CFAP65

Summary

CFAP65 (cilia and flagella associated protein 65, HGNC:25325) is a protein-coding gene on chromosome 2q35, encoding Cilia- and flagella-associated protein 65 (Q6ZU64). Plays a role in flagellar formation and sperm motility.

The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility.

Source: NCBI Gene 255101 — RefSeq curated summary.

At a glance

• Gene–disease (curated): non-syndromic male infertility due to sperm motility disorder (Supportive, GenCC) — +1 more curated relationship
• GWAS associations: 2
• Clinical variants (ClinVar): 94 total — 5 pathogenic, 3 likely-pathogenic
• Phenotypes (HPO): 7
• MANE Select transcript: NM_194302

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:25325
Approved symbol	CFAP65
Name	cilia and flagella associated protein 65
Location	2q35
Locus type	gene with protein product
Status	Approved
Aliases	DKFZp434O0527, MGC35338
Ensembl gene	ENSG00000181378
Ensembl biotype	protein_coding
OMIM	614270
Entrez	255101

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 9 protein_coding, 3 retained_intron

ENST00000295729, ENST00000341552, ENST00000409865, ENST00000410037, ENST00000413871, ENST00000436631, ENST00000453220, ENST00000457968, ENST00000458526, ENST00000462848, ENST00000463683, ENST00000474601

RefSeq mRNA: 4 — MANE Select: NM_194302 NM_001278295, NM_001278296, NM_152389, NM_194302

CCDS: CCDS2430, CCDS2431, CCDS63125, CCDS63126

Canonical transcript exons

ENST00000341552 — 35 exons

Exon	Start	End
ENSE00001265987	219003135	219003272
ENSE00001265995	219003952	219004455
ENSE00001266003	219005434	219005562
ENSE00001266015	219006021	219006223
ENSE00001266026	219006465	219006509
ENSE00001266048	219009047	219009154
ENSE00001364112	219013519	219013585
ENSE00001364683	219024015	219024260
ENSE00001367785	219013259	219013369
ENSE00001370263	219029403	219029668
ENSE00001371639	219022171	219022329
ENSE00001372178	219019051	219019179
ENSE00001373757	219009942	219010085
ENSE00001374388	219029986	219030208
ENSE00001376078	219019506	219019719
ENSE00001377861	219021152	219021280
ENSE00001378297	219031489	219031658
ENSE00001378663	219009347	219009460
ENSE00001381212	219010805	219010996
ENSE00001384984	219013868	219014044
ENSE00001385540	219023207	219023431
ENSE00001385844	219026022	219026159
ENSE00001386343	219010546	219010704
ENSE00001388017	219021780	219021930
ENSE00001462434	219027650	219028009
ENSE00001693723	219002846	219003021
ENSE00001751084	219038896	219039050
ENSE00003465166	219035480	219035664
ENSE00003470422	219032470	219032572
ENSE00003545853	219041488	219041516
ENSE00003601600	219038375	219038578
ENSE00003623951	219040519	219040564
ENSE00003644628	219030689	219030834
ENSE00003648253	219031106	219031305
ENSE00003691495	219028201	219028401

Expression profiles

Bgee: expression breadth ubiquitous, 117 present calls, max score 98.11.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.2866 / max 30.2227, expressed in 117 samples.

FANTOM5 promoters (1 alternative TSS)

Promoter ID	TPM avg	Samples expressed
34013	0.2866	117

Top tissues by expression

231 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right uterine tube	UBERON:0001302	98.11	gold quality
buccal mucosa cell	CL:0002336	89.06	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	88.55	gold quality
right testis	UBERON:0004534	82.50	gold quality
left testis	UBERON:0004533	82.48	gold quality
testis	UBERON:0000473	80.05	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	79.08	gold quality
fallopian tube	UBERON:0003889	74.66	gold quality
right lung	UBERON:0002167	73.55	gold quality
pituitary gland	UBERON:0000007	73.34	gold quality
adenohypophysis	UBERON:0002196	73.05	gold quality
bronchial epithelial cell	CL:0002328	72.91	gold quality
bronchus	UBERON:0002185	71.45	gold quality
nasal cavity epithelium	UBERON:0005384	70.71	gold quality
tendon of biceps brachii	UBERON:0008188	70.14	gold quality
upper arm skin	UBERON:0004263	68.59	gold quality
left uterine tube	UBERON:0001303	68.04	gold quality
nasal cavity mucosa	UBERON:0001826	68.01	gold quality
pancreatic ductal cell	CL:0002079	66.09	silver quality
oviduct epithelium	UBERON:0004804	66.09	gold quality
caudate nucleus	UBERON:0001873	65.99	gold quality
hypothalamus	UBERON:0001898	65.78	gold quality
kidney epithelium	UBERON:0004819	65.56	gold quality
cartilage tissue	UBERON:0002418	64.45	gold quality
prefrontal cortex	UBERON:0000451	63.89	gold quality
nucleus accumbens	UBERON:0001882	63.67	gold quality
Brodmann (1909) area 9	UBERON:0013540	61.56	gold quality
biceps brachii	UBERON:0001507	61.09	gold quality
forebrain	UBERON:0001890	61.05	gold quality
right frontal lobe	UBERON:0002810	60.89	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	9.99

Regulation

Is transcription factor: no

Literature-anchored findings (GeneRIF, showing 3)

• CFAP65 mutations may cause spermatozoa to be completely immotile. (PMID:31413122)
• Biallelic mutations in CFAP65 cause male infertility with multiple morphological abnormalities of the sperm flagella in humans and mice. (PMID:31501240)
• Male infertility-associated Ccdc108 regulates multiciliogenesis via the intraflagellar transport machinery. (PMID:35201641)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	cfap65	ENSDARG00000006863
mus_musculus	Cfap65	ENSMUSG00000047021
rattus_norvegicus	Cfap65	ENSRNOG00000056996
drosophila_melanogaster	Sox14	FBGN0005612
drosophila_melanogaster	Sox21a	FBGN0036411

Paralogs (20): SOX8 (ENSG00000005513), SOX30 (ENSG00000039600), SOX10 (ENSG00000100146), SOX6 (ENSG00000110693), SOX4 (ENSG00000124766), SOX21 (ENSG00000125285), SOX9 (ENSG00000125398), SOX15 (ENSG00000129194), SOX5 (ENSG00000134532), SOX3 (ENSG00000134595), SOX13 (ENSG00000143842), SOX17 (ENSG00000164736), SOX14 (ENSG00000168875), SOX7 (ENSG00000171056), SOX11 (ENSG00000176887), SOX12 (ENSG00000177732), SOX2 (ENSG00000181449), SOX1 (ENSG00000182968), SRY (ENSG00000184895), SOX18 (ENSG00000203883)

Protein

Protein identifiers

Cilia- and flagella-associated protein 65 — Q6ZU64 (reviewed: Q6ZU64)

Alternative names: Coiled-coil domain-containing protein 108

All UniProt accessions (5): C9JIV0, C9JLP9, C9JVA0, H7C0B4, Q6ZU64

UniProt curated annotations — full annotation on UniProt →

Function. Plays a role in flagellar formation and sperm motility. Essential for acrosome formation, manchette organization, spermatid head morphogenesis and mitochondrial sheath assembly within the sperm flagellum during spermiogenesis. Also required for proper assembly and stabilization of the C2a projection, a structural subunit of the central pair apparatus within the axoneme of motile cilia and flagella.

Subunit / interactions. Interacts with CFAP47. Interacts with MYCBPAP, MNS1, TPPP2, RSPH1, ZPBP, SPACA1, WDR35, SPAG16, SPATA4, CFAP20 and CFAP70. Interacts with MYCBP in a MYCBPAP-dependent manner.

Subcellular location. Cell projection. Cilium. Flagellum membrane. Cytoplasmic vesicle. Secretory vesicle. Acrosome membrane. Cytoplasm. Flagellum. Cytoskeleton. Cilium axoneme. Flagellum axoneme.

Disease relevance. Spermatogenic failure 40 (SPGF40) [MIM:618664] An autosomal recessive infertility disorder characterized by severely reduced or absent sperm motility, due to multiple morphologic anomalies such as absent, short, bent, coiled and irregular-caliber tails. Patient spermatozoa may also show morphologic defects of the sperm head. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the CFAP65 family.

Isoforms (4)

UniProt ID	Names	Canonical?
Q6ZU64-1	1	yes
Q6ZU64-3	2
Q6ZU64-4	3
Q6ZU64-5	4

RefSeq proteins (4): NP_001265224, NP_001265225, NP_689602, NP_919278* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000535	MSP_dom	Domain
IPR013783	Ig-like_fold	Homologous_superfamily
IPR052614	CFAP65	Family
IPR053879	HYDIN_VesB_CFA65-like_Ig	Domain
IPR056305	Ig_CFAP65_10th	Domain
IPR056344	Ig_CFAP65-like_9th	Domain
IPR057467	Ig_CFAP65_8th	Domain
IPR057470	Ig_CFAP65_7th	Domain
IPR058536	Ig_CFAP65_4th	Domain

Pfam: PF22544, PF24291, PF24507, PF24816, PF25248, PF25249

UniProt features (31 total): sequence variant 13, splice variant 6, sequence conflict 3, compositionally biased region 3, region of interest 2, chain 1, transmembrane region 1, domain 1, coiled-coil region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q6ZU64-F1	71.03	0.16

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 129 (showing top): GSE45365_NK_CELL_VS_CD8A_DC_DN, RNGTGGGC_UNKNOWN, GOCC_SECRETORY_GRANULE, GOBP_VESICLE_ORGANIZATION, AP4_Q6, GOBP_MALE_GAMETE_GENERATION, CAGCTG_AP4_Q5, HATADA_METHYLATED_IN_LUNG_CANCER_DN, GOBP_SECRETORY_GRANULE_ORGANIZATION, GOBP_CELLULAR_COMPONENT_ASSEMBLY_INVOLVED_IN_MORPHOGENESIS, GOBP_CILIUM_ORGANIZATION, GOBP_CILIUM_MOVEMENT, GATA1_01, GOBP_CILIUM_OR_FLAGELLUM_DEPENDENT_CELL_MOTILITY, GOBP_ACROSOME_ASSEMBLY

GO Biological Process (3): sperm axoneme assembly (GO:0007288), flagellated sperm motility (GO:0030317), cell projection organization (GO:0030030)

GO Molecular Function (2): RNA binding (GO:0003723), protein binding (GO:0005515)

GO Cellular Component (11): acrosomal vesicle (GO:0001669), acrosomal membrane (GO:0002080), cytoplasm (GO:0005737), sperm flagellum (GO:0036126), sperm midpiece (GO:0097225), plasma membrane (GO:0005886), cilium (GO:0005929), membrane (GO:0016020), cytoplasmic vesicle (GO:0031410), motile cilium (GO:0031514), cell projection (GO:0042995)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	4
developmental process involved in reproduction	1
axoneme assembly	1
sperm flagellum assembly	1
cilium-dependent cell motility	1
cilium movement involved in cell motility	1
sperm motility	1
cellular component organization	1
nucleic acid binding	1
binding	1
secretory granule	1
acrosomal vesicle	1
secretory granule membrane	1
intracellular anatomical structure	1
9+2 motile cilium	1
sperm flagellum	1
membrane	1
cell periphery	1
intraciliary transport particle	1
membrane-bounded organelle	1
plasma membrane bounded cell projection	1
cytoplasm	1
intracellular vesicle	1
cilium	1

Protein interactions and networks

STRING

414 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CFAP65	CFAP70	Q5T0N1	609
CFAP65	CRYBA2	P53672	599
CFAP65	CFAP43	Q8NDM7	584
CFAP65	CFAP47	Q6ZTR5	570
CFAP65	CFAP44	Q96MT7	551
CFAP65	TTC29	Q8NA56	479
CFAP65	TTC21A	Q8NDW8	479
CFAP65	CFAP69	A5D8W1	474
CFAP65	RSPH10B	P0C881	471
CFAP65	QRICH2	Q9H0J4	459
CFAP65	SPATA17	Q96L03	448
CFAP65	FSIP2	Q5CZC0	447
CFAP65	ARMC2	Q8NEN0	446
CFAP65	CFAP99	D6REC4	445
CFAP65	CFAP251	Q8TBY9	432

IntAct

4 interactions, top by confidence:

A	B	Type	Score
LRRK2		psi-mi:“MI:0914”(association)	0.350
PRKAR1A	RBFOX3	psi-mi:“MI:0914”(association)	0.350

BioGRID (4): CCDC108 (Two-hybrid), GART (Co-fractionation), CCDC108 (Affinity Capture-MS), CCDC108 (Protein-RNA)

ESM2 similar proteins: A0A0G2JEB6, A0JM56, B0DOB4, B0FXQ5, B1ANS9, B4F7L9, B4GQJ7, B5DHW4, B7FF06, B7FF07, B7FF08, B7FF09, B7FF12, C5IAW9, F1LW30, F1P4W9, O08747, O95185, P0DM40, Q008S8, Q18264, Q32NR9, Q3V0B4, Q402B2, Q4G0P3, Q5R4M2, Q5T0N1, Q5XI14, Q6AXU1, Q6DCF6, Q6NRS1, Q6P2C0, Q6P5D8, Q6UXZ4, Q6ZTR5, Q6ZU64, Q761X5, Q7T2Z5, Q80W93, Q86YR7

Diamond homologs: F1P4W9, Q3V0B4, Q6ZU64

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

94 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	5
Likely pathogenic	3
Uncertain significance	38
Likely benign	22
Benign	10

Top pathogenic / likely-pathogenic (8)

Variant ID	HGVS	Classification
2066848	NM_194302.4(CFAP65):c.400C>T (p.Gln134Ter)	Pathogenic
694534	NM_194302.4(CFAP65):c.5341G>T (p.Glu1781Ter)	Pathogenic
694535	NM_194302.4(CFAP65):c.2284C>T (p.Arg762Ter)	Pathogenic
694536	NM_194302.4(CFAP65):c.1580del (p.Leu527fs)	Pathogenic
694583	NM_194302.4(CFAP65):c.2675G>A (p.Trp892Ter)	Pathogenic
2160780	NM_194302.4(CFAP65):c.3602+1G>T	Likely pathogenic
2629507	NM_194302.4(CFAP65):c.3603G>A (p.Trp1201Ter)	Likely pathogenic
3256948	NM_194302.4(CFAP65):c.5518G>T (p.Glu1840Ter)	Likely pathogenic

SpliceAI

6412 predictions. Top by Δscore:

Variant	Effect	Δscore
2:219003019:CTC:C	acceptor_gain	1.0000
2:219003020:TCC:T	acceptor_loss	1.0000
2:219003022:CTGGA:C	acceptor_loss	1.0000
2:219003129:CCTTA:C	donor_loss	1.0000
2:219003130:CTTAC:C	donor_loss	1.0000
2:219003131:TTAC:T	donor_loss	1.0000
2:219003132:TACC:T	donor_loss	1.0000
2:219003133:A:AC	donor_gain	1.0000
2:219003133:ACC:A	donor_loss	1.0000
2:219003134:C:A	donor_loss	1.0000
2:219003134:C:CC	donor_gain	1.0000
2:219003271:GC:G	acceptor_gain	1.0000
2:219003271:GCC:G	acceptor_loss	1.0000
2:219003272:CC:C	acceptor_gain	1.0000
2:219003273:C:CC	acceptor_gain	1.0000
2:219003273:CTGC:C	acceptor_loss	1.0000
2:219004332:CAGG:C	donor_gain	1.0000
2:219006510:C:CC	acceptor_gain	1.0000
2:219009035:AGC:A	donor_gain	1.0000
2:219009041:CCTCA:C	donor_loss	1.0000
2:219009042:CTCAC:C	donor_loss	1.0000
2:219009043:TCA:T	donor_loss	1.0000
2:219009044:CAC:C	donor_loss	1.0000
2:219009046:C:A	donor_loss	1.0000
2:219009046:CCT:C	donor_gain	1.0000
2:219009055:T:A	donor_gain	1.0000
2:219009081:T:TA	donor_gain	1.0000
2:219009150:TACAG:T	acceptor_gain	1.0000
2:219009152:CAG:C	acceptor_gain	1.0000
2:219009155:C:CC	acceptor_gain	1.0000

AlphaMissense

12708 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
2:219010840:A:G	W1372R	0.996
2:219010840:A:T	W1372R	0.996
2:219023284:A:G	W915R	0.996
2:219023284:A:T	W915R	0.996
2:219022320:A:G	W944R	0.995
2:219022320:A:T	W944R	0.995
2:219027799:A:G	W688R	0.994
2:219027799:A:T	W688R	0.994
2:219010979:A:C	N1325K	0.993
2:219010979:A:T	N1325K	0.993
2:219009971:A:G	W1475R	0.992
2:219009971:A:T	W1475R	0.992
2:219031283:A:G	W280R	0.992
2:219031283:A:T	W280R	0.992
2:219032486:A:G	F210S	0.991
2:219019052:A:G	W1201R	0.990
2:219019052:A:T	W1201R	0.990
2:219009071:G:C	F1550L	0.989
2:219009071:G:T	F1550L	0.989
2:219009073:A:G	F1550L	0.989
2:219027827:G:C	N678K	0.989
2:219027827:G:T	N678K	0.989
2:219032485:G:C	F210L	0.989
2:219032485:G:T	F210L	0.989
2:219032487:A:G	F210L	0.989
2:219010957:A:C	Y1333D	0.988
2:219035556:A:G	W156R	0.988
2:219035556:A:T	W156R	0.988
2:219010655:A:G	F1400S	0.987
2:219013299:A:G	F1306S	0.987

dbSNP variants (sampled 300 via entrez): RS1000123535 (2:219025697 G>A), RS1000139032 (2:219019906 C>T), RS1000239962 (2:219029938 GCAGGGGCTGCTCCTGTCCC>G), RS1000243978 (2:219010820 C>T), RS1000273905 (2:219020273 C>T), RS1000476000 (2:219021385 C>T), RS1000612730 (2:219021692 C>G,T), RS1000816287 (2:219016054 A>G), RS1000843066 (2:219010395 G>A,C,T), RS1000883562 (2:219017072 AC>A), RS1001069259 (2:219005739 T>C), RS1001123964 (2:219015820 C>T), RS1001187985 (2:219027377 T>C,G), RS1001246165 (2:219012127 A>C), RS1001254763 (2:219038630 G>C,T)

Disease associations

OMIM: gene MIM:614270 | disease phenotypes: MIM:618664

GenCC curated gene-disease

Disease	Classification	Inheritance
non-syndromic male infertility due to sperm motility disorder	Supportive	Autosomal recessive
spermatogenic failure 40	Limited	Autosomal recessive

Mondo (3): spermatogenic failure 40 (MONDO:0032859), prostate cancer (MONDO:0008315), (MONDO:0017173)

Orphanet (2): Familial prostate cancer (Orphanet:1331), Non-syndromic male infertility due to sperm motility disorder (Orphanet:276234)

HPO phenotypes

7 total (7 of 7 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000798	Oligozoospermia
HP:0003251	Male infertility
HP:0012208	Immotile sperm
HP:0032558	Absent sperm flagella
HP:0032559	Short sperm flagella
HP:0032560	Coiled sperm flagella

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST008839_220	Height	4.000000e-14
GCST012226_196	Waist circumference adjusted for body mass index	2.000000e-09

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0007789	BMI-adjusted waist circumference

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D011471	Prostatic Neoplasms	C04.588.945.440.770; C12.100.500.260.750; C12.100.500.565.625; C12.200.294.260.750; C12.200.294.565.625; C12.200.758.409.750; C12.900.619.750

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

16 total (human), top 16 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation	2
Aflatoxin B1	increases methylation	2
testosterone undecanoate	affects cotreatment, increases expression	1
terbufos	increases methylation	1
aflatoxin B2	increases methylation	1
Grape Seed Proanthocyanidins	affects cotreatment, decreases expression	1
Air Pollutants	increases abundance, increases expression	1
Arsenic	affects methylation	1
Catechin	affects cotreatment, decreases expression	1
Fonofos	increases methylation	1
Parathion	increases methylation	1
Smoke	increases expression, increases abundance	1
Tobacco Smoke Pollution	decreases expression	1
Valproic Acid	increases methylation	1
Levonorgestrel	affects cotreatment, increases expression	1
Antirheumatic Agents	decreases expression	1

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00029224	PHASE4	COMPLETED	Treatment With Zoledronic Acid in Patients With Breast Cancer, Multiple Myeloma, and Prostate Cancer With Cancer Related Bone Lesions
NCT00035997	PHASE4	COMPLETED	Open-label Trial on the Effect of I.V. Zoledronic Acid 4 mg on Bone Density in Hormone Sensitive Prostate Cancer Patients With Bone Metastasis
NCT00063609	PHASE4	COMPLETED	The Effect of Zoledronic Acid on Bone Loss in Prostate Cancer Patients Undergoing Androgen Deprivation Therapy
NCT00103623	PHASE4	SUSPENDED	The Plenaxis® Experience Study
NCT00106392	PHASE4	COMPLETED	A Safety and Efficacy Study of Prograf in the Prevention of Erectile Dysfunction After Radical Prostatectomy
NCT00185029	PHASE4	UNKNOWN	MR-Lymphography and Lymph Node Staging in Prostate Cancer
NCT00199485	PHASE4	COMPLETED	Angelica Sinensis for the Treatment of Hot Flashes in Men Undergoing LHRH Therapy for Prostate Cancer
NCT00219219	PHASE4	COMPLETED	Zoledronic Acid in the Prevention of Skeletal-related Events in Hormone Refractory and Hormone-sensitive Prostate Cancer Patients With Bone Metastases
NCT00219271	PHASE4	COMPLETED	Effect Of Zoledronic Acid On Circulating And Bone Marrow-Residing Prostate Cancer Cells In Patients With Clinically Localized Prostate Cancer
NCT00237146	PHASE4	COMPLETED	Study to Evaluate Zoledronic Acid on Quality of Life and Skeletal-related Events as Adjuvant Treatment in Patients With Hormone-naïve Prostate Cancer and Bone Metastasis Who Have Undergone Orchiectomy
NCT00242554	PHASE4	COMPLETED	Open-label Phase IV Clinical Trial to Evaluate the Safety and Tolerability of Zoledronic Acid in Patients With Prostate Cancer and Bone Metastases
NCT00280098	PHASE4	COMPLETED	Docetaxel in the Treatment of Hormone Refractory Prostate Cancer
NCT00293696	PHASE4	COMPLETED	Casodex/Zoladex Biomarkers in Localised Prostate Cancer
NCT00334139	PHASE4	COMPLETED	Effect of Zoledronic Acid on Bone Metabolism in Patients With Bone Metastasis and Prostate or Breast Cancer
NCT00375765	PHASE4	COMPLETED	Effects On Dihydrotestosterone Regulated Gene Expression In Benign Prostatic Hyperplasia Or Prostate Cancer
NCT00391690	PHASE4	COMPLETED	Evaluation of Bone Markers as Diagnostic Tools for Early Detection of Bone Metastases in Patients With High Risk Prostate Cancer
NCT00422708	PHASE4	COMPLETED	Local Anesthesia for Prostate Biopsy
NCT00526331	PHASE4	COMPLETED	Evaluation of Arterial Pressure Based Cardiac Output for Goal-Directed Perioperative Therapy
NCT00590213	PHASE4	COMPLETED	Compare the Value of Prophylactic Versus Therapeutic Breast Radiotherapy in CASODEX
NCT00629330	PHASE4	TERMINATED	Dissemination of Prostate Cancer Screening to PCP’s in African American Communities
NCT00771966	PHASE4	COMPLETED	Radical Prostatectomy and Perioperative Fluid Therapy
NCT00805701	PHASE4	COMPLETED	Study Assessing The Efficacy And Safety Of Avodart (Dutasteride) At Improving Urinary Symptoms In Men With Prostate Cancer Who Are Undergoing Seed Implantation
NCT00859027	PHASE4	COMPLETED	Effect Of Risedronate On Bone Mass In Older Men Receiving Neoadjuvant Therapy For Prostate Cancer
NCT00906269	PHASE4	UNKNOWN	Can Hyperbaric Oxygen Improve Erectile Function Following Surgery for Prostate Cancer
NCT00953277	PHASE4	COMPLETED	Study of Nerve Reconstruction Using AVANCE in Subjects Who Undergo Robotic Assisted Prostatectomy for Treatment of Prostate Cancer
NCT00982800	PHASE4	COMPLETED	Does Postoperative Gabapentin Reduce Pain, Opioid Consumption and Anxiety and Have a Positive Effect on Health Related Quality of Life After Radical Prostatectomy?
NCT01083199	PHASE4	COMPLETED	Global Performance Evaluation of the AMS CONTINUUM™ Device
NCT01136226	PHASE4	COMPLETED	Evaluate Recovery of Testosterone for Patients Using Eligard
NCT01161563	PHASE4	COMPLETED	Randomized Crossover Trial to Assess the Tolerability of Gonadotropin Releasing Hormone (GnRH) Analogue Administration
NCT01230905	PHASE4	COMPLETED	Study to Monitor the Effects of Androgen Suppression Treatment on the Heart
NCT01296672	PHASE4	COMPLETED	3 Month Finasteride Challenge Test Can Significantly Improve the Performance of Screening for Prostate Cancer
NCT01365143	PHASE4	TERMINATED	Prospective Randomized Trial Comparing Robotic Versus Open Radical Prostatectomy
NCT01379742	PHASE4	UNKNOWN	Comparison of Between ThinSeed™ and OncoSeed™ for Permanent Prostate Brachytherapy
NCT01486563	PHASE4	COMPLETED	Hydroxyethyl Starch and Renal Function After Radical Prostatectomy
NCT01511874	PHASE4	COMPLETED	Efficacy and Safety Study of ELIGARD 22.5mg With Prostate Cancer
NCT01512472	PHASE4	TERMINATED	Firmagon (Degarelix) Intermittent Therapy
NCT01547416	PHASE4	COMPLETED	The Effect of Combined General/Epidural Anesthesia Versus General Anesthesia on Diaphragmatic Function
NCT01571544	PHASE4	COMPLETED	The Use of Thermal Suits as Preventing Hypothermia During Surgery
NCT01581749	PHASE4	UNKNOWN	Evaluation of Truebeam for Low-Intermediate Risk Prostate Cancer
NCT01649635	PHASE4	COMPLETED	Study of Cabazitaxel Combined With Prednisone and Prophylaxis of Neutropenia Complications in the Treatment of Patients With Metastatic Castration-resistant Prostate Cancer