CEMP1

Summary

CEMP1 (cementum protein 1, HGNC:32553) is a protein-coding gene on chromosome 16p13.3, encoding Cementoblastoma-derived protein 1 (Q6PRD7). May play a role in development of the periodontium which surrounds and supports the teeth by promoting the differentiation of multi-potent cells from the periodontal ligament into cementoblasts to form the cementum.

Enables hydroxyapatite binding activity. Involved in several processes, including biomineral tissue development; cell population proliferation; and odontogenesis. Located in cytoplasm and nucleoplasm.

Source: NCBI Gene 752014 — RefSeq curated summary.

At a glance

• MANE Select transcript: NM_001048212

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:32553
Approved symbol	CEMP1
Name	cementum protein 1
Location	16p13.3
Locus type	gene with protein product
Status	Approved
Aliases	CP-23
Ensembl gene	ENSG00000205923
Ensembl biotype	protein_coding
OMIM	611113
Entrez	752014

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

ENST00000565480, ENST00000567119

RefSeq mRNA: 1 — MANE Select: NM_001048212 NM_001048212

CCDS: CCDS42108

Canonical transcript exons

ENST00000567119 — 1 exons

Exon	Start	End
ENSE00002615541	2530035	2531408

Expression profiles

Bgee: expression breadth ubiquitous, 172 present calls, max score 81.15.

Top tissues by expression

270 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
mucosa of transverse colon	UBERON:0004991	81.15	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	80.86	gold quality
anterior cingulate cortex	UBERON:0009835	80.10	gold quality
cingulate cortex	UBERON:0003027	80.06	gold quality
right frontal lobe	UBERON:0002810	79.45	gold quality
amygdala	UBERON:0001876	79.11	gold quality
tendon of biceps brachii	UBERON:0008188	78.39	silver quality
right hemisphere of cerebellum	UBERON:0014890	76.66	gold quality
putamen	UBERON:0001874	75.82	gold quality
cerebellar hemisphere	UBERON:0002245	75.81	gold quality
Brodmann (1909) area 9	UBERON:0013540	75.72	gold quality
cerebellar cortex	UBERON:0002129	75.48	gold quality
parotid gland	UBERON:0001831	75.38	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	75.32	gold quality
nucleus accumbens	UBERON:0001882	75.07	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	74.98	gold quality
prefrontal cortex	UBERON:0000451	74.84	gold quality
metanephros cortex	UBERON:0010533	74.65	gold quality
apex of heart	UBERON:0002098	74.57	gold quality
lower esophagus mucosa	UBERON:0035834	74.52	gold quality
vena cava	UBERON:0004087	74.26	silver quality
spinal cord	UBERON:0002240	74.02	gold quality
cerebellum	UBERON:0002037	73.95	gold quality
spleen	UBERON:0002106	73.43	gold quality
neocortex	UBERON:0001950	73.34	gold quality
caudate nucleus	UBERON:0001873	73.04	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	72.92	gold quality
muscle layer of sigmoid colon	UBERON:0035805	72.70	gold quality
frontal cortex	UBERON:0001870	72.50	gold quality
small intestine Peyer’s patch	UBERON:0003454	72.50	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

7 targeting CEMP1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6809-3P	99.91	71.45	3814
HSA-MIR-1249-5P	99.61	66.55	2049
HSA-MIR-1909-5P	98.94	64.01	484
HSA-MIR-767-3P	98.61	67.69	1192
HSA-MIR-3944-5P	98.50	67.55	997
HSA-MIR-6747-5P	96.17	64.99	743
HSA-MIR-6828-3P	96.06	67.61	1155

Literature-anchored findings (GeneRIF, showing 13)

• CEMP1 might participate in differentiation and mineralization of nonosteogenic cells, and it might have a potential function in cementum and bone formation (PMID:17509525)
• CEMP1 plays a role during the biomineralization process by promoting octacalcium phosphate crystal nucleation. (PMID:19393626)
• These data demonstrate for the first time that the CEMP1 is not only a marker protein for cementoblast-related cells, but it also regulates cementoblast commitment in periodontal ligament cells (PMID:21465469)
• human primary cementoblasts subjected to compression and IL-1beta stimulation impeded BSP and CEMP-1 expression, proteins that are associated with cementogenesis. (PMID:22349547)
• when HIF-1 was activated by gene introduction or chemically, CEMP1 expression and mineralization increased. (PMID:24117017)
• CEMP1 exerts modulation of a number of cellular genes. (PMID:26011628)
• The synthesis of hydroxyapatite with different crystallinities by controlling the concentration of recombinant CEMP1 for biological application. (PMID:26652387)
• data demonstrate that CEMP-1-p1 is an effective bioactive peptide for bone tissue regeneration. The application of this bioactive peptide may lead to implementing new strategies for the regeneration of bone and other mineralized tissues (PMID:30113883)
• On day 14, mineralization nodules appeared, as seen by positive von Kossa staining; the nodules increased in number and size by day 21. The expression of CEMP1 was detected on day 5, and its expression level increased gradually by day 7, reached a peak on day 14, and decreased by day 21 (PMID:30804111)
• Cementum protein 1-derived peptide (CEMP 1-p1) modulates hydroxyapatite crystal formation in vitro. (PMID:31410920)
• Carboxy-Terminal Cementum Protein 1-Derived Peptide 4 (cemp1-p4) Promotes Mineralization through wnt/beta-catenin Signaling in Human Oral Mucosa Stem Cells. (PMID:32075221)
• Protease-activated receptor type 1 (PAR1) increases CEMP1 gene expression through MAPK/ERK pathway. (PMID:35442377)
• Cementum protein 1 gene-modified adipose-derived mesenchymal stem cell sheets enhance periodontal regeneration in osteoporosis rat. (PMID:37154214)

Cross-species orthologs

0 orthologs

Protein

Protein identifiers

Cementoblastoma-derived protein 1 — Q6PRD7 (reviewed: Q6PRD7)

Alternative names: Cementum protein 1, Cementum protein 23

All UniProt accessions (2): H3BPU9, Q6PRD7

UniProt curated annotations — full annotation on UniProt →

Function. May play a role in development of the periodontium which surrounds and supports the teeth by promoting the differentiation of multi-potent cells from the periodontal ligament into cementoblasts to form the cementum. Binds hydroxyapatite and may promote the biomineralization of the cementum. Also promotes cell proliferation.

Subcellular location. Cytoplasm. Nucleus.

Tissue specificity. Expressed by cementoblasts, a subpopulation of periodontal ligament cells and cells located around vessels in periodontium (at protein level).

Post-translational modifications. Phosphorylated. N-glycosylated.

Induction. Up-regulated by hypoxia (at protein level).

RefSeq proteins (1): NP_001041677* (*=MANE)

Domains & families (InterPro)

UniProt features (6 total): region of interest 2, chain 1, compositionally biased region 1, sequence variant 1, helix 1

Structure

Experimental structures (PDB)

1 structures.

PDB	Method	Resolution (Å)
7TB9	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q6PRD7-F1	35.92	0.00

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 31 (showing top): GOBP_ANIMAL_ORGAN_MORPHOGENESIS, GOBP_ODONTOGENESIS, ZWANG_TRANSIENTLY_UP_BY_2ND_EGF_PULSE_ONLY, ATF6_TARGET_GENES, HOXB4_TARGET_GENES, SALL4_TARGET_GENES, SNRNP70_TARGET_GENES, SUPT16H_TARGET_GENES, ZNF257_TARGET_GENES, GSE11864_CSF1_IFNG_VS_CSF1_IFNG_PAM3CYS_IN_MAC_UP, MIR6828_3P, GSE13484_12H_VS_3H_YF17D_VACCINE_STIM_PBMC_DN, GSE1460_DP_VS_CD4_THYMOCYTE_UP, GSE1460_CD4_THYMOCYTE_VS_NAIVE_CD4_TCELL_CORD_BLOOD_DN, DESCARTES_MAIN_FETAL_CSH1_CSH2_POSITIVE_CELLS

GO Biological Process (4): cell population proliferation (GO:0008283), cell differentiation (GO:0030154), biomineral tissue development (GO:0031214), odontogenesis (GO:0042476)

GO Molecular Function (2): hydroxyapatite binding (GO:0046848), protein binding (GO:0005515)

GO Cellular Component (3): nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	2
cellular process	1
cellular developmental process	1
tissue development	1
animal organ development	1
animal organ morphogenesis	1
small molecule binding	1
binding	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
intracellular anatomical structure	1

Protein interactions and networks

STRING

146 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CEMP1	HACD1	B0YJ81	813
CEMP1	IBSP	P21815	606
CEMP1	BGLAP	P02818	571
CEMP1	FGF2	P09038	549
CEMP1	RUNX2	Q13950	543
CEMP1	SPP1	P10451	479
CEMP1	DMP1	Q13316	447
CEMP1	SRI	P30626	445
CEMP1	AMBN	Q9NP70	444
CEMP1	BMP2	P12643	418
CEMP1	ARNT	P27540	401
CEMP1	POSTN	Q15063	373
CEMP1	HOXC6	P09630	358
CEMP1	ZNF221	Q9UK13	348
CEMP1	BMP7	P18075	348

IntAct

8 interactions, top by confidence:

A	B	Type	Score
FNDC3B	CEMP1	psi-mi:“MI:0915”(physical association)	0.560
VWC2L	CEMP1	psi-mi:“MI:0915”(physical association)	0.560
CEMP1	PABPN1L	psi-mi:“MI:0914”(association)	0.350
FNDC3B	CEMP1	psi-mi:“MI:0915”(physical association)	0.000
VWC2L	CEMP1	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (5): CEMP1 (Two-hybrid), CEMP1 (Two-hybrid), PLXNC1 (Affinity Capture-MS), PITRM1 (Affinity Capture-MS), PABPN1L (Affinity Capture-MS)

ESM2 similar proteins: A0A3Q1LFG5, A1L4Q6, A8MQB3, A8MWP4, A8MZ25, C0HM98, C9JC47, P0DMU3, P0DPA3, P58512, P59020, P59021, P86434, Q0IIN9, Q0VFX4, Q4VX62, Q52M75, Q5SR53, Q5T036, Q5W150, Q6PRD7, Q6ZN03, Q6ZSK4, Q6ZUF6, Q6ZUU3, Q6ZV77, Q6ZV80, Q6ZWC4, Q7Z4H9, Q86UQ8, Q8JMZ5, Q8JN06, Q8N1D0, Q8N2B8, Q8N2X6, Q8N3U1, Q8N7R1, Q8N9X3, Q8NAA6, Q8NDY4

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

0 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	0
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

206 predictions. Top by Δscore:

Variant	Effect	Δscore
16:2530701:CAC:C	acceptor_gain	0.7300
16:2530471:C:CT	acceptor_gain	0.7200
16:2530702:ACCT:A	acceptor_loss	0.7200
16:2530703:CCTGT:C	acceptor_loss	0.7200
16:2530704:C:CA	acceptor_loss	0.7200
16:2530705:T:A	acceptor_loss	0.7200
16:2530676:C:CT	acceptor_gain	0.6900
16:2530706:G:C	acceptor_loss	0.6900
16:2530649:GCCC:G	acceptor_gain	0.6700
16:2530580:A:AC	donor_gain	0.6500
16:2530581:C:CC	donor_gain	0.6500
16:2531203:C:A	donor_gain	0.6500
16:2530699:CCCAC:C	acceptor_gain	0.6300
16:2530700:CCACC:C	acceptor_gain	0.6300
16:2530700:CCAC:C	acceptor_gain	0.6200
16:2530701:CACC:C	acceptor_gain	0.6200
16:2530653:A:T	acceptor_gain	0.6100
16:2530648:AGCCC:A	acceptor_gain	0.6000
16:2530877:ATAC:A	donor_loss	0.5900
16:2530879:ACCC:A	donor_loss	0.5900
16:2530880:CCCA:C	donor_loss	0.5900
16:2530882:CACCT:C	donor_loss	0.5900
16:2530884:CC:C	donor_loss	0.5900
16:2530884:CCT:C	donor_gain	0.5800
16:2530666:TCTC:T	acceptor_gain	0.5700
16:2530667:CTCC:C	acceptor_gain	0.5700
16:2530471:C:T	acceptor_gain	0.5400
16:2530581:CAG:C	donor_gain	0.5000
16:2530849:G:T	donor_gain	0.5000
16:2530883:A:AC	donor_gain	0.5000

AlphaMissense

1579 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
16:2530660:G:C	F138L	0.967
16:2530660:G:T	F138L	0.967
16:2530662:A:G	F138L	0.967
16:2530819:C:A	W85C	0.918
16:2530819:C:G	W85C	0.918
16:2530844:A:G	I77T	0.911
16:2530661:A:G	F138S	0.906
16:2530669:C:A	W135C	0.878
16:2530669:C:G	W135C	0.878
16:2530671:A:G	W135R	0.875
16:2530671:A:T	W135R	0.875
16:2530844:A:C	I77S	0.860
16:2530726:G:C	F116L	0.858
16:2530726:G:T	F116L	0.858
16:2530728:A:G	F116L	0.858
16:2530677:A:G	W133R	0.856
16:2530677:A:T	W133R	0.856
16:2530821:A:G	W85R	0.854
16:2530821:A:T	W85R	0.854
16:2530651:C:A	W141C	0.853
16:2530651:C:G	W141C	0.853
16:2530675:C:A	W133C	0.848
16:2530675:C:G	W133C	0.848
16:2530661:A:C	F138C	0.842
16:2530346:A:G	M243T	0.831
16:2530649:G:T	A142D	0.828
16:2530650:C:G	A142P	0.813
16:2530658:A:G	L139P	0.807
16:2530732:C:A	W114C	0.807
16:2530732:C:G	W114C	0.807

dbSNP variants (sampled 300 via entrez): RS1000260221 (16:2532925 T>C), RS1000354027 (16:2532800 T>G), RS1000362781 (16:2532354 C>T), RS1000559638 (16:2529814 G>A), RS1001137527 (16:2533095 C>A,G,T), RS1001231398 (16:2532027 G>A), RS1002637832 (16:2532786 G>T), RS1002868224 (16:2531400 C>G), RS1004203323 (16:2532530 C>G,T), RS1004743665 (16:2532213 A>G), RS1005889924 (16:2530065 T>C), RS1007485470 (16:2532201 GCACAGAGCCCGAGGCTGCGCGGTCCCCGGC>G), RS1007981757 (16:2531298 A>C), RS1008300953 (16:2531552 C>T), RS1008424454 (16:2529988 T>G)

Disease associations

OMIM: gene MIM:611113 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

20 total (human), top 20 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	decreases methylation, increases expression	2
Air Pollutants	increases abundance, increases expression, affects cotreatment	2
alpha-pinene	affects cotreatment, increases expression, increases abundance	1
sodium arsenite	increases expression	1
methacrylaldehyde	affects cotreatment, increases expression, increases abundance	1
jinfukang	increases expression, affects cotreatment	1
2,3,5-trichloro-6-phenyl-(1,4)benzoquinone	decreases expression	1
Sunitinib	increases expression	1
Leflunomide	decreases expression	1
Acrolein	affects cotreatment, increases expression, increases abundance	1
Benzo(a)pyrene	increases methylation	1
Cisplatin	affects cotreatment, increases expression	1
Diethylhexyl Phthalate	affects expression	1
Ozone	affects cotreatment, increases expression, increases abundance	1
Urethane	decreases expression	1
Valproic Acid	increases methylation	1
Aflatoxin M1	increases expression	1
Lactic Acid	increases expression	1
Particulate Matter	increases abundance, increases expression	1
Volatile Organic Compounds	affects cotreatment, increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.