CDON

Summary

CDON (cell adhesion associated, oncogene regulated, HGNC:17104) is a protein-coding gene on chromosome 11q24.2, encoding Cell adhesion molecule-related/down-regulated by oncogenes (Q4KMG0). Component of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells.

This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis.

Source: NCBI Gene 50937 — RefSeq curated summary.

At a glance

• Gene–disease (curated): holoprosencephaly 11 (Definitive, GenCC) — +1 more curated relationship
• GWAS associations: 11
• Clinical variants (ClinVar): 820 total — 4 pathogenic, 2 likely-pathogenic
• Phenotypes (HPO): 133
• MANE Select transcript: NM_001378964

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:17104
Approved symbol	CDON
Name	cell adhesion associated, oncogene regulated
Location	11q24.2
Locus type	gene with protein product
Status	Approved
Aliases	ORCAM, CDO, CDON1, Ihog
Ensembl gene	ENSG00000064309
Ensembl biotype	protein_coding
OMIM	608707
Entrez	50937

Gene structure

Transcript identifiers

Ensembl transcripts: 26 — 10 protein_coding, 10 retained_intron, 4 nonsense_mediated_decay, 2 protein_coding_CDS_not_defined

ENST00000263577, ENST00000392693, ENST00000525625, ENST00000531738, ENST00000531830, ENST00000680589, ENST00000682450, ENST00000682556, ENST00000682796, ENST00000682834, ENST00000683026, ENST00000683416, ENST00000683597, ENST00000683716, ENST00000683981, ENST00000684078, ENST00000684167, ENST00000684238, ENST00000684564, ENST00000684636, ENST00000919649, ENST00000919650, ENST00000919651, ENST00000919652, ENST00000919653, ENST00000961444

RefSeq mRNA: 3 — MANE Select: NM_001378964 NM_001243597, NM_001378964, NM_016952

CCDS: CCDS58192, CCDS8468

Canonical transcript exons

ENST00000531738 — 20 exons

Exon	Start	End
ENSE00000749572	125961724	125961998
ENSE00000991231	126015241	126015510
ENSE00000991234	126003902	126004076
ENSE00000991235	126001719	126001850
ENSE00000991236	125997207	125997410
ENSE00000991237	125994871	125995052
ENSE00000991239	125989637	125989759
ENSE00000991240	125983872	125984093
ENSE00000991241	125981049	125981329
ENSE00000991242	125978304	125978383
ENSE00001384670	126023401	126023537
ENSE00001695557	125994284	125994389
ENSE00002199460	126062579	126062866
ENSE00003474338	126021248	126021520
ENSE00003621923	126017088	126017375
ENSE00003623102	126018330	126018473
ENSE00003632475	126005759	126006057
ENSE00003682232	126010341	126010694
ENSE00003791108	126019619	126019765
ENSE00003914096	125956821	125961105

Expression profiles

Bgee: expression breadth ubiquitous, 222 present calls, max score 99.14.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 3.8691 / max 139.7566, expressed in 1005 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
123013	3.4914	951
123014	0.3777	199

Top tissues by expression

281 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ventricular zone	UBERON:0003053	99.14	gold quality
ganglionic eminence	UBERON:0004023	96.06	gold quality
calcaneal tendon	UBERON:0003701	93.27	gold quality
germinal epithelium of ovary	UBERON:0001304	92.88	gold quality
synovial joint	UBERON:0002217	92.87	gold quality
parietal pleura	UBERON:0002400	92.64	gold quality
left uterine tube	UBERON:0001303	90.84	gold quality
skin of hip	UBERON:0001554	88.71	gold quality
ovary	UBERON:0000992	88.27	gold quality
cortical plate	UBERON:0005343	88.20	gold quality
right ovary	UBERON:0002118	87.67	gold quality
left ovary	UBERON:0002119	87.57	gold quality
tendon	UBERON:0000043	87.37	gold quality
tendon of biceps brachii	UBERON:0008188	86.63	gold quality
smooth muscle tissue	UBERON:0001135	85.91	gold quality
thyroid gland	UBERON:0002046	85.71	gold quality
cerebellar hemisphere	UBERON:0002245	85.67	gold quality
cerebellar cortex	UBERON:0002129	85.62	gold quality
cartilage tissue	UBERON:0002418	85.59	gold quality
left lobe of thyroid gland	UBERON:0001120	85.55	gold quality
right lobe of thyroid gland	UBERON:0001119	85.40	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	85.14	gold quality
right hemisphere of cerebellum	UBERON:0014890	85.07	gold quality
body of uterus	UBERON:0009853	84.35	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	84.28	gold quality
upper leg skin	UBERON:0004262	84.23	gold quality
cerebellum	UBERON:0002037	84.07	gold quality
gall bladder	UBERON:0002110	84.00	gold quality
muscle layer of sigmoid colon	UBERON:0035805	83.32	gold quality
omental fat pad	UBERON:0010414	83.24	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.42
E-MTAB-6108	no	225.85

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

145 targeting CDON, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-4768-5P	100.00	69.49	2861
HSA-MIR-4713-3P	100.00	65.92	505
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-181A-5P	99.99	72.96	2995
HSA-MIR-181B-5P	99.99	72.97	2996
HSA-MIR-181C-5P	99.99	72.95	2996
HSA-MIR-181D-5P	99.99	73.04	2997
HSA-MIR-548AW	99.99	72.57	3559
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593
HSA-MIR-1185-2-3P	99.98	71.04	2593
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-4482-3P	99.98	72.50	3147
HSA-MIR-548AN	99.97	70.91	2817
HSA-MIR-3688-3P	99.97	72.02	2834
HSA-MIR-495-3P	99.96	72.81	4197

Literature-anchored findings (GeneRIF, showing 14)

• Targeted inactivation of Cdon in the mouse results in mild holoprosencephaly, suggesting a link to signaling pathways that control midline development such as the Sonic hedgehog pathway. (PMID:12620190)
• CDO and BOC forms complexes with specific cadherins that mediate some of the promyogenic effects of cell-cell contact. (PMID:12634428)
• CDO and BOC play a role in differentiation of cells in the skeletal muscle lineage (PMID:12720294)
• Hedgehog proteins interact with cell adhesion molecule, down-regulated by oncogenes (CDO) and brother of CDO (BOC) in a conserved manner (PMID:20519495)
• CDON must associate with both ligand and other hedgehog-receptor components, particularly PTCH1, for signaling to occur and disruption of the latter interactions is a mechanism of holoprosencephaly. (PMID:21802063)
• We found that CDON is overexpressed in prostate cancer (PMID:21849809)
• Mutations in the CDON cause holoprosencephaly. (Review) (PMID:22326621)
• Single-nucleotide polymorphism in CDON is associated with biochemical recurrence in prostate cancer. (PMID:24740842)
• These data support the view that cell-adhesion molecule-related/downregulated by oncogenes (CDON) acts as a tumor suppressor in neuroblastomas, and that CDON is tightly regulated by miRNAs. (PMID:25313246)
• CDO is required for proliferation and survival of lung cancer cells via Hh signaling. (PMID:25369201)
• We identified a novel heterozygous nonsense CDON mutation in a case of Pituitary Stalk Interruption Syndrome who presented with neonatal hypoglycemia and cholestasis (PMID:26529631)
• Compound heterozygous splicing CDON variants result in isolated ocular coloboma. (PMID:32729136)
• Exome sequencing in patients with microphthalmia, anophthalmia, and coloboma (MAC) from a consanguineous population. (PMID:32799327)
• Cdon suppresses vascular smooth muscle calcification via repression of the Wnt/Runx2 Axis. (PMID:36609601)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	cdon	ENSDARG00000061328
mus_musculus	Cdon	ENSMUSG00000038119
rattus_norvegicus	Cdon	ENSRNOG00000011789

Paralogs (36): CNTN1 (ENSG00000018236), NEO1 (ENSG00000067141), SDK2 (ENSG00000069188), IGSF9B (ENSG00000080854), IGSF9 (ENSG00000085552), NRCAM (ENSG00000091129), MXRA5 (ENSG00000101825), IGDCC4 (ENSG00000103742), CNTN3 (ENSG00000113805), IGSF21 (ENSG00000117154), CNTN6 (ENSG00000134115), CHL1 (ENSG00000134121), PTPRQ (ENSG00000139304), CNTN4 (ENSG00000144619), BOC (ENSG00000144857), SDK1 (ENSG00000146555), HMCN2 (ENSG00000148357), NCAM1 (ENSG00000149294), CNTN5 (ENSG00000149972), IGSF10 (ENSG00000152580), ROBO4 (ENSG00000154133), ROBO3 (ENSG00000154134), NCAM2 (ENSG00000154654), VCAM1 (ENSG00000162692), NFASC (ENSG00000163531), PRTG (ENSG00000166450), ROBO1 (ENSG00000169855), DSCAM (ENSG00000171587), IGDCC3 (ENSG00000174498), VSIG10 (ENSG00000176834), DSCAML1 (ENSG00000177103), CNTN2 (ENSG00000184144), ROBO2 (ENSG00000185008), VSIG10L (ENSG00000186806), DCC (ENSG00000187323), L1CAM (ENSG00000198910)

Protein

Protein identifiers

Cell adhesion molecule-related/down-regulated by oncogenes — Q4KMG0 (reviewed: Q4KMG0)

All UniProt accessions (5): Q4KMG0, A0A804HKV0, A0A804HL16, E9PN78, H0YCZ4

UniProt curated annotations — full annotation on UniProt →

Function. Component of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells. Promotes differentiation of myogenic cells.

Subunit / interactions. Part of a complex that contains BOC, CDON, NEO1, cadherins and CTNNB1. Interacts with NTN3. Interacts with PTCH1. Interacts with GAS1. Interacts with DHH, IHH and SHH.

Subcellular location. Cell membrane.

Post-translational modifications. N-glycosylated.

Disease relevance. Holoprosencephaly 11 (HPE11) [MIM:614226] A form of holoprosencephaly, a structural anomaly of the brain in which the developing forebrain fails to correctly separate into right and left hemispheres. It is a genetically and clinically heterogeneous disorder with a wide spectrum of severity, ranging from alobar holoprosencephaly with severe facial abnormalities, such as cyclopia and proboscis, to mild forms that include lobar or microform holoprosencephaly, without cerebral malformations and with mild craniofacial defects. HPE11 inheritance is autosomal dominant. The disease is caused by variants affecting the gene represented in this entry.

Isoforms (2)

UniProt ID	Names	Canonical?
Q4KMG0-1	1	yes
Q4KMG0-2	2

RefSeq proteins (3): NP_001230526, NP_001365893, NP_058648 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003598	Ig_sub2	Domain
IPR003599	Ig_sub	Domain
IPR003961	FN3_dom	Domain
IPR007110	Ig-like_dom	Domain
IPR013098	Ig_I-set	Domain
IPR013783	Ig-like_fold	Homologous_superfamily
IPR036116	FN3_sf	Homologous_superfamily
IPR036179	Ig-like_dom_sf	Homologous_superfamily

Pfam: PF00041, PF07679, PF13927

UniProt features (57 total): sequence variant 10, glycosylation site 9, domain 8, strand 8, disulfide bond 5, sequence conflict 5, region of interest 3, topological domain 2, helix 2, signal peptide 1, chain 1, compositionally biased region 1, transmembrane region 1, splice variant 1

Structure

Experimental structures (PDB)

3 structures.

PDB	Method	Resolution (Å)
3N1F	X-RAY DIFFRACTION	1.6
3D1M	X-RAY DIFFRACTION	1.7
3N1Q	X-RAY DIFFRACTION	2.89

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q4KMG0-F1	62.62	0.11

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (5): 50–97, 141–191, 243–290, 333–380, 426–500

Glycosylation sites (9): 88, 100, 180, 287, 294, 342, 427, 570, 873

Function

Pathways and Gene Ontology

Reactome pathways

7 pathways

ID	Pathway
R-HSA-525793	Myogenesis
R-HSA-5632681	Ligand-receptor interactions
R-HSA-5635838	Activation of SMO
R-HSA-1266738	Developmental Biology
R-HSA-162582	Signal Transduction
R-HSA-5358351	Signaling by Hedgehog
R-HSA-5632684	Hedgehog ‘on’ state

MSigDB gene sets: 534 (showing top): WAMUNYOKOLI_OVARIAN_CANCER_LMP_DN, GOBP_BODY_MORPHOGENESIS, WANG_CLIM2_TARGETS_UP, GOBP_REGULATION_OF_SKELETAL_MUSCLE_TISSUE_DEVELOPMENT, GOBP_MUSCLE_TISSUE_DEVELOPMENT, MYOGENIN_Q6, GOBP_CELLULAR_RESPONSE_TO_LIPID, GOBP_POSITIVE_REGULATION_OF_NEURON_DIFFERENTIATION, GRAESSMANN_APOPTOSIS_BY_SERUM_DEPRIVATION_UP, GRAESSMANN_RESPONSE_TO_MC_AND_SERUM_DEPRIVATION_UP, GOBP_STRIATED_MUSCLE_CELL_DIFFERENTIATION, GOBP_REGULATION_OF_SMALL_GTPASE_MEDIATED_SIGNAL_TRANSDUCTION, GOBP_POSITIVE_REGULATION_OF_MAPK_CASCADE, GOBP_NEUROGENESIS, GOBP_REGULATION_OF_WNT_SIGNALING_PATHWAY

GO Biological Process (29): cell fate specification (GO:0001708), positive regulation of neuroblast proliferation (GO:0002052), lens development in camera-type eye (GO:0002088), cell adhesion (GO:0007155), smoothened signaling pathway (GO:0007224), nervous system development (GO:0007399), neuroblast proliferation (GO:0007405), myoblast fusion (GO:0007520), anterior/posterior pattern specification (GO:0009952), embryonic body morphogenesis (GO:0010172), skeletal muscle satellite cell differentiation (GO:0014816), central nervous system neuron differentiation (GO:0021953), cerebral cortex development (GO:0021987), positive regulation of MAPK cascade (GO:0043410), positive regulation of neuron differentiation (GO:0045666), positive regulation of transcription by RNA polymerase II (GO:0045944), positive regulation of skeletal muscle tissue development (GO:0048643), positive regulation of small GTPase mediated signal transduction (GO:0051057), embryonic retina morphogenesis in camera-type eye (GO:0060059), negative regulation of biomineral tissue development (GO:0070168), cellular response to vitamin D (GO:0071305), negative regulation of canonical Wnt signaling pathway (GO:0090090), cell-cell adhesion (GO:0098609), skeletal muscle tissue development (GO:0007519), neuron differentiation (GO:0030182), regulation of neuron differentiation (GO:0045664), embryonic morphogenesis (GO:0048598), striated muscle cell differentiation (GO:0051146), neural precursor cell proliferation (GO:0061351)

GO Molecular Function (2): coreceptor activity (GO:0015026), protein binding (GO:0005515)

GO Cellular Component (2): plasma membrane (GO:0005886), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-4 pathways:

Category	Pathways
Hedgehog ‘on’ state	2
Developmental Biology	1
Signal Transduction	1
Signaling by Hedgehog	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
anatomical structure development	2
embryonic morphogenesis	2
neuron differentiation	2
positive regulation of intracellular signal transduction	2
cell fate commitment	1
cellular developmental process	1
neuroblast proliferation	1
positive regulation of neurogenesis	1
regulation of neuroblast proliferation	1
positive regulation of neural precursor cell proliferation	1
camera-type eye development	1
cellular process	1
cell surface receptor signaling pathway	1
system development	1
generation of neurons	1
neural precursor cell proliferation	1
syncytium formation by cell-cell fusion	1
myotube differentiation	1
regionalization	1
body morphogenesis	1
skeletal muscle cell differentiation	1
central nervous system development	1
pallium development	1
MAPK cascade	1
regulation of MAPK cascade	1
positive regulation of cell differentiation	1
regulation of neuron differentiation	1
regulation of transcription by RNA polymerase II	1
transcription by RNA polymerase II	1
positive regulation of DNA-templated transcription	1
skeletal muscle tissue development	1
positive regulation of striated muscle tissue development	1
regulation of skeletal muscle tissue development	1
small GTPase-mediated signal transduction	1
regulation of small GTPase mediated signal transduction	1
retina morphogenesis in camera-type eye	1
biomineral tissue development	1
negative regulation of developmental process	1
regulation of biomineral tissue development	1
signaling receptor activity	1

Protein interactions and networks

STRING

1008 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CDON	SHH	Q15465	978
CDON	PTCH1	Q13635	978
CDON	GAS1	P54826	958
CDON	TNNT1	P13805	769
CDON	DHH	O43323	709
CDON	IHH	Q14623	681
CDON	PTCH2	Q9Y6C5	668
CDON	SMO	Q99835	652
CDON	CDH2	P19022	644
CDON	DISP1	Q96F81	644
CDON	SCUBE2	Q9NQ36	629
CDON	GLI2	P10070	604
CDON	HHIP	Q96QV1	549
CDON	GLI1	P08151	533
CDON	FN1	P02751	526

IntAct

27 interactions, top by confidence:

A	B	Type	Score
Shh	CDON	psi-mi:“MI:0407”(direct interaction)	0.760
TNFSF8	TOR1B	psi-mi:“MI:0914”(association)	0.640
DHH	CDON	psi-mi:“MI:0407”(direct interaction)	0.560
SLC39A5	TMEM223	psi-mi:“MI:0914”(association)	0.530
PCDHGB1	FAM171A2	psi-mi:“MI:0914”(association)	0.530
PVR	ORC4	psi-mi:“MI:0914”(association)	0.530
RYK	PCDH7	psi-mi:“MI:0914”(association)	0.530
CDON	ABL1	psi-mi:“MI:0915”(physical association)	0.520
CDON	Ihh	psi-mi:“MI:0407”(direct interaction)	0.440
IHH	CDON	psi-mi:“MI:0407”(direct interaction)	0.440
CDON	PTCH1	psi-mi:“MI:0915”(physical association)	0.400
PTCH1	CDON	psi-mi:“MI:0915”(physical association)	0.400
CTLA4	TMEM120B	psi-mi:“MI:0914”(association)	0.350
PVR	QSOX1	psi-mi:“MI:0914”(association)	0.350
RYK	TNFRSF10B	psi-mi:“MI:0914”(association)	0.350
PCDH12	PCDH17	psi-mi:“MI:0914”(association)	0.350
CEACAM21	MET	psi-mi:“MI:0914”(association)	0.350
SLC30A7	ESYT2	psi-mi:“MI:0914”(association)	0.350

BioGRID (30): CDON (Two-hybrid), CDON (Affinity Capture-MS), CDH15 (Affinity Capture-Western), CDON (Affinity Capture-MS), CDON (Affinity Capture-MS), CDON (Affinity Capture-MS), CDON (Affinity Capture-MS), CDON (Affinity Capture-MS), CDON (Affinity Capture-MS), CDON (Affinity Capture-RNA), CDON (Affinity Capture-MS), CTNNB1 (Affinity Capture-Western), CDH2 (Affinity Capture-Western), CDON (Affinity Capture-MS), CDON (Affinity Capture-MS)

ESM2 similar proteins: A0A6I8TCE0, B0X4T2, F1NY98, O00533, O35158, O55005, O60469, O89026, O97394, P12960, P14781, P16092, P17790, P18460, P18461, P21802, P21803, P28685, P29074, P35331, P35832, P57097, P70232, P97686, Q12860, Q12866, Q28106, Q32MD9, Q3UH53, Q4KMG0, Q60805, Q61851, Q63198, Q7Z5N4, Q7ZXX1, Q810U4, Q8AV58, Q8AXZ4, Q8JG38, Q8VHZ8

Diamond homologs: A1KZ92, A8WGA3, B3MKS0, B3N666, B3NS99, B4GKZ8, B4HY03, B4JEF2, B4KJW1, B4LRN7, B4N072, B4NZY8, B4Q599, D3YXG0, E1C8P7, O15146, P0C7J6, P25033, Q05695, Q05BQ1, Q1HLC0, Q29JX6, Q2WF71, Q3URE9, Q4KMG0, Q4VA61, Q6WRI0, Q7L985, Q86TC9, Q8NDA2, Q8TD84, Q90478, Q91987, Q9P244, Q9VM64, Q9VZZ4, A4IGL7, G5EG78, O35158, Q01973

SIGNOR signaling

11 interactions.

A	Effect	B	Mechanism
CDON	“form complex”	CDON/SPAG9	binding
CDON	“up-regulates activity”	SPAG9	binding
CDH2	up-regulates	CDON	binding
CDON	“up-regulates activity”	BNIP2	binding
CDON	“up-regulates activity”	MAPK14	binding
CDON	“up-regulates activity”	ABL1	binding
CDH15	“up-regulates activity”	CDON	binding
CDON	“form complex”	CDON/BOC/PTCH1	binding
CDON	unknown	MAP3K5	binding
CDON	unknown	MAP3K7	binding

Disease & clinical

Clinical variants and AI predictions

ClinVar

820 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	4
Likely pathogenic	2
Uncertain significance	444
Likely benign	148
Benign	159

Top pathogenic / likely-pathogenic (6)

Variant ID	HGVS	Classification
30748	NM_001378964.1(CDON):c.2339T>A (p.Val780Glu)	Pathogenic
30749	NM_001378964.1(CDON):c.2368A>G (p.Thr790Ala)	Pathogenic
812909	Single allele	Pathogenic
978570	NM_001378964.1(CDON):c.2764G>A (p.Glu922Lys)	Pathogenic
30747	NM_001378964.1(CDON):c.2065C>G (p.Pro689Ala)	Likely pathogenic
637955	NM_001378964.1(CDON):c.622C>T (p.Arg208Ter)	Likely pathogenic

SpliceAI

3993 predictions. Top by Δscore:

Variant	Effect	Δscore
11:125961675:G:C	donor_gain	1.0000
11:125961717:T:A	donor_gain	1.0000
11:125983865:GACTT:G	donor_loss	1.0000
11:125983866:ACTTA:A	donor_loss	1.0000
11:125983869:T:TG	donor_loss	1.0000
11:125983870:A:AC	donor_gain	1.0000
11:125983870:AC:A	donor_loss	1.0000
11:125983871:C:CC	donor_gain	1.0000
11:125983871:CT:C	donor_gain	1.0000
11:125983871:CTT:C	donor_gain	1.0000
11:125983871:CTTT:C	donor_gain	1.0000
11:125984089:TTTCA:T	acceptor_gain	1.0000
11:125984090:TTCA:T	acceptor_gain	1.0000
11:125984091:TCA:T	acceptor_gain	1.0000
11:125984092:CA:C	acceptor_gain	1.0000
11:125984092:CAC:C	acceptor_gain	1.0000
11:125984093:ACTAG:A	acceptor_loss	1.0000
11:125984094:C:CC	acceptor_gain	1.0000
11:125984098:T:C	acceptor_gain	1.0000
11:125984098:T:TC	acceptor_gain	1.0000
11:125984103:A:AC	acceptor_gain	1.0000
11:125984103:A:C	acceptor_gain	1.0000
11:125984105:A:C	acceptor_gain	1.0000
11:125989631:TCCTA:T	donor_loss	1.0000
11:125989632:CCTAC:C	donor_loss	1.0000
11:125989633:CTACC:C	donor_loss	1.0000
11:125989634:TACC:T	donor_loss	1.0000
11:125989636:CCTTT:C	donor_loss	1.0000
11:125989755:TGAAC:T	acceptor_gain	1.0000
11:125989756:GAAC:G	acceptor_gain	1.0000

AlphaMissense

4216 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
11:125994876:A:G	W847R	1.000
11:125994876:A:T	W847R	1.000
11:125995037:A:G	F793S	1.000
11:125997353:A:T	V739D	1.000
11:125997271:C:A	W766C	0.999
11:125997271:C:G	W766C	0.999
11:125997273:A:G	W766R	0.999
11:125997273:A:T	W766R	0.999
11:125997302:A:T	V756D	0.999
11:125997348:A:G	W741R	0.999
11:125997348:A:T	W741R	0.999
11:125994334:C:G	R867P	0.998
11:125994881:A:G	L845P	0.998
11:125995018:G:C	N799K	0.998
11:125995018:G:T	N799K	0.998
11:125995031:A:T	V795D	0.998
11:125995044:A:C	Y791D	0.998
11:125997297:A:C	Y758D	0.998
11:125997308:A:G	F754S	0.998
11:125997359:A:T	V737D	0.998
11:125989712:A:C	Y900D	0.997
11:125994348:A:C	F862L	0.997
11:125994348:A:T	F862L	0.997
11:125994350:A:G	F862L	0.997
11:125995019:T:A	N799I	0.997
11:125995036:A:C	F793L	0.997
11:125995036:A:T	F793L	0.997
11:125995038:A:G	F793L	0.997
11:125997224:A:T	V782D	0.997
11:125997307:G:C	F754L	0.997

dbSNP variants (sampled 300 via entrez): RS1000019671 (11:126014712 G>A,C), RS1000077559 (11:125984866 G>T), RS1000082517 (11:126056251 A>G), RS1000113608 (11:126056015 G>A,C,T), RS1000130293 (11:126025982 C>G), RS1000179138 (11:126024248 CTTAGAGGACACAGAGAAGGGGAATGATG>C), RS1000203065 (11:126008877 C>T), RS1000220701 (11:126037711 T>C), RS1000236513 (11:125969656 T>C), RS1000301408 (11:126044530 A>G), RS1000320410 (11:125990796 G>A), RS1000329302 (11:125972375 C>T), RS1000353639 (11:126054266 G>C), RS1000363866 (11:125963897 C>T), RS1000403118 (11:125972751 G>A)

Disease associations

OMIM: gene MIM:608707 | disease phenotypes: MIM:614226, MIM:236100, MIM:610805, MIM:188025

GenCC curated gene-disease

Disease	Classification	Inheritance
holoprosencephaly 11	Definitive	Autosomal dominant
pituitary stalk interruption syndrome	Supportive	Autosomal dominant

Mondo (9): holoprosencephaly 11 (MONDO:0013642), peripheral precocious puberty (MONDO:0015791), holoprosencephaly 1 (MONDO:0009349), intellectual disability (MONDO:0001071), congenital anomaly of kidney and urinary tract (MONDO:0019719), coloboma (MONDO:0001476), Paris-Trousseau thrombocytopenia (MONDO:0008557), microcephaly (MONDO:0001149), pituitary stalk interruption syndrome (MONDO:0019828)

Orphanet (7): Holoprosencephaly (Orphanet:2162), Rare peripheral precocious puberty (Orphanet:178040), Renal or urinary tract malformation (Orphanet:93545), OBSOLETE: Ocular coloboma (Orphanet:194), Paris-Trousseau thrombocytopenia (Orphanet:851), Pituitary stalk interruption syndrome (Orphanet:95496), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

133 total (30 of 133 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000028	Cryptorchidism
HP:0000062	Ambiguous genitalia
HP:0000104	Renal agenesis
HP:0000119	Abnormality of the genitourinary system
HP:0000161	Median cleft upper lip
HP:0000175	Cleft palate
HP:0000193	Bifid uvula
HP:0000202	Orofacial cleft
HP:0000218	High palate
HP:0000238	Hydrocephalus
HP:0000252	Microcephaly
HP:0000256	Macrocephaly
HP:0000322	Short philtrum
HP:0000407	Sensorineural hearing impairment
HP:0000446	Narrow nasal bridge
HP:0000453	Choanal atresia
HP:0000457	Depressed nasal ridge
HP:0000463	Anteverted nares
HP:0000478	Abnormality of the eye
HP:0000486	Strabismus
HP:0000520	Proptosis
HP:0000574	Thick eyebrow
HP:0000601	Hypotelorism
HP:0000612	Iris coloboma
HP:0000664	Synophrys
HP:0000708	Atypical behavior
HP:0000716	Depression
HP:0000736	Short attention span
HP:0000737	Irritability

GWAS associations

11 associations (top):

Study	Trait	p-value
GCST001658_12	Alzheimer’s disease (late onset)	3.000000e-06
GCST002030_5	Primary tooth development (time to first tooth eruption)	4.000000e-08
GCST004183_2	Lung function (FEV1)	5.000000e-10
GCST006585_2186	Blood protein levels	2.000000e-48
GCST008155_51	Waist-hip ratio	4.000000e-06
GCST008159_17	Waist-to-hip ratio adjusted for BMI	4.000000e-07
GCST008394_6	Mild to moderate chronic kidney disease	7.000000e-07
GCST008839_338	Height	1.000000e-09
GCST009206_7	Cerebral white matter volume	7.000000e-06
GCST010426_4	Systolic blood pressure x educational attainment (some college) interaction (2df)	5.000000e-08
GCST010426_5	Systolic blood pressure x educational attainment (some college) interaction (2df)	1.000000e-07

EFO canonical traits (6, from GWAS)

EFO ID	Trait name
EFO:0004314	forced expiratory volume
EFO:0004343	waist-hip ratio
EFO:0007788	BMI-adjusted waist-hip ratio
EFO:0008320	white matter volume measurement
EFO:0004784	self reported educational attainment
EFO:0006335	systolic blood pressure

MeSH disease descriptors (4)

Descriptor	Name	Tree numbers
D003103	Coloboma	C11.250.110; C11.270.147; C16.131.384.282
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D008831	Microcephaly	C05.660.207.620; C10.500.507.400.500; C16.131.621.207.620; C16.131.666.507.400.500
C566906	Cakut (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

51 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression, affects expression, decreases methylation	8
trichostatin A	affects cotreatment, increases expression, affects expression	4
epigallocatechin gallate	decreases expression, increases expression, affects cotreatment	2
Vorinostat	increases expression, affects cotreatment	2
Panobinostat	affects cotreatment, increases expression	2
Phenylmercuric Acetate	increases expression, affects cotreatment	2
Tobacco Smoke Pollution	decreases expression	2
Tretinoin	decreases expression	2
Aflatoxin B1	increases methylation	2
aristolochic acid I	decreases expression	1
bisphenol F	affects cotreatment, increases expression	1
bisphenol A	affects cotreatment, increases expression	1
beta-lapachone	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	increases expression	1
sodium arsenite	affects cotreatment, decreases expression, increases abundance	1
manganese chloride	affects cotreatment, decreases expression, increases abundance	1
benzo(e)pyrene	increases methylation	1
potassium chromate(VI)	affects cotreatment, decreases expression	1
aflatoxin B2	increases methylation	1
lei gong teng	increases expression	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
abrine	decreases expression	1
quinocetone	increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
jinfukang	increases expression	1
(+)-JQ1 compound	increases expression	1
Irinotecan	decreases expression	1
Leflunomide	increases expression	1
Air Pollutants	decreases expression, increases abundance	1

Clinical trials (associated diseases)

202 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT06760546	PHASE3	RECRUITING	A Trial of Setmelanotide in Patients With Congenital Hypothalamic Obesity (Sub-study of NCT05774756)
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT05273320	PHASE1	COMPLETED	Clinical Trial of Nabilone for Aggression in Adults With Intellectual and Developmental Disabilities
NCT05301361	PHASE1	ENROLLING_BY_INVITATION	Sensitivity of the NIH Toolbox to Stimulant Treatment in Intellectual Disabilities
NCT06016764	PHASE1	COMPLETED	Use of MRI and cTBS for Catatonia in Autism
NCT06586827	PHASE1	COMPLETED	Impact of Competency-Based Training and Technical Assistance Employment Outcomes of Individuals With ID/DD
NCT07531940	PHASE1	NOT_YET_RECRUITING	Escalating Doses of Memantine in Down Syndrome (MEDS-123)
NCT04115345	PHASE1	COMPLETED	A Study of a Renal Autologous Cell Therapy (REACT) in Patients With Chronic Kidney Disease (CKD) From Congenital Anomalies of the Kidney and Urinary Tract (CAKUT).
NCT05694169	PHASE1	TERMINATED	A Study of Participants With Chronic Kidney Disease Previously Treated With REACT
NCT03479476	PHASE2/PHASE3	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome
NCT02616796	PHASE1/PHASE2	COMPLETED	Effects of Social Gaze Training on Brain and Behavior in Fragile X Syndrome
NCT06860672	EARLY_PHASE1	RECRUITING	Clinical Trial of the Dual Vector Base Editor for the Treatment of the CHD3-R1025W Mutation
NCT00597948	Not specified	COMPLETED	Healthy Lifestyles for People With Intellectual Disabilities
NCT01087320	Not specified	RECRUITING	Genome Medical Sequencing for Gene Discovery
NCT01652963	Not specified	UNKNOWN	Picture-based Computerised Assessment and Training of Cognitive Behaviour Therapy Skills
NCT01695395	Not specified	COMPLETED	Mental Health Care Provision for Adults With Intellectual Disability and a Mental Disorder
NCT01867554	Not specified	COMPLETED	Research and Characterization of New Genes Involved in Intellectual Disability
NCT01915381	Not specified	COMPLETED	Improving Adherence Healthy Lifestyle With a Smartphone Application Based on Adults With Intellectual Disabilities
NCT01988623	Not specified	COMPLETED	Pivotal Response Treatment for Individuals With Intellectual Disabilities
NCT02099773	Not specified	COMPLETED	Support Staff-client Interactions With Augmentative and Alternative Communication
NCT02136849	Not specified	COMPLETED	Inter-regional Project of the Great Western Exploration Approach for Exome Molecular Causes Severe Intellectual Disability Isolated or Syndromic
NCT02225041	Not specified	COMPLETED	Sedation Strategy and Cognitive Outcome After Critical Illness in Early Childhood
NCT02414438	Not specified	COMPLETED	Establishing the Clinical Utility of First StepDx PLUS and NextStepDx PLUS Study
NCT02451761	Not specified	COMPLETED	Apparently Balanced Chromosomal Translocation/ Next-generation Sequencing/ Intellectual Disability
NCT02461420	Not specified	ACTIVE_NOT_RECRUITING	Mapping the Genotype, Phenotype, and Natural History of Phelan-McDermid Syndrome
NCT02461459	Not specified	ACTIVE_NOT_RECRUITING	Autism Spectrum Disorder (ASD) and Intellectual Disability (ID) Determinants in Tuberous Sclerosis Complex (TSC)
NCT02486081	Not specified	COMPLETED	Development and Application-Smart Football for Movement Evaluation and Training in the Special Education Population
NCT02504502	Not specified	COMPLETED	Enhancing Genomic Laboratory Reports to Enhance Communication and Empower Patients
NCT02513277	Not specified	COMPLETED	Diabetes Screening & Prevention for People With Learning (Intellectual) Disabilities:STOP Diabetes Study
NCT02561754	Not specified	COMPLETED	Weight Management for Adolescents With IDD
NCT02591446	Not specified	COMPLETED	Transcranial Magnetic Stimulation Studies in Autism Spectrum Disorders
NCT02714868	Not specified	COMPLETED	Evaluation of Project TEAM (Teens Making Environmental and Activity Modifications)