CEACAM4

Summary

CEACAM4 (CEA cell adhesion molecule 4, HGNC:1816) is a protein-coding gene on chromosome 19q13.2, encoding Cell adhesion molecule CEACAM4 (O75871). Granulocyte orphan receptor that acts as an trigger efficient phagocytosis of attached particles.

Predicted to enable protein tyrosine kinase binding activity. Involved in phagocytosis. Predicted to be located in membrane. Predicted to be active in cell surface and plasma membrane.

Source: NCBI Gene 1089 — automated summary from GO annotations (Alliance of Genome Resources).

At a glance

• GWAS associations: 2
• Clinical variants (ClinVar): 47 total
• GTEx eGene: eQTL in 22 tissues, sQTL in 3 (q < 0.05)
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.45 (unconstrained)
• MANE Select transcript: NM_001817

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:1816
Approved symbol	CEACAM4
Name	CEA cell adhesion molecule 4
Location	19q13.2
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000105352
Ensembl biotype	protein_coding
OMIM	619159
Entrez	1089

Gene structure

Transcript identifiers

Ensembl transcripts: 8 — 7 protein_coding, 1 retained_intron

MANE Select: ENST00000221954

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 2: 2

ENST00000221954, ENST00000472081, ENST00000600925, ENST00000902906, ENST00001028485, ENST00001093480, ENST00001093481, ENST00001143378

RefSeq mRNA: 4 — MANE Select: NM_001817 NM_001362492, NM_001362493, NM_001362495, NM_001817

CCDS: CCDS33033

Canonical transcript exons

ENST00000221954 — 7 exons

Exon	Start	End
ENSE00000708545	41625601	41625960
ENSE00000842460	41619670	41619711
ENSE00000842461	41620211	41620242
ENSE00001322806	41619015	41619395
ENSE00002493926	41621651	41621768
ENSE00002514344	41620575	41620627
ENSE00003554911	41626900	41627074

Expression profiles

Bgee: expression breadth ubiquitous, 126 present calls, max score 95.65.

FANTOM5 (CAGE): breadth broad, TPM avg 3.1596 / max 431.5855, expressed in 241 samples.

Highest expression (Bgee): blood, monocyte, spleen, leukocyte, granulocyte.

Genetic regulation across tissues (GTEx eQTL / sQTL)

CEACAM4 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 22 tissues and its splicing (sQTL) in 3 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 25 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Whole Blood	sqtl	4.9e-68	+0.89	19:41620075:C:T
Whole Blood	eqtl	8.9e-33	-0.21	19:41619287:C:T
Nerve Tibial	eqtl	1.2e-13	-0.25	19:41609565:A:G
Artery Tibial	eqtl	2.1e-12	-0.24	19:41621829:A:G
Spleen	sqtl	1.0e-10	+0.79	19:41618000:A:AACCTGTGGCAGTGGCAGAACACTCTTGGG
Lung	eqtl	7.0e-07	-0.13	19:41609565:A:G
Esophagus Mucosa	eqtl	1.1e-06	-0.18	19:41609815:C:G
Pancreas	eqtl	1.5e-04	+0.94	19:41597766:G:A
Breast Mammary Tissue	eqtl	2.8e-04	-0.19	19:41632519:T:C
Spleen	eqtl	4.8e-04	-0.74	19:41664392:C:A
Adrenal Gland	eqtl	6.9e-04	-0.38	19:41624402:A:G
Skin Sun Exposed Lower leg	eqtl	7.6e-04	-0.15	19:41619287:C:T
Brain Putamen basal ganglia	eqtl	1.3e-03	-1.50	19:40670091:C:T
Esophagus Muscularis	eqtl	1.3e-03	-0.20	19:41609766:A:G
Adipose Visceral Omentum	eqtl	2.7e-03	-0.11	19:41609766:A:G
Lung	sqtl	5.3e-03	-0.37	19:41619287:C:T
Colon Transverse	eqtl	5.9e-03	-0.18	19:41609766:A:G
Esophagus Gastroesophageal Junction	eqtl	7.9e-03	-0.21	19:41610711:A:G
Small Intestine Terminal Ileum	eqtl	8.1e-03	-0.30	19:41608577:T:C
Vagina	eqtl	1.2e-02	+3.10	19:40838571:C:T

FANTOM5 promoters

2 alternative TSS:

Promoter ID	TPM avg	Samples expressed
181082	2.9506	226
181081	0.2090	59

Top tissues by expression

showing 100 of 134 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
blood	UBERON:0000178	95.65	gold quality
monocyte	CL:0000576	89.71	gold quality
spleen	UBERON:0002106	89.46	gold quality
leukocyte	CL:0000738	89.36	gold quality
granulocyte	CL:0000094	87.54	gold quality
bone marrow	UBERON:0002371	85.94	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	82.26	silver quality
bone marrow cell	CL:0002092	81.48	gold quality
vermiform appendix	UBERON:0001154	81.21	gold quality
right lung	UBERON:0002167	80.83	gold quality
upper lobe of left lung	UBERON:0008952	73.50	gold quality
lymph node	UBERON:0000029	67.02	gold quality
lung	UBERON:0002048	66.74	gold quality
smooth muscle tissue	UBERON:0001135	66.17	gold quality
gall bladder	UBERON:0002110	66.02	gold quality
right coronary artery	UBERON:0001625	65.92	gold quality
left uterine tube	UBERON:0001303	65.33	gold quality
descending thoracic aorta	UBERON:0002345	64.63	gold quality
placenta	UBERON:0001987	63.10	gold quality
small intestine Peyer’s patch	UBERON:0003454	62.45	gold quality
mucosa of stomach	UBERON:0001199	62.24	gold quality
omental fat pad	UBERON:0010414	61.84	gold quality
small intestine	UBERON:0002108	61.46	gold quality
left coronary artery	UBERON:0001626	61.07	gold quality
duodenum	UBERON:0002114	60.83	gold quality
esophagus mucosa	UBERON:0002469	60.53	gold quality
adipose tissue	UBERON:0001013	60.39	gold quality
heart left ventricle	UBERON:0002084	60.35	gold quality
tibial nerve	UBERON:0001323	59.78	gold quality
body of pancreas	UBERON:0001150	59.30	gold quality
subcutaneous adipose tissue	UBERON:0002190	59.01	gold quality
apex of heart	UBERON:0002098	58.82	gold quality
thoracic aorta	UBERON:0001515	58.61	gold quality
right adrenal gland	UBERON:0001233	58.26	gold quality
ascending aorta	UBERON:0001496	57.94	gold quality
minor salivary gland	UBERON:0001830	57.84	gold quality
heart	UBERON:0000948	57.58	gold quality
left adrenal gland cortex	UBERON:0035825	57.54	gold quality
esophagus	UBERON:0001043	57.41	gold quality
right adrenal gland cortex	UBERON:0035827	57.29	gold quality
liver	UBERON:0002107	57.12	gold quality
prostate gland	UBERON:0002367	57.10	gold quality
right lobe of liver	UBERON:0001114	56.68	gold quality
left adrenal gland	UBERON:0001234	56.66	gold quality
body of stomach	UBERON:0001161	56.59	gold quality
saliva-secreting gland	UBERON:0001044	56.58	gold quality
urinary bladder	UBERON:0001255	56.37	gold quality
intestine	UBERON:0000160	56.29	gold quality
transverse colon	UBERON:0001157	55.44	gold quality
muscle layer of sigmoid colon	UBERON:0035805	55.39	gold quality
colon	UBERON:0001155	55.08	gold quality
tibial artery	UBERON:0007610	54.98	gold quality
right atrium auricular region	UBERON:0006631	54.97	gold quality
popliteal artery	UBERON:0002250	54.95	gold quality
adrenal gland	UBERON:0002369	54.92	gold quality
fallopian tube	UBERON:0003889	54.64	gold quality
rectum	UBERON:0001052	54.53	gold quality
lower esophagus muscularis layer	UBERON:0035833	54.40	gold quality
lower esophagus	UBERON:0013473	54.34	gold quality
material anatomical entity	UBERON:0000465	54.08	gold quality
anatomical system	UBERON:0000467	54.08	gold quality
multicellular organism	UBERON:0000468	54.08	gold quality
myometrium	UBERON:0001296	53.34	gold quality
stomach	UBERON:0000945	53.29	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	53.28	gold quality
vagina	UBERON:0000996	53.18	gold quality
right lobe of thyroid gland	UBERON:0001119	52.13	gold quality
gastrocnemius	UBERON:0001388	52.08	gold quality
mucosa of transverse colon	UBERON:0004991	52.01	gold quality
endocervix	UBERON:0000458	51.90	gold quality
pancreas	UBERON:0001264	51.81	gold quality
tonsil	UBERON:0002372	51.63	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	51.56	gold quality
sural nerve	UBERON:0015488	51.52	silver quality
thoracic mammary gland	UBERON:0005200	51.17	gold quality
metanephros cortex	UBERON:0010533	50.81	gold quality
body of uterus	UBERON:0009853	50.40	gold quality
muscle of leg	UBERON:0001383	50.39	gold quality
ectocervix	UBERON:0012249	49.47	gold quality
left lobe of thyroid gland	UBERON:0001120	49.43	gold quality
muscle tissue	UBERON:0002385	49.35	gold quality
uterine cervix	UBERON:0000002	49.27	gold quality
substantia nigra	UBERON:0002038	49.21	gold quality
adult mammalian kidney	UBERON:0000082	49.11	gold quality
fundus of stomach	UBERON:0001160	48.61	gold quality
right ovary	UBERON:0002118	48.12	gold quality
calcaneal tendon	UBERON:0003701	48.10	silver quality
skin of leg	UBERON:0001511	48.09	gold quality
lower esophagus mucosa	UBERON:0035834	47.92	gold quality
thyroid gland	UBERON:0002046	47.83	gold quality
zone of skin	UBERON:0000014	46.67	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	46.58	gold quality
hindlimb stylopod muscle	UBERON:0004252	46.00	gold quality
cortex of kidney	UBERON:0001225	45.61	gold quality
kidney	UBERON:0002113	45.13	gold quality
skin of abdomen	UBERON:0001416	45.08	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	44.76	silver quality
Ammon’s horn	UBERON:0001954	43.84	gold quality
pituitary gland	UBERON:0000007	43.57	gold quality
amygdala	UBERON:0001876	43.17	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	6.34

HPA expression

RNA tissue specificity: Tissue enriched

48 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM
Bone marrow	tissue	7.1
Pancreas	tissue	2.0
Spleen	tissue	1.7
Appendix	tissue	1.7
Vagina	tissue	0.6
Choroid plexus	tissue	0.6
Medulla oblongata	tissue	0.6
Lymph node	tissue	0.5
Lung	tissue	0.5
Liver	tissue	0.5
Gallbladder	tissue	0.5
Urinary bladder	tissue	0.4
Amygdala	tissue	0.4
Duodenum	tissue	0.4
Pituitary gland	tissue	0.3
Stomach 1	tissue	0.3
Cerebral cortex	tissue	0.3
Pons	tissue	0.3
Adipose tissue	tissue	0.3
Basal ganglia	tissue	0.3
Midbrain	tissue	0.3
Thalamus	tissue	0.3
Hypothalamus	tissue	0.3
Substantia nigra	tissue	0.3
Spinal cord	tissue	0.3
Endometrium 1	tissue	0.2
Putamen	tissue	0.2
Placenta	tissue	0.2
Cerebellum	tissue	0.2
Hippocampus	tissue	0.2
Adrenal gland	tissue	0.2
Hippocampal formation	tissue	0.2
Retrosplenial cortex	tissue	0.2
Occipital cortex	tissue	0.2
Heart muscle	tissue	0.1
Ovary	tissue	0.1
Esophagus	tissue	0.1
Salivary gland	tissue	0.1
Rectum	tissue	0.1
Skeletal muscle	tissue	0.1
Smooth muscle	tissue	0.1
Colon	tissue	0.1
Small intestine	tissue	0.1
Locus coeruleus	tissue	0.1
Prostate	tissue	0.1
Thymus	tissue	0.1
Tonsil	tissue	0.1
Postcentral gyrus	tissue	0.1

Brain sub-regions (HPA Brain Atlas): detected in 164; highest nTPM — Blood vessel (1.4), Nucleus raphe pallidus (0.6), Area postrema (0.4), Corticomedial amygdala (0.4), Medial olivary nucleus (0.4).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting CEACAM4 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

6 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-488-5P	99.28	68.12	821
HSA-MIR-4291	99.20	68.88	2969
HSA-MIR-892C-5P	99.16	70.56	2116
HSA-MIR-5100	99.11	67.52	1098
HSA-MIR-6852-3P	98.54	67.60	1468
HSA-MIR-4468	98.01	66.85	1187

Functional genomics

gnomAD constraint: pLI 2.75e-10, LOEUF 1.45, missense Z -0.485 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000221954 — one region, missense o/e 1.07.

Literature-anchored findings (GeneRIF, showing 2)

• CEACAM4 is expressed in tumor-derived cell lines, and this expression is specific to an medullary thyroid carcinoma derived cell line. (PMID:25152032)
• CEACAM4 has phagocytic function. (PMID:25567962)

Cross-species orthologs

0 orthologs

Paralogs (24): CEACAM21 (ENSG00000007129), CEACAM7 (ENSG00000007306), CEACAM1 (ENSG00000079385), CEACAM6 (ENSG00000086548), CEACAM5 (ENSG00000105388), PSG8 (ENSG00000124467), CEACAM8 (ENSG00000124469), HEPACAM (ENSG00000165478), PSG6 (ENSG00000170848), CEACAM3 (ENSG00000170956), PSG9 (ENSG00000183668), CEACAM19 (ENSG00000186567), HEPACAM2 (ENSG00000188175), PSG5 (ENSG00000204941), CEACAM18 (ENSG00000213822), CEACAM16 (ENSG00000213892), VSTM5 (ENSG00000214376), PSG3 (ENSG00000221826), PSG7 (ENSG00000221878), PSG1 (ENSG00000231924), PSG2 (ENSG00000242221), PSG11 (ENSG00000243130), PSG4 (ENSG00000243137), CEACAM20 (ENSG00000273777)

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Rattus norvegicus	D3ZQE1	97.4%	Diamond
Mus musculus	E9QA28	97.4%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
CEACAM7	protein-coding	1087
CEACAM21	protein-coding	90273
LINC01480	ncRNA	101927931
CEACAM5	protein-coding	1048

Protein

Protein identifiers

Cell adhesion molecule CEACAM4 — O75871 (reviewed: O75871)

Alternative names: Carcinoembryonic antigen CGM7, Carcinoembryonic antigen-related cell adhesion molecule 4, Non-specific cross-reacting antigen W236

All UniProt accessions (3): A0A077JJN3, O75871, M0R363

UniProt curated annotations — full annotation on UniProt →

Function. Granulocyte orphan receptor that acts as an trigger efficient phagocytosis of attached particles.

Subunit / interactions. Interacts through its phosphorylated ITAM domain with the SH2 domain-containing cytoplasmic proteins involved in signaling processes during phagocytosis.

Subcellular location. Membrane.

Tissue specificity. Granulocytes.

Post-translational modifications. N-glycosylated. The cytoplasmic ITAM-like sequence becomes tyrosine phosphorylated by SRC family PTKs upon ligand-mediated receptor clustering and allows to initiate phagocytosis of bound ligand.

Miscellaneous. To study the function of the orphan receptor CEACAM4 chimeric proteins containing the extracellular bacteria-binding domain of CEACAM3 and the transmembrane and cytoplasmic part of CEACAM4 has been used.

Similarity. Belongs to the immunoglobulin superfamily. CEA family.

RefSeq proteins (4): NP_001349421, NP_001349422, NP_001349424, NP_001808* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR007110	Ig-like_dom	Domain
IPR013106	Ig_V-set	Domain
IPR013783	Ig-like_fold	Homologous_superfamily
IPR036179	Ig-like_dom_sf	Homologous_superfamily
IPR050831	CEA_cell_adhesion	Family

Pfam: PF07686

UniProt features (18 total): glycosylation site 4, sequence variant 2, mutagenesis site 2, sequence conflict 2, topological domain 2, signal peptide 1, chain 1, transmembrane region 1, domain 1, region of interest 1, short sequence motif 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O75871-F1	76.99	0.51

Human Protein Atlas

Protein class: Predicted membrane proteins

Protein evidence: Evidence at protein level

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Glycosylation sites (4)

Type	Positions
N-linked (glcnac…) asparagine	111, 126, 57, 104

Mutagenesis-validated functional residues (2)

Position	Phenotype
222	no internalization of bacteria; when associated with f-233.
233	no internalization of bacteria; when associated with f-222.

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 0; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

MSigDB gene sets: 63 (showing top): VERHAAK_AML_WITH_NPM1_MUTATED_DN, TSENG_IRS1_TARGETS_UP, MODULE_45, MODULE_64, GOCC_CELL_SURFACE, GOBP_VESICLE_MEDIATED_TRANSPORT, SHETH_LIVER_CANCER_VS_TXNIP_LOSS_PAM5, CAR_MYST2, MODULE_157, CAR_MLANA, SANSOM_APC_TARGETS_DN, AFFAR_YY1_TARGETS_DN, MODULE_242, GOBP_IMPORT_INTO_CELL, MODULE_20

GO Biological Process (3): regulation of immune system process (GO:0002682), phagocytosis (GO:0006909), signal transduction (GO:0007165)

GO Molecular Function (2): protein tyrosine kinase binding (GO:1990782), protein binding (GO:0005515)

GO Cellular Component (3): plasma membrane (GO:0005886), cell surface (GO:0009986), membrane (GO:0016020)

GO top-level categories

13 GO namespaces:

Category	Terms
cellular anatomical structure	2
immune system process	1
regulation of biological process	1
endocytosis	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
protein kinase binding	1
binding	1
membrane	1
cell periphery	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 1 of 8 annotations. The rest are phylogenetic / computational / electronic (IEA).

1 experimentally-supported GO terms:

GO term	NS	Evidence
phagocytosis	BP	direct assay

Protein interactions and networks

STRING

showing 15 of 720 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CEACAM4	CEACAM20	Q6UY09	610
CEACAM4	GK5	Q6ZS86	547
CEACAM4	CYP2A13	Q16696	544
CEACAM4	UNC79	Q9P2D8	536
CEACAM4	CYP2A7	P20853	513
CEACAM4	NALCN	Q8IZF0	500
CEACAM4	UNC80	Q8N2C7	497
CEACAM4	A0A096LNM5	A0A096LNM5	490
CEACAM4	PLA2G7	Q13093	487
CEACAM4	SLC12A3	P55017	444
CEACAM4	CYP2A6	P00190	440
CEACAM4	IGDCC3	Q8IVU1	400
CEACAM4	ADGRE5	P48960	370
CEACAM4	CD177	Q8N6Q3	367
CEACAM4	IGSF23	A1L1A6	365

IntAct

Human interaction partners of CEACAM4 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

2 partners by confidence:

Partner	Interaction type	MIscore	Records
FLT4	physical association	0.400	2
PDCD1LG2	physical association	0.400	1

Disease & clinical

Genetic variants

Variant evidence for CEACAM4: 47 ClinVar records (0 pathogenic / likely pathogenic); 2 GWAS associations.

ClinVar

47 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	38
Likely benign	3
Benign	0

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 37 predictions of 634):

Position(s)	Effect	Δscore	Sites
19:41621653	donor_gain	0.9900
19:41626898–41626899	donor_loss	0.9900	5
19:41619396–41619397	acceptor_loss	0.9800	6
19:41620573–41620574	donor_loss	0.9800	5
19:41620628–41620629	acceptor_loss	0.9800	6
19:41620650	acceptor_gain	0.9800
19:41619712–41619713	acceptor_loss	0.9700	6
19:41619668–41619669	donor_loss	0.9600	5
19:41619718	acceptor_gain	0.9600
19:41619945	donor_gain	0.9600

AlphaMissense

180 missense substitutions predicted likely pathogenic (of 1,548 scored), across 76 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D116	8	0.806	0.896
W67	7	0.939	0.984
G70	6	0.777	0.893
E99	6	0.741	0.912
Y120	5	0.917	0.963
G92	5	0.863	0.870
F109	5	0.743	0.914
G105	4	0.917	0.965
G118	4	0.780	0.828
S106	4	0.779	0.975
N104	4	0.754	0.815
Y65	4	0.750	0.922
G159	4	0.742	0.801
H68	4	0.722	0.881
S96	4	0.690	0.697
G48	4	0.685	0.833
F36	4	0.659	0.661
L107	3	0.903	0.960
L122	3	0.882	0.954
L53	3	0.866	0.918

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Disease associations

OMIM: gene MIM:619159 | disease phenotypes:

GWAS associations

2 associations:

Study	Trait	p-value
GCST004744_57	Lung adenocarcinoma	3e-7
GCST007160_30	Refractive astigmatism	8e-6

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

11 total (human), top 11 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
triphenyl phosphate	affects expression	1
S-(1,2-dichlorovinyl)cysteine	affects cotreatment, decreases expression	1
di-n-butylphosphoric acid	affects expression	1
theaflavin-3,3’-digallate	affects expression	1
Acetaminophen	decreases expression	1
Aldehydes	increases expression	1
Atrazine	increases expression	1
Benzo(a)pyrene	increases methylation	1
Lipopolysaccharides	affects cotreatment, decreases expression	1
Tretinoin	increases expression	1
Aflatoxin B1	increases methylation	1

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.