CENPO

Summary

CENPO (centromere protein O, HGNC:28152) is a protein-coding gene on chromosome 2p23.3, encoding Centromere protein O (Q9BU64). Component of the CENPA-CAD (nucleosome distal) complex, a complex recruited to centromeres which is involved in assembly of kinetochore proteins, mitotic progression and chromosome segregation.

This gene encodes a component of the interphase centromere complex. The encoded protein is localized to the centromere throughout the cell cycle and is required for bipolar spindle assembly, chromosome segregation and checkpoint signaling during mitosis. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene.

Source: NCBI Gene 79172 — RefSeq curated summary.

At a glance

• GWAS associations: 21
• Clinical variants (ClinVar): 53 total
• GTEx eGene: eQTL in 31 tissues, sQTL in 1 (q < 0.05)
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.14 (unconstrained)
• MANE Select transcript: NM_001322101
• Notable: 53 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:28152
Approved symbol	CENPO
Name	centromere protein O
Location	2p23.3
Locus type	gene with protein product
Status	Approved
Aliases	MGC11266, CENP-O
Ensembl gene	ENSG00000138092
Ensembl biotype	protein_coding
OMIM	611504
Entrez	79172

Gene structure

Transcript identifiers

Ensembl transcripts: 16 — 9 protein_coding, 4 protein_coding_CDS_not_defined, 2 retained_intron, 1 nonsense_mediated_decay

MANE Select: ENST00000380834

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 2: 4, TSL 3: 1, TSL 4: 1, TSL 5: 2

ENST00000380834, ENST00000260662, ENST00000395845, ENST00000464156, ENST00000473476, ENST00000473706, ENST00000486527, ENST00000491031, ENST00000498362, ENST00000868050, ENST00000868051, ENST00000912477, ENST00000912478, ENST00000912479, ENST00001066977, ENST00001115477

RefSeq mRNA: 3 — MANE Select: NM_001322101 NM_001199803, NM_001322101, NM_024322

CCDS: CCDS1714, CCDS56113

Canonical transcript exons

ENST00000380834 — 8 exons

Exon	Start	End
ENSE00000932294	24815497	24815756
ENSE00001486462	24819354	24822376
ENSE00003462134	24793425	24793501
ENSE00003535777	24799675	24799844
ENSE00003581564	24814376	24814493
ENSE00003608807	24816646	24816817
ENSE00003625370	24793852	24793965
ENSE00003690351	24817670	24817841

Expression profiles

Bgee: expression breadth ubiquitous, 184 present calls, max score 90.69.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 13.5814 / max 199.4382, expressed in 1750 samples.

Highest expression (Bgee): ventricular zone, ganglionic eminence, male germ line stem cell (sensu Vertebrata) in testis, primordial germ cell in gonad, secondary oocyte.

Genetic regulation across tissues (GTEx eQTL / sQTL)

CENPO is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 31 tissues and its splicing (sQTL) in 1 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 32 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Whole Blood	eqtl	2.8e-59	+0.60	2:24877459:A:G
Artery Tibial	eqtl	5.2e-25	+0.32	2:24860441:T:C
Lung	eqtl	1.4e-14	+0.31	2:24873823:A:T
Adipose Subcutaneous	eqtl	3.6e-14	+0.24	2:24877298:C:G
Nerve Tibial	eqtl	2.2e-12	-0.18	2:24913997:T:A
Adipose Visceral Omentum	eqtl	4.2e-09	+0.23	2:24877298:C:G
Testis	eqtl	1.4e-06	+0.22	2:24834185:G:C
Skin Sun Exposed Lower leg	eqtl	2.0e-04	-0.14	2:24802776:G:A
Colon Transverse	eqtl	3.1e-04	+0.11	2:24888811:T:C
Heart Left Ventricle	eqtl	3.2e-04	-0.19	2:24834394:G:A
Brain Cerebellar Hemisphere	eqtl	4.1e-04	-0.30	2:24802776:G:A
Breast Mammary Tissue	eqtl	2.1e-03	-0.15	2:24799040:ATGGCACTCCAATGGAGTGCAG:A
Esophagus Muscularis	eqtl	2.1e-03	-0.13	2:24808237:G:A
Skin Not Sun Exposed Suprapubic	eqtl	2.8e-03	-0.15	2:24431445:T:G
Adrenal Gland	eqtl	5.1e-03	-0.25	2:24736392:T:G
Cells EBV-transformed lymphocytes	eqtl	5.3e-03	-0.11	2:24913997:T:A
Brain Cerebellum	eqtl	5.7e-03	-0.27	2:24802776:G:A
Brain Frontal Cortex BA9	eqtl	6.5e-03	+0.39	2:24834429:C:G
Esophagus Mucosa	eqtl	7.1e-03	+0.13	2:24834429:C:G
Esophagus Gastroesophageal Junction	eqtl	8.3e-03	-0.15	2:24824539:A:G

FANTOM5 promoters

3 alternative TSS:

Promoter ID	TPM avg	Samples expressed
19198	7.3568	1375
19197	4.9662	1670
19199	1.2584	681

Top tissues by expression

showing 100 of 263 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ventricular zone	UBERON:0003053	90.69	gold quality
ganglionic eminence	UBERON:0004023	89.72	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	87.68	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	86.93	gold quality
secondary oocyte	CL:0000655	85.09	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	82.77	gold quality
left testis	UBERON:0004533	80.50	gold quality
right testis	UBERON:0004534	80.15	gold quality
testis	UBERON:0000473	80.14	gold quality
oocyte	CL:0000023	80.00	gold quality
stromal cell of endometrium	CL:0002255	79.84	gold quality
mucosa of transverse colon	UBERON:0004991	78.96	gold quality
parotid gland	UBERON:0001831	78.91	gold quality
adrenal tissue	UBERON:0018303	78.07	gold quality
right adrenal gland cortex	UBERON:0035827	76.59	gold quality
rectum	UBERON:0001052	76.17	gold quality
right adrenal gland	UBERON:0001233	76.08	gold quality
anterior cingulate cortex	UBERON:0009835	75.99	gold quality
caudate nucleus	UBERON:0001873	75.92	gold quality
cingulate cortex	UBERON:0003027	75.90	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	75.78	gold quality
putamen	UBERON:0001874	75.72	gold quality
nucleus accumbens	UBERON:0001882	75.65	gold quality
lymph node	UBERON:0000029	75.32	gold quality
prefrontal cortex	UBERON:0000451	75.25	gold quality
tibial nerve	UBERON:0001323	75.23	gold quality
bone marrow	UBERON:0002371	75.20	gold quality
left adrenal gland	UBERON:0001234	75.19	gold quality
right frontal lobe	UBERON:0002810	75.16	gold quality
granulocyte	CL:0000094	75.09	gold quality
amygdala	UBERON:0001876	74.76	gold quality
sperm	CL:0000019	74.55	silver quality
cortical plate	UBERON:0005343	74.55	gold quality
adrenal cortex	UBERON:0001235	74.52	gold quality
left adrenal gland cortex	UBERON:0035825	74.32	gold quality
apex of heart	UBERON:0002098	74.23	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	74.09	gold quality
esophagus mucosa	UBERON:0002469	73.97	gold quality
adrenal gland	UBERON:0002369	73.96	gold quality
embryo	UBERON:0000922	73.94	gold quality
medial globus pallidus	UBERON:0002477	73.93	silver quality
neocortex	UBERON:0001950	73.92	gold quality
tendon of biceps brachii	UBERON:0008188	73.79	silver quality
spinal cord	UBERON:0002240	73.43	gold quality
frontal cortex	UBERON:0001870	73.40	gold quality
heart right ventricle	UBERON:0002080	73.36	gold quality
globus pallidus	UBERON:0001875	73.32	silver quality
omental fat pad	UBERON:0010414	73.26	gold quality
peritoneum	UBERON:0002358	73.25	gold quality
lower esophagus mucosa	UBERON:0035834	73.20	gold quality
telencephalon	UBERON:0001893	73.14	gold quality
male germ cell	CL:0000015	73.04	gold quality
body of tongue	UBERON:0011876	72.87	silver quality
tonsil	UBERON:0002372	72.73	gold quality
forebrain	UBERON:0001890	72.65	gold quality
adipose tissue of abdominal region	UBERON:0007808	72.53	gold quality
gingival epithelium	UBERON:0001949	72.37	silver quality
right ovary	UBERON:0002118	72.35	gold quality
islet of Langerhans	UBERON:0000006	72.32	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	72.32	gold quality
cerebral cortex	UBERON:0000956	72.31	gold quality
cerebellar vermis	UBERON:0004720	72.28	gold quality
brain	UBERON:0000955	72.27	gold quality
vena cava	UBERON:0004087	72.19	gold quality
transverse colon	UBERON:0001157	71.99	gold quality
ectocervix	UBERON:0012249	71.97	gold quality
caecum	UBERON:0001153	71.95	gold quality
cardia of stomach	UBERON:0001162	71.86	gold quality
endometrium	UBERON:0001295	71.83	gold quality
leukocyte	CL:0000738	71.80	gold quality
tongue	UBERON:0001723	71.62	gold quality
right hemisphere of cerebellum	UBERON:0014890	71.56	gold quality
metanephros cortex	UBERON:0010533	71.53	gold quality
hypothalamus	UBERON:0001898	71.52	gold quality
cerebellar cortex	UBERON:0002129	71.51	gold quality
monocyte	CL:0000576	71.47	gold quality
substantia nigra	UBERON:0002038	71.46	gold quality
small intestine Peyer’s patch	UBERON:0003454	71.44	gold quality
Ammon’s horn	UBERON:0001954	71.43	gold quality
midbrain	UBERON:0001891	71.42	gold quality
bone marrow cell	CL:0002092	71.40	gold quality
cerebellar hemisphere	UBERON:0002245	71.37	gold quality
mononuclear cell	CL:0000842	71.27	gold quality
upper lobe of left lung	UBERON:0008952	71.26	gold quality
temporal lobe	UBERON:0001871	71.25	gold quality
left ovary	UBERON:0002119	71.23	gold quality
esophagus	UBERON:0001043	71.19	gold quality
saphenous vein	UBERON:0007318	71.18	silver quality
vagina	UBERON:0000996	71.13	gold quality
superior surface of tongue	UBERON:0007371	71.05	gold quality
spleen	UBERON:0002106	71.01	gold quality
hindlimb stylopod muscle	UBERON:0004252	70.96	gold quality
substantia nigra pars reticulata	UBERON:0001966	70.87	gold quality
pericardium	UBERON:0002407	70.85	silver quality
vermiform appendix	UBERON:0001154	70.82	gold quality
substantia nigra pars compacta	UBERON:0001965	70.77	silver quality
lateral globus pallidus	UBERON:0002476	70.72	silver quality
muscle of leg	UBERON:0001383	70.70	gold quality
left uterine tube	UBERON:0001303	70.68	gold quality
cerebellum	UBERON:0002037	70.66	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-9543	yes	37.88
E-CURD-112	yes	15.25
E-ANND-3	no	3.14

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 76 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM
Thymus	tissue	10.6
Bone marrow	tissue	8.7
Hippocampus	tissue	7.5
Locus coeruleus	tissue	7.3
Testis	tissue	6.5
Nucleus accumbens	tissue	5.8
Tonsil	tissue	5.5
Postcentral gyrus	tissue	4.8
Lymph node	tissue	4.6
Choroid plexus	tissue	4.6
Skin 1	tissue	3.6
Vagina	tissue	3.6
Pituitary gland	tissue	3.5
Rectum	tissue	3.5
Appendix	tissue	3.3
Colon	tissue	3.0
Placenta	tissue	3.0
Duodenum	tissue	3.0
Skeletal muscle	tissue	2.8
Small intestine	tissue	2.7
Stomach 1	tissue	2.1
Esophagus	tissue	2.1
Frontal cortex	tissue	2.1
Thyroid gland	tissue	2.1
Lung	tissue	2.1
Spleen	tissue	2.1
Caudate putamen	tissue	2.1
Smooth muscle	tissue	2.0
Adrenal gland	tissue	2.0
Breast	tissue	1.9
Tongue	tissue	1.9
Salivary gland	tissue	1.8
Kidney	tissue	1.8
Adipose tissue	tissue	1.7
Urinary bladder	tissue	1.7
Spinal cord	tissue	1.7
Ovary	tissue	1.6
Parathyroid gland	tissue	1.5
Endometrium 1	tissue	1.5
Heart muscle	tissue	1.4
Medulla oblongata	tissue	1.4
Cerebellum	tissue	1.4
Gallbladder	tissue	1.4
Corpus callosum	tissue	1.4
Prostate	tissue	1.4
Fallopian tube	tissue	1.4
Retina	tissue	1.3
Pancreas	tissue	1.3
Thalamus	tissue	1.3
Cervix	tissue	1.2
Cerebral cortex	tissue	1.2
Pons	tissue	1.2
Motor cortex	tissue	1.2
Putamen	tissue	1.2
Amygdala	tissue	1.2
Midbrain	tissue	1.2
Hypothalamus	tissue	1.2
Superior colliculi	tissue	1.2
Substantia nigra	tissue	1.2
Hippocampal formation	tissue	1.2

Brain sub-regions (HPA Brain Atlas): detected in 189; highest nTPM — Ventromedial nucleus (7.8), Area postrema (7.7), Hippocampus, CA1 (7.6), Inferior olive (7.4), Dorsal motor vagal complex (7.2).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): E2F4

miRNA regulators (miRDB)

Targeting CENPO by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 83 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4713-3P	100.00	65.92	505
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-4650-5P	99.98	64.69	999
HSA-MIR-4295	99.90	73.11	1838
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-8076	99.78	68.52	1170
HSA-MIR-1299	99.77	71.24	2389
HSA-MIR-1273H-5P	99.77	66.32	2471
HSA-MIR-1255A	99.74	68.09	744
HSA-MIR-1255B-5P	99.74	68.16	741
HSA-MIR-4306	99.72	70.50	3630
HSA-MIR-1825	99.72	68.11	1089
HSA-MIR-149-3P	99.72	68.22	3963
HSA-MIR-1200	99.71	70.42	1838
HSA-MIR-378G	99.71	64.90	1106
HSA-MIR-30B-3P	99.70	65.76	2325
HSA-MIR-3689A-3P	99.70	65.73	2306
HSA-MIR-3689B-3P	99.70	65.71	2311
HSA-MIR-3689C	99.70	65.71	2311
HSA-MIR-6779-5P	99.70	65.76	2363
HSA-MIR-6883-5P	99.69	68.05	3785
HSA-MIR-5004-5P	99.68	66.63	1294
HSA-MIR-519A-3P	99.67	71.67	1868
HSA-MIR-519B-3P	99.67	71.67	1868
HSA-MIR-519C-3P	99.67	71.67	1870
HSA-MIR-488-3P	99.61	68.79	1731
HSA-MIR-4649-3P	99.56	66.90	1783

Functional genomics

gnomAD constraint: pLI 4.35e-08, LOEUF 1.14, missense Z 0.391 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000380834 — one region, missense o/e 0.98.

Literature-anchored findings (GeneRIF, showing 6)

• CENP-O protein is a novel centromere antigen that is recognized by a very minor population of ACA-positive patients with scleroderma. (PMID:19286853)
• Data propose that CENP-P/O/R/Q/U self-assembles on kinetochores with varying stoichiometry and undergoes a pre-mitotic maturation step that could be important for kinetochores switching into the correct conformation for microtubule-attachment. (PMID:23028590)
• Knockdown of CENPO contributed to Gastric Cancer cell growth inhibition and apoptosis induction. (PMID:31485675)
• Differential requirements for the CENP-O complex reveal parallel PLK1 kinetochore recruitment pathways. (PMID:33596090)
• Prognostic and immune infiltrative biomarkers of CENPO in pan-cancer and its relationship with lung adenocarcinoma cell proliferation and metastasis. (PMID:37558987)
• High expression levels of centromere protein O participates in cell proliferation of human ovarian cancer. (PMID:38890751)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	cenpo	ENSDARG00000075619
mus_musculus	Cenpo	ENSMUSG00000020652
rattus_norvegicus	Cenpo	ENSRNOG00000050111

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1923800) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 22 distinct phenotype terms.

Mouse phenotype (MP)	Records
decreased circulating HDL cholesterol level	1
decreased circulating calcium level	1
abnormal lens morphology	1
hyperactivity	1
failure of primitive streak formation	1
failure to gastrulate	1
decreased embryo size	1
embryonic growth arrest	1
decreased circulating triglyceride level	1
decreased circulating free fatty acids level	1
increased heart weight	1
decreased circulating iron level	1
decreased circulating cholesterol level	1
decreased circulating glucose level	1
decreased blood urea nitrogen level	1
absent primitive node	1
embryonic lethality between implantation and placentation, complete penetrance	1
preweaning lethality, complete penetrance	1
absent head fold	1
embryonic lethality prior to organogenesis	1
embryonic lethality prior to tooth bud stage	1
decreased egg cylinder size	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Bos taurus	Q3ZBK8	78.7%	Diamond
Gallus gallus	Q1T7B8	49.5%	Diamond
Xenopus tropicalis	Q28HU3	43.2%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
ADCY3	protein-coding	109
PTRHD1	protein-coding	391356
NCOA1	protein-coding	8648
DNAJC27	protein-coding	51277
DNAJC27-AS1	ncRNA	729723
ITSN2	protein-coding	50618

Protein

Protein identifiers

Centromere protein O — Q9BU64 (reviewed: Q9BU64)

Alternative names: Interphase centromere complex protein 36

All UniProt accessions (1): Q9BU64

UniProt curated annotations — full annotation on UniProt →

Function. Component of the CENPA-CAD (nucleosome distal) complex, a complex recruited to centromeres which is involved in assembly of kinetochore proteins, mitotic progression and chromosome segregation. May be involved in incorporation of newly synthesized CENPA into centromeres via its interaction with the CENPA-NAC complex. Modulates the kinetochore-bound levels of NDC80 complex.

Subunit / interactions. Component of the CENPA-CAD complex, composed of CENPI, CENPK, CENPL, CENPO, CENPP, CENPQ, CENPR and CENPS. The CENPA-CAD complex interacts with the CENPA-NAC complex, at least composed of CENPA, CENPC, CENPH, CENPM, CENPN, CENPT and CENPU.

Subcellular location. Nucleus. Chromosome. Centromere. Kinetochore.

Similarity. Belongs to the CENP-O/MCM21 family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9BU64-1	1	yes
Q9BU64-2	2

RefSeq proteins (3): NP_001186732, NP_001309030, NP_077298 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR018464	CENP-O	Family

Pfam: PF09496

UniProt features (29 total): strand 12, helix 9, coiled-coil region 2, sequence conflict 2, chain 1, modified residue 1, splice variant 1, sequence variant 1

Structure

Experimental structures (PDB)

13 structures by resolution:

PDB	Title	Method	Resolution (Å)
28OP	Structure of the human inner kinetochore CCAN and CENP-C bound to DNA	ELECTRON MICROSCOPY	2.7
7R5S	Structure of the human CCAN bound to alpha satellite DNA	ELECTRON MICROSCOPY	2.83
7PKN	Structure of the human CCAN deltaCT complex	ELECTRON MICROSCOPY	3.2
7XHO	Structure of human inner kinetochore CCAN complex	ELECTRON MICROSCOPY	3.29
9TAW	Structure of the human inner kinetochore CCAN bound to DNA	ELECTRON MICROSCOPY	3.54
7PB8	Crystal structure of the CENP-OPQUR complex	X-RAY DIFFRACTION	3.68
7XHN	Structure of human inner kinetochore CCAN-DNA complex	ELECTRON MICROSCOPY	3.71
9TAX	Structure of the human inner kinetochore CCAN bound to a mono-CENP-A nucleosome	ELECTRON MICROSCOPY	4.5
7R5V	Structure of the human CCAN CENP-A alpha-satellite complex	ELECTRON MICROSCOPY	4.55
7QOO	Structure of the human inner kinetochore CCAN complex	ELECTRON MICROSCOPY	4.6
7YYH	Structure of the human CCANdeltaT CENP-A alpha-satellite complex	ELECTRON MICROSCOPY	8.9
7YWX	Structure of the human CCAN CENP-A alpha-satellite complex	ELECTRON MICROSCOPY	12
9TAY	Structure of the human inner kinetochore CCAN bound to a di-CENP-A nucleosome	ELECTRON MICROSCOPY	15.5

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9BU64-F1	85.64	0.62

Human Protein Atlas

Protein class: Predicted intracellular proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): nucleoplasm; nuclear bodies

Antibody reliability (HPA): IF supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1)

Type	Positions
Phosphoserine	35

Function

Pathways and Gene Ontology

Reactome pathways

7 curated (TAS) of 21; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

21 pathways:

ID	Pathway	Evidence
R-HSA-141444	Amplification of signal from unattached kinetochores via a MAD2 inhibitory signal	curated
R-HSA-606279	Deposition of new CENPA-containing nucleosomes at the centromere	curated
R-HSA-9648025	EML4 and NUDC in mitotic spindle formation	curated
R-HSA-68877	Mitotic Prometaphase	curated
R-HSA-5663220	RHO GTPases Activate Formins	curated
R-HSA-2500257	Resolution of Sister Chromatid Cohesion	curated
R-HSA-2467813	Separation of Sister Chromatids	curated
R-HSA-141424	Amplification of signal from the kinetochores	—
R-HSA-1640170	Cell Cycle	—
R-HSA-69620	Cell Cycle Checkpoints	—
R-HSA-69278	Cell Cycle, Mitotic	—
R-HSA-73886	Chromosome Maintenance	—
R-HSA-68886	M Phase	—
R-HSA-68882	Mitotic Anaphase	—
R-HSA-2555396	Mitotic Metaphase and Anaphase	—
R-HSA-69618	Mitotic Spindle Checkpoint	—
R-HSA-774815	Nucleosome assembly	—
R-HSA-195258	RHO GTPase Effectors	—
R-HSA-162582	Signal Transduction	—
R-HSA-194315	Signaling by Rho GTPases	—
R-HSA-9716542	Signaling by Rho GTPases, Miro GTPases and RHOBTB3	—

MSigDB gene sets: 145 (showing top): TGCGCANK_UNKNOWN, GCM_GSPT1, TGCACTT_MIR519C_MIR519B_MIR519A, GGCKCATGS_UNKNOWN, DODD_NASOPHARYNGEAL_CARCINOMA_UP, FISCHER_DREAM_TARGETS, BASAKI_YBX1_TARGETS_UP, GCM_NF2, REACTOME_CELL_CYCLE_CHECKPOINTS, GOCC_CHROMOSOMAL_REGION, GOCC_NUCLEAR_BODY, TCCCRNNRTGC_UNKNOWN, GOCC_CONDENSED_CHROMOSOME_CENTROMERIC_REGION, GOBP_CELL_CYCLE_PROCESS, SCGGAAGY_ELK1_02

GO Biological Process (2): chromosome segregation (GO:0007059), kinetochore assembly (GO:0051382)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (7): nucleus (GO:0005634), nucleoplasm (GO:0005654), cytosol (GO:0005829), nuclear body (GO:0016604), Mis6-Sim4 complex (GO:0031511), chromosome, centromeric region (GO:0000775), kinetochore (GO:0000776)

Reactome top-level categories

14 top-level categories:

Category	Pathways
Cell Cycle	3
Mitotic Prometaphase	2
M Phase	2
Amplification of signal from the kinetochores	1
Mitotic Anaphase	1
RHO GTPase Effectors	1
Nucleosome assembly	1
Mitotic Spindle Checkpoint	1
Signaling by Rho GTPases, Miro GTPases and RHOBTB3	1
Signaling by Rho GTPases	1
Mitotic Metaphase and Anaphase	1
Cell Cycle, Mitotic	1
Cell Cycle Checkpoints	1
Chromosome Maintenance	1

GO top-level categories

16 GO namespaces:

Category	Terms
cellular anatomical structure	2
intracellular membraneless organelle	2
cell cycle process	1
kinetochore organization	1
protein-containing complex assembly	1
membraneless organelle assembly	1
binding	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
cytoplasm	1
nucleoplasm	1
inner kinetochore	1
protein-containing complex	1
chromosomal region	1
condensed chromosome, centromeric region	1
supramolecular complex	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 2 of 11 annotations. The rest are phylogenetic / computational / electronic (IEA).

2 experimentally-supported GO terms:

GO term	NS	Evidence
nuclear body	CC	direct assay
nucleoplasm	CC	direct assay

Protein interactions and networks

STRING

showing 15 of 814 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CENPO	CENPP	Q6IPU0	970
CENPO	CENPQ	Q7L2Z9	968
CENPO	CENPU	Q71F23	956
CENPO	CENPH	Q9H3R5	942
CENPO	CENPI	Q92674	932
CENPO	CENPT	Q96BT3	914
CENPO	CENPN	Q96H22	886
CENPO	CENPA	P49450	870
CENPO	CENPM	Q9NSP4	849
CENPO	CENPC	Q03188	818
CENPO	ITGB3BP	Q13352	814
CENPO	CENPK	Q9BS16	811
CENPO	CENPL	Q8N0S6	778
CENPO	CENPS	Q8N2Z9	774
CENPO	CENPW	Q5EE01	724

IntAct

Human interaction partners of CENPO in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

11 partners by confidence:

Partner	Interaction type	MIscore	Records
CENPP	physical association	0.870	9
CEP170P1	physical association	0.740	5
DCDC2	physical association	0.560	3
FOS	physical association	0.560	3
FOSB	physical association	0.560	3
NECAB2	physical association	0.560	3
RNF40	physical association	0.370	1
CENPX	association	0.350	1
ITGB3BP	association	0.350	1
RPL4	association	0.350	1
WDR4	association	0.350	1

BioGRID (86 interactions; top human partners by supporting records): CENPP (Two-hybrid; 9 records), CENPU (Affinity Capture-MS; 7 records), CENPQ (Affinity Capture-MS; 6 records), ITGB3BP (Affinity Capture-MS; 6 records), CENPN (Affinity Capture-MS; 3 records), CEP170P1 (Two-hybrid; 3 records), ARL5B (Affinity Capture-MS; 2 records), CENPH (Affinity Capture-MS; 2 records), CENPI (Affinity Capture-MS; 2 records), CENPM (Affinity Capture-MS; 2 records), FOS (Two-hybrid; 2 records), MTFR1 (Affinity Capture-MS; 2 records), NECAB2 (Two-hybrid; 2 records), APITD1 (Affinity Capture-MS), ATP2B1 (Affinity Capture-MS)

SIGNOR signaling

1 signaling interactions:

A	Effect	B	Mechanism
CENPO	“form complex”	“CCAN complex”	binding

Protein complexes (CORUM) (3)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

3 complexes by size:

Complex	Subunits	Members
CEN complex	37	SUPT16H, BMI1, CENPC, CENPU, FBL, RNF2, COBLL1, CUL4A, DDB1, HSPA5, NUP93, KIF23, ZFP91, CENPI, CENPK, RACGAP1, SSRP1, ZC3H13, CENPH, CENPM, HSPA8, VIRMA, CBX3, CENPB, SMARCA5, SRRT, CBX8, CENPA, CENPO, PLPPR3, RSF1, WDR11, WTAP, CENPL, DHX38, RING1, SHCBP1
CENP-A NAC-CAD complex	14	CENPB, CENPM, CENPN, CENPO, CENPQ, CENPS, CENPT, CENPC, CENPH, CENPK, CENPL, CENPP, CENPU, ITGB3BP
CENP-H-I complex	11	CENPH, CENPI, CENPK, CENPM, CENPP, CENPU, CENPL, CENPN, CENPO, CENPQ, ITGB3BP

Disease & clinical

Genetic variants

Variant evidence for CENPO: 53 ClinVar records (0 pathogenic / likely pathogenic); 21 GWAS associations.

ClinVar

53 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	33
Likely benign	8
Benign	0

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 37 predictions of 724):

Position(s)	Effect	Δscore	Sites
2:24816719	acceptor_gain	1.0000
2:24799673–24799674	acceptor_loss	0.9900	6
2:24799845–24799846	donor_loss	0.9900	6
2:24799849	donor_loss	0.9900	3
2:24799857	donor_gain	0.9900
2:24814373–24814375	acceptor_loss	0.9900	7
2:24814463	donor_gain	0.9900
2:24814479	donor_gain	0.9900
2:24814493–24814495	donor_loss	0.9900	6
2:24815495–24815496	acceptor_loss	0.9900	5

AlphaMissense

256 missense substitutions predicted likely pathogenic (of 1,936 scored), across 92 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
F220	8	0.835	0.966
F130	7	0.822	0.960
F284	7	0.804	0.905
R190	6	0.891	0.984
F158	6	0.816	0.969
P247	6	0.812	0.945
Q193	6	0.771	0.887
P156	6	0.754	0.885
H153	6	0.742	0.876
F176	5	0.841	0.910
N212	5	0.790	0.902
Y239	5	0.781	0.889
F275	5	0.751	0.887
D141	5	0.653	0.708
Y222	4	0.816	0.886
G112	4	0.767	0.851
Y187	4	0.761	0.905
Y138	4	0.739	0.884
G121	4	0.721	0.748
F287	4	0.676	0.704

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

6 prognostic cancer types:

Cancer	Prognostic	p-value
Liver Hepatocellular Carcinoma (TCGA)	unfavorable	2.25e-06
Kidney Renal Clear Cell Carcinoma (TCGA)	unfavorable	1.68e-05
Kidney Renal Clear Cell Carcinoma (validation)	unfavorable	0.000408
Kidney Chromophobe (TCGA)	unfavorable	0.000452
Pancreatic Adenocarcinoma (validation)	unfavorable	0.000564
Lung Adenocarcinoma (TCGA)	unfavorable	0.000962

Disease associations

OMIM: gene MIM:611504 | disease phenotypes:

GWAS associations

21 associations:

Study	Trait	p-value
GCST008129_87	Body mass index	4e-59
GCST007293_82	Body fat distribution (arm fat ratio)	2e-39
GCST002647_136	Height	8e-33
GCST005950_4	Body mass index x sex x age interaction (4df test)	5e-26
GCST005951_5	Body mass index	3e-24
GCST007293_129	Body fat distribution (arm fat ratio)	5e-22
GCST007293_74	Body fat distribution (arm fat ratio)	2e-21
GCST005953_10	Body mass index (age <50)	6e-20
GCST90020029_338	Waist circumference adjusted for body mass index	7e-14
GCST001956_65	Height	1e-13
GCST007294_120	Body fat distribution (trunk fat ratio)	9e-10
GCST005531_9	Multiple sclerosis	3e-9
GCST001255_1	Type 1 diabetes	4e-9
GCST005952_4	Body mass index (age>50)	5e-9
GCST004077_6	Cognitive function	7e-9
GCST008157_58	Body fat mass	4e-8
GCST005196_210	Coronary artery disease	3e-7
GCST008163_15	Height	3e-7
GCST008154_13	Trunk fat mass	2e-6
GCST007294_154	Body fat distribution (trunk fat ratio)	7e-6
GCST008514_4	Peginterferon alfa-2a treatment response in chronic hepatitis B infection	8e-6

EFO canonical traits (from GWAS)

7 canonical traits:

EFO ID	Trait name
EFO:0004337	intelligence
EFO:0004340	body mass index
EFO:0008007	age at assessment
EFO:0008343	sex interaction measurement
EFO:0004341	body fat distribution
EFO:0010103	response to peginterferon alfa-2a
EFO:0007789	BMI-adjusted waist circumference

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

39 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	affects methylation, increases expression	2
Resveratrol	affects cotreatment, increases expression	2
Acetaminophen	decreases expression, increases expression	2
Aflatoxin B1	increases expression, increases methylation	2
aristolochic acid I	increases expression	1
afuresertib	decreases expression	1
FR900359	increases phosphorylation	1
propionaldehyde	decreases expression	1
pirinixic acid	affects binding, decreases expression, increases activity	1
bisphenol A	decreases expression	1
beta-lapachone	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
2,3-bis(3’-hydroxybenzyl)butyrolactone	increases expression, affects cotreatment	1
bisphenol S	affects cotreatment, decreases expression	1
jinfukang	increases expression	1
NSC 689534	affects binding, decreases expression	1
Dasatinib	decreases expression	1
Sunitinib	decreases expression	1
Atrazine	decreases expression	1
Azacitidine	increases expression	1
Benzo(a)pyrene	increases expression	1
Cadmium	increases abundance, increases expression	1
Caffeine	increases phosphorylation	1
Calcitriol	decreases expression, affects cotreatment	1
Copper	decreases expression, affects binding	1
Coumestrol	affects cotreatment, increases expression	1
Dichlorodiphenyl Dichloroethylene	increases expression	1
Dexamethasone	affects cotreatment, decreases expression	1
Doxorubicin	decreases expression	1
Indomethacin	decreases expression, affects cotreatment	1

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.