	donor_gain	0.9900
9:21971206:GAC:G	acceptor_gain	0.9900
9:21971213:C:CT	acceptor_gain	0.9900
9:21971213:C:T	acceptor_gain	0.9900
9:21974673:CCCA:C	donor_loss	0.9900
9:21974674:CCA:C	donor_loss	0.9900
9:21974675:CACCT:C	donor_loss	0.9900
9:21974676:A:T	donor_loss	0.9900
9:21974677:C:CG	donor_loss	0.9900
9:21974930:T:TA	donor_gain	0.9900
9:21968346:A:AC	donor_gain	0.9800
9:21968409:C:A	donor_gain	0.9800
9:21971214:A:T	acceptor_gain	0.9800
9:21971342:T:TA	donor_gain	0.9800
9:21974699:A:C	donor_gain	0.9800
9:21993353:G:GT	donor_gain	0.9800
9:21968347:T:C	donor_gain	0.9700
9:21969646:C:A	donor_gain	0.9700
9:21969787:GCT:G	donor_gain	0.9700

AlphaMissense

983 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
9:21971102:G:T	A86D	0.996
9:21971037:C:G	D108H	0.992
9:21971018:G:T	P114H	0.989
9:21971036:T:A	D108V	0.989
9:21971105:G:T	A85D	0.989
9:21971036:T:G	D108A	0.985
9:21971035:A:C	D108E	0.984
9:21971035:A:T	D108E	0.984
9:21971089:G:C	F90L	0.983
9:21971089:G:T	F90L	0.983
9:21971091:A:G	F90L	0.983
9:21971037:C:A	D108Y	0.981
9:21971093:C:A	G89V	0.981
9:21971099:C:G	R87P	0.981
9:21971006:G:T	A118D	0.980
9:21974702:A:C	N42K	0.980
9:21974702:A:T	N42K	0.980
9:21971103:C:G	A86P	0.979
9:21971117:G:T	P81H	0.978
9:21971171:A:G	L63P	0.978
9:21974769:G:T	A20E	0.977
9:21971117:G:C	P81R	0.975
9:21971171:A:T	L63Q	0.975
9:21974682:A:T	I49N	0.974
9:21971018:G:C	P114R	0.973
9:21971106:C:G	A85P	0.972
9:21971168:A:G	L64P	0.971
9:21974691:C:G	R46P	0.971
9:21971078:A:G	L94P	0.969
9:21974685:G:C	P48R	0.968

dbSNP variants (sampled 300 via entrez): RS1000134582 (9:21983634 T>A), RS1000139090 (9:21974896 A>C,G,T), RS1000154513 (9:21982436 C>G), RS1000170568 (9:21995129 C>G), RS1000207799 (9:21982862 T>C,G), RS1000286686 (9:21969587 T>C), RS1000370747 (9:21975758 T>C), RS1000428671 (9:21969803 A>C,G,T), RS1000474515 (9:21976600 C>A), RS1000499478 (9:21981779 T>A), RS1000522288 (9:21984423 C>T), RS1000646513 (9:21988627 C>T), RS1000654479 (9:21977160 C>A), RS1001081670 (9:21988290 G>C), RS1001094833 (9:21995327 G>A)

Disease associations

OMIM: gene MIM:600160 | disease phenotypes: MIM:606719, MIM:155755, MIM:155601, MIM:260350, MIM:151623, MIM:609266, MIM:614569, MIM:167000, MIM:114550, MIM:613659, MIM:109800, MIM:607174, MIM:181500

GenCC curated gene-disease

Disease	Classification	Inheritance
melanoma-pancreatic cancer syndrome	Definitive	Autosomal dominant
melanoma, cutaneous malignant, susceptibility to, 2	Definitive	Autosomal dominant
familial atypical multiple mole melanoma syndrome	Supportive	Autosomal dominant
melanoma and neural system tumor syndrome	Limited	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
melanoma-pancreatic cancer syndrome	Definitive	AD

Mondo (23): hereditary neoplastic syndrome (MONDO:0015356), familial melanoma (MONDO:0018961), atypical endometrial hyperplasia (MONDO:0006096), melanoma-pancreatic cancer syndrome (MONDO:0011713), melanoma and neural system tumor syndrome (MONDO:0007967), melanoma, cutaneous malignant, susceptibility to, 2 (MONDO:0007964), familial pancreatic carcinoma (MONDO:0015278), Li-Fraumeni syndrome (MONDO:0018875), acute lymphoblastic leukemia (MONDO:0004967), osteoblastic osteosarcoma (MONDO:0020660), Maffucci syndrome (MONDO:0013808), ovarian cancer (MONDO:0008170), hepatocellular carcinoma (MONDO:0007256), squamous cell lung carcinoma (MONDO:0005097), gastric cancer (MONDO:0001056)

Orphanet (15): Inherited cancer-predisposing syndrome (Orphanet:140162), Familial melanoma (Orphanet:618), Familial atypical multiple mole melanoma syndrome (Orphanet:404560), Melanoma and neural system tumor syndrome (Orphanet:252206), Familial pancreatic carcinoma (Orphanet:1333), Li-Fraumeni syndrome (Orphanet:524), Acute lymphoblastic leukemia (Orphanet:513), Maffucci syndrome (Orphanet:163634), Rare ovarian cancer (Orphanet:213500), Hepatocellular carcinoma (Orphanet:88673), Familial multiple meningioma (Orphanet:263662), Retinoblastoma (Orphanet:790), NON RARE IN EUROPE: Melanoma (Orphanet:411533), NON RARE IN EUROPE: Bladder cancer (Orphanet:157980), NON RARE IN EUROPE: Schizophrenia (Orphanet:3140)

HPO phenotypes

96 total (30 of 96 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000080	Abnormality of reproductive system physiology
HP:0000488	Retinopathy
HP:0000737	Irritability
HP:0000739	Anxiety
HP:0000819	Diabetes mellitus
HP:0000822	Hypertension
HP:0000859	Increased circulating aldosterone concentration
HP:0000952	Jaundice
HP:0000958	Dry skin
HP:0000975	Hyperhidrosis
HP:0000998	Hypertrichosis
HP:0001065	Striae distensae
HP:0001324	Muscle weakness
HP:0001433	Hepatosplenomegaly
HP:0001480	Freckling
HP:0001595	Abnormal hair morphology
HP:0001738	Exocrine pancreatic insufficiency
HP:0001824	Weight loss
HP:0001909	Leukemia
HP:0001939	Abnormality of metabolism/homeostasis
HP:0001962	Palpitations
HP:0002017	Nausea and vomiting
HP:0002027	Abdominal pain
HP:0002039	Anorexia
HP:0002071	Abnormality of extrapyramidal motor function
HP:0002254	Intermittent diarrhea
HP:0002664	Neoplasm
HP:0002665	Lymphoma
HP:0002669	Osteosarcoma

GWAS associations

93 associations (top):

Study	Trait	p-value
GCST000024_7	Type 2 diabetes	8.000000e-15
GCST000025_5	Type 2 diabetes	1.000000e-06
GCST000025_8	Type 2 diabetes	5.000000e-06
GCST000028_2	Type 2 diabetes	8.000000e-15
GCST000030_1	Myocardial infarction	1.000000e-20
GCST000045_1	Coronary heart disease	1.000000e-13
GCST000167_5	Type 2 diabetes	2.000000e-07
GCST000262_3	Intracranial aneurysm	1.000000e-10
GCST000340_1	Myocardial infarction (early onset)	3.000000e-44
GCST000383_2	Type 2 diabetes	2.000000e-29
GCST000437_2	Melanoma	4.000000e-07
GCST000439_7	Glioma	7.000000e-15
GCST000646_5	Intracranial aneurysm	2.000000e-22
GCST000678_8	Breast cancer	3.000000e-08
GCST000712_25	Type 2 diabetes	1.000000e-10
GCST000727_1	Abdominal aortic aneurysm	2.000000e-08
GCST000945_3	Coronary artery disease	5.000000e-14
GCST000998_24	Coronary heart disease	1.000000e-22
GCST001058_3	Glioma	5.000000e-16
GCST001070_2	Type 2 diabetes	6.000000e-10
GCST001084_4	Coronary heart disease (SNP X SNP interaction)	7.000000e-14
GCST001260_2	Coronary heart disease	6.000000e-16
GCST001267_6	Melanoma	7.000000e-09
GCST001337_28	Platelet count	6.000000e-14
GCST001720_6	Endometriosis	2.000000e-09
GCST001759_5	Type 2 diabetes	3.000000e-06
GCST001902_2	Coronary artery calcification	2.000000e-11
GCST001937_3	Breast cancer	6.000000e-08
GCST002128_6	Type 2 diabetes	1.000000e-18
GCST002331_7	Basal cell carcinoma	3.000000e-10

EFO canonical traits (13, from GWAS)

EFO ID	Trait name
EFO:0004309	platelet count
EFO:0004723	coronary artery calcification
EFO:0007985	platelet crit
EFO:0005091	monocyte count
EFO:0004587	lymphocyte count
EFO:0007796	parental longevity
EFO:0005090	basophil count
EFO:0004842	eosinophil count
EFO:0007993	lymphocyte percentage of leukocytes
EFO:0004528	mean corpuscular hemoglobin concentration
EFO:0007990	neutrophil percentage of leukocytes
EFO:0009188	Red cell distribution width
EFO:0007788	BMI-adjusted waist-hip ratio

MeSH disease descriptors (11)

Descriptor	Name	Tree numbers
D006528	Carcinoma, Hepatocellular	C04.557.470.200.025.255; C04.588.274.623.160; C06.301.623.160; C06.552.697.160
D004416	Dysplastic Nevus Syndrome	C04.557.665.560.260; C04.700.305; C16.320.700.305
D016864	Li-Fraumeni Syndrome	C04.700.600; C16.320.700.600; C18.452.284.520
D008545	Melanoma	C04.557.465.625.650.510; C04.557.580.625.650.510; C04.557.665.510; C04.588.805.377; C17.800.882.445
D009386	Neoplastic Syndromes, Hereditary	C04.700; C16.320.700
D010051	Ovarian Neoplasms	C04.588.322.455; C12.050.351.500.056.630.705; C12.050.351.937.418.685; C12.100.250.056.630.705; C12.900.418.685; C19.344.410; C19.391.630.705
D012175	Retinoblastoma	C04.557.465.625.600.725; C04.557.470.670.725; C04.557.580.625.600.725; C04.588.364.818.760; C11.270.862; C11.319.475.760; C11.768.717.760
C536149	Melanoma astrocytoma syndrome (supp.)
C563985	Melanoma-Pancreatic Cancer Syndrome (supp.)
C537443	Meningioma, familial (supp.)
C535837	Pancreatic carcinoma, familial (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL4680027 (SINGLE PROTEIN)

Clinical evidence (CIViC)

Drug × variant × indication: 24 predictive associations from 24 curated evidence items; also 9 prognostic, 1 oncogenic, 1 predisposing.

Variant	Therapy	Indication	Effect	Level	CIViC
CDKN2A Deletion	Palbociclib	Gastrointestinal Stromal Tumor	Sensitivity/Response	CIViC B	EID7311
CDKN2A Loss OR CDKN2A Mutation	Palbociclib	Pancreatic Cancer	Sensitivity/Response	CIViC B	EID11653
CDKN2A Loss OR CDKN2A Mutation	Palbociclib	Biliary Tract Cancer	Sensitivity/Response	CIViC B	EID11654
CDKN2A Mutation	Palbociclib	Pancreatic Cancer	Sensitivity/Response	CIViC B	EID7299
CDKN2A Mutation	Palbociclib	Cholangiocarcinoma	Sensitivity/Response	CIViC B	EID7300
CDKN2A p16 Expression	Panitumumab	Head And Neck Squamous Cell Carcinoma	Sensitivity/Response	CIViC B	EID753
RB1 Wildtype AND ( CDKN2A Loss OR CDKN2A Mutation )	Palbociclib	Lung Non-small Cell Carcinoma	Sensitivity/Response	CIViC B	EID11665
CDKN2A Loss	Immune Checkpoint Inhibitor	Bladder Urothelial Carcinoma	Resistance	CIViC B	EID12546
CDKN2A Loss	Palbociclib	Lung Non-small Cell Carcinoma	Resistance	CIViC B	EID7444
CDKN2A Loss	Dabrafenib + Vemurafenib	Melanoma	Resistance	CIViC B	EID7679
CDKN2A p16 Expression	Afatinib	Head And Neck Squamous Cell Carcinoma	Resistance	CIViC B	EID1155
CDKN2A p16 Expression	Epidermal Growth Factor Receptor Tyrosine Kinase Inhibitor	Head And Neck Squamous Cell Carcinoma	Resistance	CIViC B	EID694
CDKN2A p16 Expression	Panitumumab	Head And Neck Squamous Cell Carcinoma	Resistance	CIViC B	EID696
CDKN2A p16 Expression	Cetuximab	Head And Neck Squamous Cell Carcinoma	Resistance	CIViC B	EID697
CDKN2A p16 Expression	Cetuximab	Oropharynx Cancer	Resistance	CIViC B	EID759
CDKN2A Loss	Letrozole + Palbociclib	Her2-receptor Negative Breast Cancer	Sensitivity/Response	CIViC C	EID1765
CDKN2A Loss	Alvocidib	Skin Melanoma	Sensitivity/Response	CIViC D	EID1372
CDKN2A Loss	Palbociclib	Renal Cell Carcinoma	Sensitivity/Response	CIViC D	EID1373
CDKN2A Loss	Palbociclib	Skin Melanoma	Sensitivity/Response	CIViC D	EID1375
CDKN2A Loss	Palbociclib	Ovarian Cancer	Sensitivity/Response	CIViC D	EID1377
CDKN2A Loss	Palbociclib	Glioblastoma	Sensitivity/Response	CIViC D	EID1559
CDKN2A Loss	Linsitinib + Palbociclib	Ewing Sarcoma	Sensitivity/Response	CIViC D	EID1879
CDKN2A Loss	Palbociclib	Dermatofibrosarcoma Protuberans	Sensitivity/Response	CIViC D	EID1881
CDKN2A p16 Expression	Palbociclib	Sarcoma	Resistance	CIViC D	EID4873

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs759922342	CDKN2A		0.00	0

CTD chemical–gene interactions

197 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Decitabine	increases phosphorylation, decreases expression, decreases reaction, decreases methylation, affects cotreatment (+5 more)	25
Arsenic Trioxide	decreases methylation, affects localization, decreases reaction, affects cotreatment, decreases expression (+2 more)	11
Arsenic	affects expression, decreases expression, increases expression, increases methylation	8
Valproic Acid	increases expression, increases methylation, affects expression	7
Particulate Matter	decreases reaction, affects binding, increases abundance, affects cotreatment, affects reaction (+3 more)	7
sodium arsenite	affects cotreatment, increases expression, decreases expression, increases methylation	6
Hydrogen Peroxide	affects expression, increases reaction, decreases reaction, increases expression	6
Quercetin	decreases reaction, decreases methylation, affects cotreatment, decreases expression, increases expression	6
Tobacco Smoke Pollution	decreases expression, increases expression, increases methylation	6
trichostatin A	affects expression, affects methylation, decreases expression, increases expression, affects cotreatment	5
Cisplatin	affects cotreatment, increases expression, decreases expression, decreases response to substance, affects expression (+1 more)	5
bisphenol A	affects cotreatment, decreases expression, increases expression, increases methylation	4
palbociclib	affects cotreatment, decreases response to substance, affects response to substance, increases response to substance	4
Cadmium Chloride	decreases reaction, affects cotreatment, increases expression, decreases expression, increases methylation (+1 more)	4
arsenite	decreases methylation, increases methylation, decreases reaction, affects binding, increases reaction (+1 more)	3
epigallocatechin gallate	decreases metabolic processing, decreases methylation, increases expression	3
Resveratrol	decreases reaction, increases expression, affects reaction, decreases expression	3
Asbestos	decreases expression, increases methylation, increases mutagenesis	3
Cannabidiol	increases reaction, affects cotreatment, increases expression	3
Copper	affects binding, decreases expression, increases activity, increases expression	3
Nanotubes, Carbon	decreases expression, increases expression	3
perfluorooctanoic acid	increases expression	2
butylidenephthalide	increases expression	2
monobutyl phthalate	affects cotreatment, decreases expression, increases methylation	2
hydroquinone	affects reaction, decreases expression, increases expression, decreases reaction	2
mercuric bromide	increases expression, affects cotreatment	2
mono-benzyl phthalate	decreases expression, increases methylation, affects cotreatment	2
(+)-JQ1 compound	decreases expression, increases expression	2
Irinotecan	decreases expression, increases response to substance, affects expression	2
Acetylcysteine	decreases reaction, increases expression, affects binding, increases abundance, increases reaction	2

ChEMBL screening assays

2 unique, capped per target: 2 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4678413	Binding	Inhibition of GFP-tagged p16INK4A (unknown orgin) expressed in human dermal fibroblast at 20 uM after 24 hrs by renilla/firefly dual-luciferase reporter assay relative to control	Phenolic Constituents of the Roots of Rhamnoneuron balansae with Senolytic Activity. — J Nat Prod

Cellosaurus cell lines

4,344 cell lines: 4,149 cancer cell line, 152 spontaneously immortalized cell line, 19 transformed cell line, 14 telomerase immortalized cell line, 9 finite cell line, 1 induced pluripotent stem cell

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_0002	HL-60	Cancer cell line	Female
CVCL_0020	U-138MG	Cancer cell line	Male
CVCL_0026	Capan-2	Cancer cell line	Male
CVCL_0031	MCF-7	Cancer cell line	Female
CVCL_0036	RT-4	Cancer cell line	Male
CVCL_0039	SK-MEL-30	Cancer cell line	Male
CVCL_0040	WM115	Cancer cell line	Female
CVCL_0062	MDA-MB-231	Cancer cell line	Female
CVCL_0078	SNU-5	Cancer cell line	Female
CVCL_0080	A-673	Cancer cell line	Female

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT07462663	PHASE4	NOT_YET_RECRUITING	SHAPE-ENDO: Multimodal Pre-Surgical Optimization in Patients With Obesity and Early-Stage Endometrial Cancer (Phase 1)
NCT00114348	PHASE4	COMPLETED	ALL-REZ BFM 2002: Multi-Center Study for Children With Relapsed Acute Lymphoblastic Leukemia
NCT00192673	PHASE4	UNKNOWN	Poly(Ethylene Glycol)(PEG)-Asparaginase During Two Treatment Courses
NCT00222612	PHASE4	UNKNOWN	Medical Research Council (MRC) Working Party on Leukaemia in Children UK National Acute Lymphoblastic Leukaemia (ALL) Trial: UKALL 2003
NCT00411541	PHASE4	COMPLETED	Pulses of Vincristine and Dexamethasone in BFM Protocols for Children With Acute Lymphoblastic Leukemia
NCT00494897	PHASE4	COMPLETED	PETHEMA LAL-RI/96: Treatment for Patients With Standard Risk Acute Lymphoblastic Leukemia
NCT00526175	PHASE4	COMPLETED	LAL-BR/2001: Study Treatment to Low Risk ALL
NCT00526305	PHASE4	COMPLETED	LAL-Ph-2000: Treatment of Acute Lymphoblastic Leukemia Chromosome Philadelphia Positive
NCT00526409	PHASE4	COMPLETED	LAL-AR-N-2005:Study Treatment for Children High Risk Acute Lymphoblastic Leukemia
NCT00576472	PHASE4	COMPLETED	Learning Impairments Among Survivors of Childhood Cancer
NCT00797810	PHASE4	UNKNOWN	Intensification Therapy of Mature B-ALL, Burkitt and Burkitt Like and Other High Grade Non-Hodgkin’s Lymphoma in Adults
NCT00846703	PHASE4	UNKNOWN	The GD-2008 ALL Protocol for Childhood Acute Lymphoblastic Leukemia
NCT00853008	PHASE4	COMPLETED	Treatment of High Risk Adult Acute Lymphoblastic Leukemia
NCT01358201	PHASE4	UNKNOWN	PETHEMA LAL-07FRAIL: All Treatment In Fragile Patients Ph’ Negative Over 55 Years
NCT01358253	PHASE4	COMPLETED	Rituximab Plus Chemotherapy for CD20+ Adult Acute Lymphoblastic Leukemia
NCT01366898	PHASE4	UNKNOWN	Protocol For the Treatment Acute Lymphoblastic Leukemia With Ph ‘Negative in Elderly Patients (> 55 Years)
NCT01735955	PHASE4	COMPLETED	Study to Allow Access to Nilotinib for Patients Who Are on Nilotinib Treatment in a Novartis-sponsored Study
NCT01873807	PHASE4	UNKNOWN	HD-Idarubicin/Etoposide Intensified Conditioning Regimen Allo-HSCT for Adult ALL
NCT01906671	PHASE4	UNKNOWN	Study on Two Different Formulations of 6-mercaptopurine. Tablet Versus Oral Liquid
NCT02447718	PHASE4	COMPLETED	Vaccinating Children After Chemotherapy
NCT02670564	PHASE4	UNKNOWN	ALL SCTped FORUM - Pharmacogenomic Study (add-on Study)
NCT02894645	PHASE4	UNKNOWN	Malaysia-Singapore Acute Lymphoblastic Leukemia 2010 Study
NCT02933333	PHASE4	UNKNOWN	G-CSF Alone or Combination With GM-CSF on Prevention and Treatment of Infection in Children With Malignant Tumor
NCT02953730	PHASE4	COMPLETED	The Study on the Pharmacokinetics of PEG-rhG-CSF in Children and Adolescents
NCT03677596	PHASE4	COMPLETED	A Study Of Two Inotuzumab Ozogamicin Doses in Relapsed/ Refractory Acute Lymphoblastic Leukemia Transplant Eligible Patients
NCT03920813	PHASE4	UNKNOWN	Determinants of Mercaptopurine Toxicity in Paediatric Acute Lymphoblastic Leukemia Maintenance Therapy
NCT05133310	PHASE4	UNKNOWN	Effect of Simvastatin on Sepsis and Febrile Neutropenia in Patients With Acute Lymphoblastic Leukemia
NCT05687032	PHASE4	COMPLETED	A Study of Inotuzumab Ozogamicin in Chinese Patients With Relapsed or Refractory Acute Lymphoblastic Leukemia
NCT06289673	PHASE4	RECRUITING	Identification of Necessary Information for Treatment Induction in Newly Diagnosed Acute Lymphoblastic Leukemia/Lymphoma
NCT06918054	PHASE4	RECRUITING	Hepatoprotective for Children and Adolescent With Acute Lymphoblastic Leukemia
NCT06918080	PHASE4	ACTIVE_NOT_RECRUITING	Hepatoprotective Measures for Children at High Risk of NAFLD
NCT07016165	PHASE4	RECRUITING	Ciprofloxacin vs Ceftazidime for Empirical Treatment of High-Risk Neutropenic Fever in Children With Hematologic Malignancies
NCT07320534	PHASE4	NOT_YET_RECRUITING	Levofloxacin Prophylaxis to Prevent First Febrile Neutropenia in Pediatric ALL During Induction Phase
NCT00490087	PHASE3	COMPLETED	Resectoscopic Treatment of Atypical Endometrial Polyps in Fertile Women
NCT01464086	PHASE3	COMPLETED	LIFSCREEN : Evaluation of Whole Body MRI for Early Detection of Cancers in Subjects With P53 Mutation (Li-Fraumeni Syndrome)
NCT00075725	PHASE3	COMPLETED	Dexamethasone Compared With Prednisone During Induction Therapy and Methotrexate With or Without Leucovorin During Maintenance Therapy in Treating Patients With Newly Diagnosed High-Risk Acute Lymphoblastic Leukemia
NCT00103285	PHASE3	COMPLETED	Combination Chemotherapy in Treating Young Patients With Newly Diagnosed Acute Lymphoblastic Leukemia
NCT00131027	PHASE3	UNKNOWN	High-Dose Methotrexate (MTX) for Adult Acute Lymphoblastic Leukemia (ALL)
NCT00137111	PHASE3	COMPLETED	Therapy for Newly Diagnosed Patients With Acute Lymphoblastic Leukemia
NCT00152139	PHASE3	COMPLETED	Stem Cell Transplantation for Patients With Hematologic Malignancies