CEND1

Summary

CEND1 (cell cycle exit and neuronal differentiation 1, HGNC:24153) is a protein-coding gene on chromosome 11p15.5, encoding Cell cycle exit and neuronal differentiation protein 1 (Q8N111). Involved in neuronal differentiation.

The protein encoded by this gene is a neuron-specific protein. The similar protein in pig enhances neuroblastoma cell differentiation in vitro and may be involved in neuronal differentiation in vivo. Multiple pseudogenes have been reported for this gene.

Source: NCBI Gene 51286 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 44 total
• MANE Select transcript: NM_016564

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:24153
Approved symbol	CEND1
Name	cell cycle exit and neuronal differentiation 1
Location	11p15.5
Locus type	gene with protein product
Status	Approved
Aliases	FLJ90066, BM88
Ensembl gene	ENSG00000184524
Ensembl biotype	protein_coding
OMIM	608213
Entrez	51286

Gene structure

Transcript identifiers

Ensembl transcripts: 6 — 5 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000330106, ENST00000524587, ENST00000901135, ENST00000901136, ENST00000901137, ENST00000966810

RefSeq mRNA: 1 — MANE Select: NM_016564 NM_016564

CCDS: CCDS7714

Canonical transcript exons

ENST00000330106 — 2 exons

Exon	Start	End
ENSE00001299073	787115	788658
ENSE00001312569	790030	790090

Expression profiles

Bgee: expression breadth ubiquitous, 186 present calls, max score 98.97.

FANTOM5 (CAGE): breadth broad, TPM avg 16.9422 / max 713.4368, expressed in 787 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
117821	16.8587	784
117818	0.0466	24
117819	0.0228	5
117820	0.0140	4

Top tissues by expression

271 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right hemisphere of cerebellum	UBERON:0014890	98.97	gold quality
right frontal lobe	UBERON:0002810	98.96	gold quality
cerebellar hemisphere	UBERON:0002245	98.71	gold quality
cerebellar cortex	UBERON:0002129	98.68	gold quality
anterior cingulate cortex	UBERON:0009835	98.28	gold quality
cingulate cortex	UBERON:0003027	98.27	gold quality
prefrontal cortex	UBERON:0000451	97.90	gold quality
Brodmann (1909) area 9	UBERON:0013540	97.89	gold quality
cerebellum	UBERON:0002037	97.88	gold quality
nucleus accumbens	UBERON:0001882	97.35	gold quality
putamen	UBERON:0001874	97.11	gold quality
caudate nucleus	UBERON:0001873	96.93	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	96.69	gold quality
amygdala	UBERON:0001876	96.68	gold quality
frontal cortex	UBERON:0001870	96.42	gold quality
neocortex	UBERON:0001950	96.05	gold quality
hypothalamus	UBERON:0001898	95.35	gold quality
telencephalon	UBERON:0001893	94.85	gold quality
cerebral cortex	UBERON:0000956	94.63	gold quality
cerebellar vermis	UBERON:0004720	94.63	gold quality
brain	UBERON:0000955	94.35	gold quality
forebrain	UBERON:0001890	94.16	gold quality
substantia nigra	UBERON:0002038	94.04	gold quality
lateral nuclear group of thalamus	UBERON:0002736	93.92	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	93.81	gold quality
midbrain	UBERON:0001891	93.34	gold quality
Ammon’s horn	UBERON:0001954	93.03	gold quality
temporal lobe	UBERON:0001871	92.73	gold quality
pons	UBERON:0000988	92.60	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	92.44	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-7316	yes	15.86
E-HCAD-25	yes	7.75
E-ANND-3	no	0.47

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): SP1

miRNA regulators (miRDB)

21 targeting CEND1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-2110	99.96	66.68	1930
HSA-MIR-6753-3P	99.93	66.57	637
HSA-MIR-7107-3P	99.93	66.73	627
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-6763-5P	99.76	64.68	1767
HSA-MIR-18A-3P	99.56	65.68	1092
HSA-MIR-7160-5P	99.11	67.17	2207
HSA-MIR-4764-5P	98.88	65.53	894
HSA-MIR-6829-5P	98.86	65.12	1480
HSA-MIR-2355-5P	98.83	65.51	1589
HSA-MIR-423-5P	98.69	67.48	1522
HSA-MIR-3184-5P	98.56	67.13	1491
HSA-MIR-4483	98.09	64.12	1642
HSA-MIR-3650	97.88	64.89	693
HSA-MIR-2278	97.30	66.19	1130
HSA-MIR-3192-5P	96.98	65.76	1926
HSA-MIR-6815-5P	96.05	65.55	662
HSA-MIR-6865-5P	96.05	65.58	675
HSA-MIR-1237-5P	95.38	62.21	451
HSA-MIR-4488	95.38	62.00	443
HSA-MIR-4697-5P	95.38	61.72	457

Literature-anchored findings (GeneRIF, showing 4)

• BM88/Cend1 participates in cell cycle control and neuronal differentiation mechanisms during neonatal SVZ neurogenesis and becomes crucial for the transition from neuroblasts to mature neurons when reaching high levels (PMID:18499894)
• Interaction of CEND1 gene and life events in susceptibility to depressive symptoms in Chinese Han college students. (PMID:33027701)
• Cend1 and Neurog2 efficiently reprogram human cortical astrocytes to neural precursor cells and induced-neurons. (PMID:34549796)
• CEND1 and miR885 methylation changes associated with successful cognitive aging in community-dwelling older adults. (PMID:35045349)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Cend1	ENSMUSG00000060240
rattus_norvegicus	Cend1	ENSRNOG00000062814

Protein

Protein identifiers

Cell cycle exit and neuronal differentiation protein 1 — Q8N111 (reviewed: Q8N111)

Alternative names: BM88 antigen

All UniProt accessions (1): Q8N111

UniProt curated annotations — full annotation on UniProt →

Function. Involved in neuronal differentiation.

Subunit / interactions. Homodimer. Interacts with AHI1.

Subcellular location. Membrane.

Tissue specificity. Neuron specific.

Similarity. Belongs to the CEND1 family.

RefSeq proteins (1): NP_057648* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR020162	Cend1	Family

Pfam: PF15677

UniProt features (10 total): topological domain 2, compositionally biased region 2, modified residue 2, chain 1, transmembrane region 1, region of interest 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8N111-F1	60.87	0.11

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (2): 10, 87

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 104 (showing top): GOBP_HINDBRAIN_DEVELOPMENT, GOBP_METENCEPHALON_DEVELOPMENT, GOBP_BEHAVIOR, LFA1_Q6, GOBP_ADULT_BEHAVIOR, GOBP_CEREBELLAR_PURKINJE_CELL_LAYER_FORMATION, GOBP_CEREBELLAR_CORTEX_MORPHOGENESIS, GOBP_NEUROGENESIS, TGACCTY_ERR1_Q2, GOBP_ADULT_LOCOMOTORY_BEHAVIOR, NFKB_Q6, GOBP_NEURAL_PRECURSOR_CELL_PROLIFERATION, GOBP_ANATOMICAL_STRUCTURE_MATURATION, NKX62_Q2, GOBP_CEREBELLAR_GRANULAR_LAYER_DEVELOPMENT

GO Biological Process (8): adult walking behavior (GO:0007628), cerebellar granular layer maturation (GO:0021686), cerebellar Purkinje cell differentiation (GO:0021702), radial glia guided migration of cerebellar granule cell (GO:0021933), negative regulation of cerebellar granule cell precursor proliferation (GO:0021941), cerebellum development (GO:0021549), cell differentiation (GO:0030154), neuron differentiation (GO:0030182)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (3): membrane (GO:0016020), mitochondrion (GO:0005739), vesicle (GO:0031982)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
adult locomotory behavior	1
walking behavior	1
cerebellar granular layer development	1
cerebellar cortex maturation	1
anatomical structure maturation	1
cell differentiation in hindbrain	1
cerebellar Purkinje cell layer formation	1
central nervous system neuron differentiation	1
hindbrain radial glia guided cell migration	1
cerebellar granule cell precursor proliferation	1
regulation of cerebellar granule cell precursor proliferation	1
negative regulation of neural precursor cell proliferation	1
metencephalon development	1
anatomical structure development	1
cellular developmental process	1
cell differentiation	1
generation of neurons	1
binding	1
cellular anatomical structure	1
cytoplasm	1
intracellular membrane-bounded organelle	1
membrane-bounded organelle	1

Protein interactions and networks

STRING

1396 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CEND1	SRC	P12931	505
CEND1	AHI1	Q8N157	467
CEND1	UBQLN4	Q9NRR5	429
CEND1	SSH3	Q8TE77	426
CEND1	NRP1	O14786	411
CEND1	YPEL5	P62699	407
CEND1	KLHL35	Q6PF15	393
CEND1	ATXN1	P54253	374
CEND1	CCDC70	Q6NSX1	371
CEND1	RANBP9	Q96S59	368
CEND1	FRMPD4	Q14CM0	357
CEND1	ARMCX2	Q7L311	348
CEND1	IFFO1	Q0D2I5	330
CEND1	ADNP2	Q6IQ32	329
CEND1	DLEU7	Q6UYE1	327

IntAct

21 interactions, top by confidence:

A	B	Type	Score
CEND1	MAGED4B	psi-mi:“MI:0915”(physical association)	0.560
CEND1	MFF	psi-mi:“MI:0915”(physical association)	0.560
EGFR	CEND1	psi-mi:“MI:0915”(physical association)	0.550
CEND1	EGFR	psi-mi:“MI:0915”(physical association)	0.550
CEND1	GLP1R	psi-mi:“MI:0915”(physical association)	0.510
GLP1R	CEND1	psi-mi:“MI:0915”(physical association)	0.510
	CEND1	psi-mi:“MI:0915”(physical association)	0.500
	RBFOX2	psi-mi:“MI:0914”(association)	0.500
ERBB2	CEND1	psi-mi:“MI:0915”(physical association)	0.370
	TSPO	psi-mi:“MI:0914”(association)	0.350
APP	ESYT2	psi-mi:“MI:0914”(association)	0.350
MAPT	SEPTIN8	psi-mi:“MI:0914”(association)	0.350
MAPT	SHTN1	psi-mi:“MI:0914”(association)	0.350
MFF	CEND1	psi-mi:“MI:0915”(physical association)	0.000
MAGED4B	CEND1	psi-mi:“MI:0915”(physical association)	0.000
UBQLN4	CEND1	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (13): CEND1 (Two-hybrid), MAGED4B (Two-hybrid), CEND1 (Two-hybrid), CEND1 (Affinity Capture-RNA), CEND1 (Affinity Capture-MS), CEND1 (Affinity Capture-MS), CEND1 (Affinity Capture-MS), CEND1 (Cross-Linking-MS (XL-MS)), CEND1 (Affinity Capture-MS), CEND1 (PCA), CEND1 (Two-hybrid), CEND1 (PCA), CEND1 (Affinity Capture-Western)

ESM2 similar proteins: A0A1B0GUA9, A0A1B0GV96, A4IFJ0, B3DGJ2, O43687, O55074, O70139, O75167, P04370, P0C8S0, P0C913, P0C914, P0CD96, P19103, P27775, P49342, P61925, P61926, P62025, P63248, P63249, Q04758, Q13522, Q29026, Q3SX13, Q3T0A6, Q3ZB98, Q4VC05, Q5FVI4, Q5R6X9, Q64256, Q6P3A1, Q71U53, Q7M2N1, Q7YQJ3, Q7YQJ4, Q8N111, Q8R409, Q8TAD7, Q8WMS3

Diamond homologs: Q29026, Q5FVI4, Q8N111, Q9JKC6

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

44 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	41
Likely benign	3
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

283 predictions. Top by Δscore:

Variant	Effect	Δscore
11:790028:A:AC	donor_gain	1.0000
11:790029:C:CC	donor_gain	1.0000
11:790029:CG:C	donor_gain	1.0000
11:788654:TGGGC:T	acceptor_gain	0.9900
11:788659:C:CC	acceptor_gain	0.9900
11:790029:CGCGT:C	donor_gain	0.9900
11:790033:T:TA	donor_gain	0.9900
11:788657:GC:G	acceptor_gain	0.9800
11:788658:CC:C	acceptor_gain	0.9800
11:788655:GGGC:G	acceptor_gain	0.9700
11:790023:GCCTT:G	donor_loss	0.9700
11:790024:CCTTA:C	donor_loss	0.9700
11:790025:CTTAC:C	donor_loss	0.9700
11:790026:TTACG:T	donor_loss	0.9700
11:790027:T:TG	donor_loss	0.9700
11:790028:A:AG	donor_loss	0.9700
11:790028:ACG:A	donor_gain	0.9700
11:790029:CGC:C	donor_gain	0.9700
11:790036:T:TA	donor_gain	0.9700
11:790044:C:CA	donor_gain	0.9700
11:788656:GGC:G	acceptor_gain	0.9600
11:790029:CGCG:C	donor_gain	0.9600
11:789330:G:A	donor_gain	0.9500
11:790023:G:A	donor_gain	0.9500
11:790045:C:A	donor_gain	0.9500
11:789313:T:TA	donor_gain	0.9400
11:790043:T:TA	donor_gain	0.9400
11:789319:G:C	donor_gain	0.9300
11:789334:G:A	donor_gain	0.9100
11:789866:ACATC:A	donor_gain	0.9100

AlphaMissense

948 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
11:788156:C:G	G141R	0.968
11:788167:G:T	A137D	0.964
11:788155:C:T	G141D	0.956
11:788176:G:T	A134E	0.953
11:788192:C:G	G129R	0.946
11:788192:C:T	G129R	0.946
11:788182:G:T	A132D	0.943
11:788191:C:T	G129E	0.938
11:788349:G:C	S76R	0.931
11:788349:G:T	S76R	0.931
11:788351:T:G	S76R	0.931
11:788173:G:T	A135D	0.919
11:788179:A:T	V133E	0.909
11:788170:A:T	I136K	0.906
11:788189:C:G	G130R	0.905
11:788161:A:T	I139N	0.898
11:788164:A:C	L138R	0.894
11:788158:A:T	L140H	0.882
11:788194:G:T	A128D	0.879
11:788170:A:C	I136R	0.873
11:788352:G:C	H75Q	0.869
11:788352:G:T	H75Q	0.869
11:788340:C:A	K79N	0.867
11:788340:C:G	K79N	0.867
11:788355:G:C	N74K	0.866
11:788355:G:T	N74K	0.866
11:788547:G:C	S10R	0.865
11:788547:G:T	S10R	0.865
11:788549:T:G	S10R	0.865
11:788164:A:T	L138Q	0.859

dbSNP variants (sampled 300 via entrez): RS1000028882 (11:788758 C>G,T), RS1001878013 (11:789686 A>C,G), RS1003229552 (11:787860 C>G,T), RS1003290288 (11:790558 A>G), RS1003631232 (11:787727 T>G), RS1003995961 (11:787482 G>A), RS1004045180 (11:787219 A>C,G), RS1004459287 (11:790347 CGGGTCGGTGGGTGAG>C,CGGGTCGGTGGGTGAGGGGTCGGTGGGTGAG), RS1004867467 (11:791899 G>A), RS1004873636 (11:791677 G>A), RS1005716573 (11:791751 C>T), RS1005819683 (11:791283 C>T), RS1006015821 (11:789402 C>G,T), RS1006031902 (11:787463 T>C), RS1006279251 (11:790839 G>A)

Disease associations

OMIM: gene MIM:608213 | disease phenotypes:

GenCC curated gene-disease

Mondo (1): developmental and epileptic encephalopathy (MONDO:0100620)

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST90013442_17	Keratoconus	1.000000e-26

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

28 total (human), top 28 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases expression, increases methylation, affects expression	3
(+)-JQ1 compound	increases expression	2
aristolochic acid I	increases expression	1
propionaldehyde	increases expression	1
bisphenol A	decreases expression	1
ethyl-p-hydroxybenzoate	decreases expression	1
butyraldehyde	increases expression	1
beta-methylcholine	affects expression	1
pentanal	increases expression	1
abrine	increases expression	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	decreases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Temozolomide	decreases expression	1
Sunitinib	increases expression	1
Air Pollutants	decreases expression, increases abundance	1
Aldehydes	increases expression	1
Benzo(a)pyrene	affects methylation, increases methylation	1
Cannabidiol	affects cotreatment, decreases expression	1
Cisplatin	decreases expression	1
Cuprizone	affects cotreatment, decreases expression	1
Dexamethasone	increases expression	1
Lead	affects expression	1
Plant Extracts	affects cotreatment, decreases expression	1
Potassium Dichromate	increases expression	1
Tretinoin	increases expression	1
Triclosan	decreases expression	1
Acrylamide	decreases expression	1
Particulate Matter	decreases expression, increases abundance	1

Clinical trials (associated diseases)

22 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT03347526	PHASE3	SUSPENDED	A Novel Approach to Infantile Spasms
NCT03421496	PHASE3	TERMINATED	A Study to Assess Cannabidiol Oral Solution With Vigabatrin as Initial Therapy in Participants With Infantile Spasms
NCT06719141	PHASE3	RECRUITING	A Study to Investigate LP352 in Children and Adults With Developmental and Epileptic Encephalopathies (DEE)
NCT06908226	PHASE3	ENROLLING_BY_INVITATION	A Study to Investigate LP352 in Children and Adults With Developmental and Epileptic Encephalopathy (DEE)
NCT04289467	PHASE2	RECRUITING	Treatment of Refractory Infantile Spasms With Fenfluramine
NCT05626634	PHASE2	COMPLETED	Open-label, Long-term Safety Study of LP352 in Subjects With Developmental and Epileptic Encephalopathy
NCT04727970	PHASE1	COMPLETED	Tricaprilin Infantile Spasms Pilot Study
NCT06700811	PHASE1	RECRUITING	Ketogenic Diet for Prevention of Epileptic Spasms in Infantile Onset Genetic Epilepsies
NCT03876444	PHASE2/PHASE3	UNKNOWN	Intravenous Methylprednisolone Versus Oral Prednisolone for Infantile Spasms
NCT05279118	PHASE2/PHASE3	ACTIVE_NOT_RECRUITING	Ketogenic Diet vs ACTH for the Treatment of Children With West Syndrome
NCT05364021	PHASE1/PHASE2	COMPLETED	Study to Investigate LP352 in Subjects With Developmental and Epileptic Encephalopathies
NCT06983158	PHASE1/PHASE2	SUSPENDED	A Clinical Trial of CAP-002 Gene Therapy in Pediatric Patients With Syntaxin-Binding Protein 1 (STXBP1) Encephalopathy
NCT04937062	EARLY_PHASE1	ACTIVE_NOT_RECRUITING	Phenylbutyrate for Monogenetic Developmental and Epileptic Encephalopathy
NCT04302116	Not specified	RECRUITING	Vigabatrin With High Dose Prednisolone Combination Therapy vs Vigabatrin Alone for Infantile Spasm
NCT05538936	Not specified	COMPLETED	The Effect of Spa and Massage on Babies on Colic Symptoms
NCT06149663	Not specified	AVAILABLE	Intermediate-Size Expanded Access Protocol (EAP) for LP352
NCT06266234	Not specified	RECRUITING	Characterization by Automated System on Infantile Spasmes
NCT06380192	Not specified	RECRUITING	Developmental and Epileptic Encephalopathy of Genetic Etiology: Natural History Through Reuse of Clinical Data
NCT07396883	Not specified	NOT_YET_RECRUITING	Developmental and Epileptic Encephalopathies Diagnosed Via Long-read Genome Sequencing
NCT07413211	Not specified	RECRUITING	Genetic Developmental and Epileptic Encephalopathy Natural History Study for Clinical Trial Readiness
NCT07531511	Not specified	NOT_YET_RECRUITING	SLC6A1-NDD Prospective Longitudinal Natural History Study
NCT07585643	Not specified	NOT_YET_RECRUITING	IBIS - Investigating Reliability of BIS and SEDLINE Monitoring in Children With Developmental and Epileptic Encephalopathies (DEE).