CHST14

Summary

CHST14 (carbohydrate sulfotransferase 14, HGNC:24464) is a protein-coding gene on chromosome 15q15.1, encoding Carbohydrate sulfotransferase 14 (Q8NCH0). Catalyzes the transfer of sulfate to position 4 of the N-acetylgalactosamine (GalNAc) residue of dermatan sulfate.

This gene encodes a member of the HNK-1 family of sulfotransferases. The encoded protein transfers sulfate to the C-4 hydroxyl of N-acetylgalactosamine residues in dermatan sulfate. Mutations in this gene have been associated with adducted thumb-clubfoot syndrome.

Source: NCBI Gene 113189 — RefSeq curated summary.

At a glance

• Gene–disease (curated): Ehlers-Danlos syndrome, musculocontractural type 1 (Definitive, ClinGen) — +1 more curated relationship
• GWAS associations: 4
• Clinical variants (ClinVar): 426 total — 23 pathogenic, 6 likely-pathogenic
• Phenotypes (HPO): 106
• Druggable target: yes
• MANE Select transcript: NM_130468

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:24464
Approved symbol	CHST14
Name	carbohydrate sulfotransferase 14
Location	15q15.1
Locus type	gene with protein product
Status	Approved
Aliases	HD4ST, D4ST-1
Ensembl gene	ENSG00000169105
Ensembl biotype	protein_coding
OMIM	608429
Entrez	113189

Gene structure

Transcript identifiers

Ensembl transcripts: 2 — 2 protein_coding

ENST00000306243, ENST00000559991

RefSeq mRNA: 1 — MANE Select: NM_130468 NM_130468

CCDS: CCDS10059

Canonical transcript exons

ENST00000306243 — 1 exons

Exon	Start	End
ENSE00001154859	40470984	40473158

Expression profiles

Bgee: expression breadth ubiquitous, 201 present calls, max score 90.76.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 8.9323 / max 48.3036, expressed in 1691 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
146118	8.6140	1690
207476	0.3183	127

Top tissues by expression

235 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
stromal cell of endometrium	CL:0002255	90.76	gold quality
ventricular zone	UBERON:0003053	87.92	gold quality
ileal mucosa	UBERON:0000331	86.84	gold quality
tibialis anterior	UBERON:0001385	86.31	silver quality
right ovary	UBERON:0002118	86.26	gold quality
ascending aorta	UBERON:0001496	86.22	gold quality
endocervix	UBERON:0000458	86.21	gold quality
thoracic aorta	UBERON:0001515	86.21	gold quality
placenta	UBERON:0001987	85.86	gold quality
pancreatic ductal cell	CL:0002079	85.51	silver quality
body of uterus	UBERON:0009853	85.49	gold quality
right coronary artery	UBERON:0001625	85.46	gold quality
left ovary	UBERON:0002119	85.38	gold quality
apex of heart	UBERON:0002098	84.96	gold quality
descending thoracic aorta	UBERON:0002345	84.58	gold quality
ectocervix	UBERON:0012249	84.56	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	84.52	gold quality
aorta	UBERON:0000947	84.52	gold quality
left uterine tube	UBERON:0001303	84.32	gold quality
left coronary artery	UBERON:0001626	83.95	gold quality
popliteal artery	UBERON:0002250	83.36	gold quality
tibial artery	UBERON:0007610	83.35	gold quality
coronary artery	UBERON:0001621	83.30	gold quality
decidua	UBERON:0002450	83.26	gold quality
ovary	UBERON:0000992	83.18	gold quality
smooth muscle tissue	UBERON:0001135	82.98	gold quality
right lobe of thyroid gland	UBERON:0001119	82.93	gold quality
adenohypophysis	UBERON:0002196	82.74	gold quality
left lobe of thyroid gland	UBERON:0001120	82.68	gold quality
granulocyte	CL:0000094	82.65	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-GEOD-111727	yes	199.22
E-ANND-3	yes	4.26

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

64 targeting CHST14, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4747-5P	100.00	67.90	2681
HSA-MIR-5196-5P	100.00	67.98	2761
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-548AN	99.97	70.91	2817
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-124-3P	99.89	73.74	3043
HSA-MIR-506-3P	99.89	73.55	3057
HSA-MIR-4271	99.88	68.32	2244
HSA-MIR-182-5P	99.87	74.03	2589
HSA-MIR-548AR-3P	99.85	71.26	3889
HSA-MIR-548AZ-3P	99.82	70.56	3549
HSA-MIR-548BC	99.82	70.61	3524
HSA-MIR-548E-3P	99.82	70.59	3514
HSA-MIR-548F-3P	99.82	70.59	3540
HSA-MIR-320A-3P	99.77	69.73	2107
HSA-MIR-320B	99.77	69.73	2107
HSA-MIR-320C	99.77	69.73	2107
HSA-MIR-320D	99.77	69.73	2107
HSA-MIR-4429	99.77	69.62	2111
HSA-MIR-548A-3P	99.76	70.58	3524
HSA-MIR-4729	99.69	72.18	4233
HSA-MIR-12124	99.68	69.17	2700
HSA-MIR-3202	99.66	67.70	2737
HSA-MIR-548AV-5P	99.60	70.84	2107
HSA-MIR-548K	99.60	70.84	2107
HSA-MIR-4649-3P	99.56	66.90	1783
HSA-MIR-6081	99.48	66.07	1446
HSA-MIR-8054	99.48	70.81	2084

Literature-anchored findings (GeneRIF, showing 15)

• D4ST-1 is encoded by a single exon located on human chromosome 15q14; type II membrane protein of 376 amino acids with a 43-amino acid cytoplasmic domain and a 316-amino acid luminal domain containing two potential N-linked glycosylation sites (PMID:11470797)
• human D4ST-1, C4ST-1, and S4ST-2 have differential roles in dermatan sulfate biosynthesis (PMID:12847091)
• D4ST-1 is a key enzyme and is indispensable in the formation of important functional domains in dermatan sulfate and cannot be compensated by other 4-O-sulfotransferases (PMID:19661164)
• dermatan-4-sulfotransferase 1 has a role in adducted thumb-clubfoot syndrome (PMID:20004762)
• A homozygous CHST14 (carbohydrate sulfotransferase 14) mutation in the two familial cases and compound heterozygous mutations in four sporadic cases of Ehlers-Danlos syndrome, were identified. (PMID:20533528)
• Musculocontractural Ehlers-Danlos Syndrome (former EDS type VIB) and adducted thumb clubfoot syndrome (ATCS) represent a single clinical entity caused by mutations in the dermatan-4-sulfotransferase 1 encoding CHST14 gene. (PMID:20842734)
• Loss of dermatan-4-sulfotransferase 1 (D4ST1/CHST14) function represents the first dermatan sulfate biosynthesis defect, “dermatan sulfate-deficient adducted thumb-clubfoot syndrome”. (PMID:21309034)
• We report on the detailed clinical characterization of two sisters with musculocontractural Ehlers-Danlos syndrome caused by a homozygous mutation in the CHST14 gene. (PMID:22581468)
• CHST14 gene mutations are associated with musculocontractural type of Ehlers-Danlos syndrome. (PMID:26373698)
• patients with CHST14/D4ST1 deficiency develop progressive multisystem fragility-related manifestations, establishment of a comprehensive and detailed natural history and health-care guidelines as well as further elucidation of the pathophysiology in view of future etiology-based therapy are crucial (PMID:26646600)
• Dermatan sulfate does not appear in urine of patients with Ehlers-Danlos syndrome caused by a CHST14/D4ST1 deficiency. (PMID:28238810)
• DS-epi1, DS-epi2, and D4ST1 form homomers and are all part of a hetero-oligomeric complex where D4ST1 directly interacts with DS-epi1, but not with DS-epi2. The cooperation of DS-epi1 with D4ST1 may therefore explain the processive mode of the formation of iduronic acid blocks. (PMID:29976758)
• Patients with musculocontractural Ehlers-Danlos syndrome-CHST14 are susceptible to develop scoliosis, thoracolumbar kyphosis. (PMID:30195269)
• Delineation of musculocontractural Ehlers-Danlos Syndrome caused by dermatan sulfate epimerase deficiency. (PMID:32130795)
• Clinical and molecular features of 66 patients with musculocontractural Ehlers-Danlos syndrome caused by pathogenic variants in CHST14 (mcEDS-CHST14). (PMID:34815299)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	chst14	ENSDARG00000043011
mus_musculus	Chst14	ENSMUSG00000074916
rattus_norvegicus	Chst14	ENSRNOG00000045997

Paralogs (6): CHST10 (ENSG00000115526), CHST8 (ENSG00000124302), CHST12 (ENSG00000136213), CHST9 (ENSG00000154080), CHST11 (ENSG00000171310), CHST13 (ENSG00000180767)

Protein

Protein identifiers

Carbohydrate sulfotransferase 14 — Q8NCH0 (reviewed: Q8NCH0)

Alternative names: Dermatan 4-sulfotransferase 1

All UniProt accessions (2): Q8NCH0, H0YN65

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the transfer of sulfate to position 4 of the N-acetylgalactosamine (GalNAc) residue of dermatan sulfate. Plays a pivotal role in the formation of 4-0-sulfated IdoA blocks in dermatan sulfate. Transfers sulfate to the C-4 hydroxyl of beta1,4-linked GalNAc that is substituted with an alpha-linked iduronic acid (IdoUA) at the C-3 hydroxyl. Transfers sulfate more efficiently to GalNAc residues in -IdoUA-GalNAc-IdoUA- than in -GlcUA-GalNAc-GlcUA-sequences. Has preference for partially desulfated dermatan sulfate. Addition of sulfate to GalNAc may occur immediately after epimerization of GlcUA to IdoUA. Appears to have an important role in the formation of the cerebellar neural network during postnatal brain development.

Subcellular location. Golgi apparatus membrane.

Tissue specificity. Widely expressed. Expressed at high level in pituitary gland, placenta, uterus and thyroid.

Disease relevance. Ehlers-Danlos syndrome, musculocontractural type 1 (EDSMC1) [MIM:601776] A form of Ehlers-Danlos syndrome characterized by distinctive craniofacial dysmorphism, congenital contractures of thumbs and fingers, clubfeet, severe kyphoscoliosis, muscular hypotonia, hyperextensible thin skin with easy bruisability and atrophic scarring, wrinkled palms, joint hypermobility, and ocular involvement. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the sulfotransferase 2 family.

RefSeq proteins (1): NP_569735* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR005331	Sulfotransferase	Family
IPR018011	Carb_sulfotrans_8-10	Family

Pfam: PF03567

Enzyme classification (BRENDA):

• EC 2.8.2.35 — dermatan 4-sulfotransferase (BRENDA: 4 organisms, 6 substrates, 0 inhibitors, 0 Km, 0 kcat entries)

Catalyzed reactions (Rhea), 1 shown:

• dermatan + n 3’-phosphoadenylyl sulfate = dermatan 4’-sulfate + n adenosine 3’,5’-bisphosphate + n H(+) (RHEA:48052)

UniProt features (16 total): sequence variant 6, topological domain 2, sequence conflict 2, binding site 2, glycosylation site 2, chain 1, transmembrane region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8NCH0-F1	84.17	0.67

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (2): 155–161; 213–221

Glycosylation sites (2): 110, 368

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-2022923	DS-GAG biosynthesis
R-HSA-3595174	Defective CHST14 causes EDS, musculocontractural type

MSigDB gene sets: 321 (showing top): GOBP_CARBOHYDRATE_DERIVATIVE_METABOLIC_PROCESS, MODULE_205, WCTCNATGGY_UNKNOWN, GOBP_CARBOHYDRATE_DERIVATIVE_BIOSYNTHETIC_PROCESS, GOBP_CARBOHYDRATE_METABOLIC_PROCESS, DODD_NASOPHARYNGEAL_CARCINOMA_UP, IVANOVA_HEMATOPOIESIS_INTERMEDIATE_PROGENITOR, GOBP_PROTEIN_O_LINKED_GLYCOSYLATION, GOBP_GLYCOPROTEIN_METABOLIC_PROCESS, REACTOME_METABOLISM_OF_CARBOHYDRATES_AND_CARBOHYDRATE_DERIVATIVES, CP2_01, GOMF_PHOSPHATE_ION_BINDING, MATSUDA_NATURAL_KILLER_DIFFERENTIATION, KEGG_GLYCOSAMINOGLYCAN_BIOSYNTHESIS_CHONDROITIN_SULFATE, CHEN_METABOLIC_SYNDROM_NETWORK

GO Biological Process (3): carbohydrate biosynthetic process (GO:0016051), dermatan sulfate proteoglycan biosynthetic process (GO:0050651), dermatan sulfate proteoglycan metabolic process (GO:0050655)

GO Molecular Function (5): dermatan 4-sulfotransferase activity (GO:0001537), sulfotransferase activity (GO:0008146), phosphate ion binding (GO:0042301), protein binding (GO:0005515), transferase activity (GO:0016740)

GO Cellular Component (4): Golgi membrane (GO:0000139), membrane (GO:0016020), extracellular exosome (GO:0070062), Golgi apparatus (GO:0005794)

Reactome top-level categories

Rollup of top-2 pathways:

Category	Pathways
Chondroitin sulfate/dermatan sulfate metabolism	1
Diseases associated with glycosaminoglycan metabolism	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
carbohydrate metabolic process	1
biosynthetic process	1
proteoglycan biosynthetic process	1
dermatan sulfate proteoglycan metabolic process	1
protein O-linked glycosylation via xylose	1
proteoglycan metabolic process	1
dermatan sulfotransferase activity	1
transferase activity, transferring sulphur-containing groups	1
anion binding	1
binding	1
catalytic activity	1
Golgi apparatus	1
bounding membrane of organelle	1
cellular anatomical structure	1
extracellular vesicle	1
cytoplasm	1
endomembrane system	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

702 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CHST14	ZNF469	Q96JG9	979
CHST14	PLOD1	Q02809	823
CHST14	CHST15	Q7LFX5	737
CHST14	DSE	Q9UL01	731
CHST14	B4GALT7	Q9UBV7	716
CHST14	PLOD3	O60568	713
CHST14	CHST7	Q9NS84	698
CHST14	B3GALT6	Q96L58	691
CHST14	CHST3	Q7LGC8	668
CHST14	FKBP14	Q9NWM8	663
CHST14	PLOD2	O00469	647
CHST14	CSGALNACT2	Q8N6G5	630
CHST14	SULT1C3	Q6IMI6	605
CHST14	CSGALNACT1	Q8TDX6	600
CHST14	SLC39A13	Q96H72	594

IntAct

62 interactions, top by confidence:

A	B	Type	Score
CHST14	CANX	psi-mi:“MI:0914”(association)	0.640
CRIPTO	AIP	psi-mi:“MI:0914”(association)	0.640
CRP	QSOX1	psi-mi:“MI:0914”(association)	0.530
PON2	NPC1	psi-mi:“MI:0914”(association)	0.530
C1orf54	EXTL3	psi-mi:“MI:0914”(association)	0.530
CHST14	CFTR	psi-mi:“MI:0915”(physical association)	0.370
CFTR	CHST14	psi-mi:“MI:0915”(physical association)	0.370
PTCH1	PLXNB2	psi-mi:“MI:0914”(association)	0.350
	TMEM223	psi-mi:“MI:0914”(association)	0.350
POMK	ESYT2	psi-mi:“MI:0914”(association)	0.350
CANX	HLA-A	psi-mi:“MI:0914”(association)	0.350
TMEM106A	QSOX1	psi-mi:“MI:0914”(association)	0.350
LDLRAD1	GXYLT2	psi-mi:“MI:0914”(association)	0.350
CLEC12B	GXYLT2	psi-mi:“MI:0914”(association)	0.350
NRSN1	FAM171A2	psi-mi:“MI:0914”(association)	0.350
TMEM106A	TMEM131L	psi-mi:“MI:0914”(association)	0.350
HLA-C	TMEM131L	psi-mi:“MI:0914”(association)	0.350
HLA-G	TMEM131L	psi-mi:“MI:0914”(association)	0.350
BTNL2	TMEM131L	psi-mi:“MI:0914”(association)	0.350
KLRD1	TMEM131L	psi-mi:“MI:0914”(association)	0.350
BRICD5	TMEM131L	psi-mi:“MI:0914”(association)	0.350
HLA-DQA1	TMEM131L	psi-mi:“MI:0914”(association)	0.350
LY86	TMEM131L	psi-mi:“MI:0914”(association)	0.350
PTCH1	TMEM131L	psi-mi:“MI:0914”(association)	0.350
NCR3	POTEF	psi-mi:“MI:0914”(association)	0.350

BioGRID (73): CHST14 (Affinity Capture-MS), POTEE (Affinity Capture-MS), GOLGA5 (Affinity Capture-MS), FUT11 (Affinity Capture-MS), CHST14 (Affinity Capture-MS), CANX (Affinity Capture-MS), CHST14 (Affinity Capture-MS), CHST14 (Affinity Capture-MS), CHST14 (Affinity Capture-MS), CHST14 (Proximity Label-MS), CHST14 (Proximity Label-MS), CHST14 (Proximity Label-MS), CHST14 (Proximity Label-MS), CHST14 (Affinity Capture-MS), CHST14 (Affinity Capture-MS)

ESM2 similar proteins: A2A699, A2XVC2, A8MVW0, B0F2B4, D3ZE55, O09017, O14492, O62763, O95206, P10588, P21836, P22303, P23795, P36196, P37136, P43029, P43136, P50427, Q14003, Q29RK8, Q2QXZ2, Q2RAQ5, Q3U0S6, Q495W5, Q4ACU6, Q5T442, Q5U651, Q5ZMM1, Q62888, Q62889, Q63959, Q69ZK9, Q6UXK2, Q76KP1, Q7FA29, Q7Z4P5, Q80WV3, Q80XF7, Q869C3, Q8BQU6

Diamond homologs: O43529, O54702, P69478, Q5RBZ6, Q5XHM7, Q5ZIE4, Q6AXM1, Q6GNS1, Q6PGK7, Q76EC5, Q7L1S5, Q7T3S3, Q805E5, Q80V53, Q8BQ86, Q8NCH0, Q8NET6, Q99LL3, Q9H2A9, Q9JME2, Q9NPF2, Q9NRB3

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 73 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Immunoregulatory interactions between a Lymphoid and a non-Lymphoid cell	6	10.1×	2e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

426 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	23
Likely pathogenic	6
Uncertain significance	207
Likely benign	163
Benign	4

Top pathogenic / likely-pathogenic (29)

Variant ID	HGVS	Classification
1163962	NM_130468.4(CHST14):c.798C>A (p.Tyr266Ter)	Pathogenic
1705283	NM_130468.4(CHST14):c.711T>A (p.Tyr237Ter)	Pathogenic
18421	NM_130468.4(CHST14):c.981_1000dup (p.Glu334fs)	Pathogenic
193484	NM_130468.4(CHST14):c.567del (p.Phe190fs)	Pathogenic
1937598	NM_130468.4(CHST14):c.486G>A (p.Trp162Ter)	Pathogenic
1949857	NM_130468.4(CHST14):c.264del (p.Lys89fs)	Pathogenic
1971283	NM_130468.4(CHST14):c.676_682delinsGCTATGGGGCT (p.Lys226fs)	Pathogenic
2340	NM_130468.4(CHST14):c.842C>T (p.Pro281Leu)	Pathogenic
2341	NM_130468.4(CHST14):c.205A>T (p.Lys69Ter)	Pathogenic
2342	NM_130468.4(CHST14):c.866G>C (p.Cys289Ser)	Pathogenic
2506367	NM_130468.4(CHST14):c.922C>T (p.Gln308Ter)	Pathogenic
2758622	NM_130468.4(CHST14):c.783del (p.Glu262fs)	Pathogenic
2836581	NM_130468.4(CHST14):c.315del (p.Gln106fs)	Pathogenic
3631461	NM_130468.4(CHST14):c.88del (p.Ala30fs)	Pathogenic
3672102	NM_130468.4(CHST14):c.201_202del (p.Glu67fs)	Pathogenic
3727226	NM_130468.4(CHST14):c.494del (p.Val165fs)	Pathogenic
3896437	NM_130468.4(CHST14):c.181G>T (p.Glu61Ter)	Pathogenic
446173	NM_130468.4(CHST14):c.453dup (p.Cys152fs)	Pathogenic
4777340	NM_130468.4(CHST14):c.597dup (p.Arg200fs)	Pathogenic
4797381	NM_130468.4(CHST14):c.730del (p.Arg244fs)	Pathogenic
50992	NM_130468.4(CHST14):c.821G>C (p.Arg274Pro)	Pathogenic
575403	NM_130468.4(CHST14):c.160dup (p.Ser54fs)	Pathogenic
816708	NM_130468.4(CHST14):c.797dup (p.Tyr266Ter)	Pathogenic
2337	NM_130468.4(CHST14):c.638G>C (p.Arg213Pro)	Likely pathogenic
3900616	NM_130468.4(CHST14):c.870_871delinsT (p.Val291fs)	Likely pathogenic
4292286	NM_130468.4(CHST14):c.626T>C (p.Phe209Ser)	Likely pathogenic
4293813	NM_130468.4(CHST14):c.85_95dup (p.Leu34fs)	Likely pathogenic
432924	NM_130468.4(CHST14):c.958C>T (p.Arg320Ter)	Likely pathogenic
807210	NM_130468.4(CHST14):c.275del (p.Gly92fs)	Likely pathogenic

SpliceAI

29 predictions. Top by Δscore:

Variant	Effect	Δscore
15:40471672:C:G	acceptor_gain	0.6300
15:40471679:A:AC	acceptor_gain	0.5400
15:40471667:T:A	acceptor_gain	0.5100
15:40472271:C:G	donor_gain	0.4700
15:40471678:CA:C	acceptor_gain	0.4400
15:40472269:GCC:G	donor_gain	0.4300
15:40472271:C:CG	donor_gain	0.4300
15:40471664:TACTG:T	acceptor_gain	0.4200
15:40471057:G:GT	donor_gain	0.4000
15:40472139:TGCTG:T	donor_gain	0.4000
15:40472140:GCTGG:G	donor_gain	0.4000
15:40471085:G:T	donor_gain	0.3800
15:40471679:AAGGT:A	acceptor_gain	0.3300
15:40472327:G:GT	donor_gain	0.3200
15:40471670:TACG:T	acceptor_gain	0.3000
15:40471667:TG:T	acceptor_gain	0.2900
15:40471665:ACT:A	acceptor_gain	0.2700
15:40471666:C:G	acceptor_gain	0.2700
15:40472274:A:AG	donor_gain	0.2700
15:40472275:G:GG	donor_gain	0.2700
15:40472261:G:GT	donor_gain	0.2500
15:40472141:CTGGA:C	donor_gain	0.2400
15:40471665:ACTGC:A	acceptor_gain	0.2300
15:40471672:C:CA	acceptor_gain	0.2300
15:40471660:C:CT	acceptor_gain	0.2200
15:40471084:G:GT	donor_gain	0.2100
15:40471669:CTACG:C	acceptor_gain	0.2000
15:40472145:A:AG	donor_gain	0.2000
15:40472146:G:GG	donor_gain	0.2000

AlphaMissense

2406 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
15:40471668:G:A	C152Y	1.000
15:40471669:C:G	C152W	1.000
15:40471681:G:C	K156N	1.000
15:40471681:G:T	K156N	1.000
15:40471702:G:C	K163N	1.000
15:40471702:G:T	K163N	1.000
15:40471889:A:G	K226E	1.000
15:40471890:A:T	K226M	1.000
15:40471891:G:C	K226N	1.000
15:40471891:G:T	K226N	1.000
15:40472000:T:C	F263L	1.000
15:40472001:T:C	F263S	1.000
15:40472001:T:G	F263C	1.000
15:40472002:C:A	F263L	1.000
15:40472002:C:G	F263L	1.000
15:40472048:T:A	W279R	1.000
15:40472048:T:C	W279R	1.000
15:40472050:G:C	W279C	1.000
15:40472050:G:T	W279C	1.000
15:40471667:T:C	C152R	0.999
15:40471668:G:T	C152F	0.999
15:40471689:G:A	C159Y	0.999
15:40471692:C:T	S160F	0.999
15:40471697:T:A	W162R	0.999
15:40471697:T:C	W162R	0.999
15:40471699:G:C	W162C	0.999
15:40471699:G:T	W162C	0.999
15:40471880:T:G	Y223D	0.999
15:40471887:A:T	N225I	0.999
15:40471888:C:A	N225K	0.999

dbSNP variants (sampled 300 via entrez): RS1000109255 (15:40473529 T>C), RS1001909989 (15:40473276 G>A), RS1002158278 (15:40469128 A>G,T), RS1002697813 (15:40470057 T>C), RS1002725606 (15:40469726 C>T), RS1002934159 (15:40470750 A>C), RS1003545738 (15:40472756 T>A,C), RS1003919871 (15:40470287 T>C), RS1003947736 (15:40470106 T>G), RS1004173028 (15:40472487 C>T), RS1005432466 (15:40470804 GGAGCTTTTGTCCCCAAGCCCA>G), RS1006618449 (15:40470133 A>C), RS1007569346 (15:40471649 C>G), RS1010368353 (15:40469387 G>C), RS1010620378 (15:40470881 G>A,C)

Disease associations

OMIM: gene MIM:608429 | disease phenotypes: MIM:601776, MIM:130000

GenCC curated gene-disease

Disease	Classification	Inheritance
Ehlers-Danlos syndrome, musculocontractural type 1	Definitive	Autosomal recessive
Ehlers-Danlos syndrome, musculocontractural type	Supportive	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
Ehlers-Danlos syndrome, musculocontractural type 1	Definitive	AR

Mondo (3): Ehlers-Danlos syndrome, musculocontractural type (MONDO:0011142), Ehlers-Danlos syndrome, musculocontractural type 1 (MONDO:0020681), Ehlers-Danlos syndrome (MONDO:0020066)

Orphanet (2): Musculocontractural Ehlers-Danlos syndrome (Orphanet:2953), Ehlers-Danlos syndrome (Orphanet:98249)

HPO phenotypes

106 total (30 of 106 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000009	Functional abnormality of the bladder
HP:0000023	Inguinal hernia
HP:0000028	Cryptorchidism
HP:0000085	Horseshoe kidney
HP:0000100	Nephrotic syndrome
HP:0000126	Hydronephrosis
HP:0000153	Abnormality of the mouth
HP:0000160	Narrow mouth
HP:0000175	Cleft palate
HP:0000218	High palate
HP:0000219	Thin upper lip vermilion
HP:0000239	Large fontanelles
HP:0000248	Brachycephaly
HP:0000270	Delayed cranial suture closure
HP:0000308	Microretrognathia
HP:0000316	Hypertelorism
HP:0000324	Facial asymmetry
HP:0000337	Broad forehead
HP:0000343	Long philtrum
HP:0000358	Posteriorly rotated ears
HP:0000365	Hearing impairment
HP:0000369	Low-set ears
HP:0000377	Abnormal pinna morphology
HP:0000400	Macrotia
HP:0000411	Protruding ear
HP:0000482	Microcornea
HP:0000483	Astigmatism
HP:0000486	Strabismus
HP:0000494	Downslanted palpebral fissures

GWAS associations

4 associations (top):

Study	Trait	p-value
GCST010002_167	Refractive error	3.000000e-11
GCST010725_23	Malaria	2.000000e-06
GCST010725_38	Malaria	3.000000e-06
GCST010725_80	Malaria	7.000000e-06

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D004535	Ehlers-Danlos Syndrome	C14.907.454.240; C15.378.463.515.240; C16.131.831.428; C16.320.850.260; C17.300.200.310; C17.800.804.428; C17.800.827.260
C000600608	Ehlers-Danlos Syndrome, musculocontractural type 1 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL4742302 (PROTEIN-PROTEIN INTERACTION)

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

38 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, increases expression	2
Benzo(a)pyrene	decreases methylation, increases expression, increases methylation	2
Cisplatin	affects cotreatment, increases expression	2
Cyclosporine	decreases expression	2
Cadmium Chloride	decreases expression	2
Particulate Matter	decreases expression, increases abundance	2
aristolochic acid I	decreases expression	1
GSK-J4	decreases expression	1
bisphenol A	affects cotreatment, increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
butyraldehyde	decreases expression	1
zinc chromate	increases abundance, decreases expression	1
ferrous chloride	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
chromium hexavalent ion	decreases expression, increases abundance	1
CGP 52608	affects binding, increases reaction	1
abrine	decreases expression	1
bisphenol S	increases methylation	1
jinfukang	affects cotreatment, increases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Sunitinib	decreases expression	1
Air Pollutants	decreases expression, increases abundance	1
Vehicle Emissions	decreases expression, increases abundance	1
Cannabidiol	decreases expression	1
Dexamethasone	increases expression, affects cotreatment	1
Doxorubicin	decreases expression	1
Indomethacin	affects cotreatment, increases expression	1
Ivermectin	decreases expression	1
Plant Extracts	decreases expression, affects cotreatment	1
Smoke	decreases expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4713773	Binding	Protac activity at CRBN/CHST14 in human BxPC-3 cells assessed as CHST14 degradation incubated for 16 hrs by proteomic analysis	Discovery of a Napabucasin PROTAC as an Effective Degrader of the E3 Ligase ZFP91. — J Med Chem

Clinical trials (associated diseases)

49 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT04890431	PHASE4	UNKNOWN	Impact of Oxygen Therapy on Fatigue in Patients With Hypermobile-type Ehlers-Danlos Syndrome
NCT05603741	PHASE4	ACTIVE_NOT_RECRUITING	Local Anesthetic Response in Ehlers-Danlos Syndrome (EDS) and Healthy Volunteers
NCT05279937	PHASE3	NOT_YET_RECRUITING	The Ultrasound-Guided Dextrose Prolotherapy in Ehlers-Danlos Syndrome Patients
NCT00001966	PHASE2	COMPLETED	Mind-Body Therapy for Pain in Ehlers-Danlos Syndrome
NCT03686748	EARLY_PHASE1	ACTIVE_NOT_RECRUITING	Two Point Discrimination
NCT00001641	Not specified	COMPLETED	Study of Heritable Connective Tissue Disorders
NCT00270686	Not specified	COMPLETED	Studies of Heritable Disorders of Connective Tissue
NCT01322165	Not specified	COMPLETED	National Registry of Genetically Triggered Thoracic Aortic Aneurysms and Cardiovascular Conditions
NCT01356134	Not specified	COMPLETED	Vascular Fundus Changes in Patients With High Probability of Chronic Cerebrospinal Venous Insufficiency (CCSVI)
NCT01367977	Not specified	COMPLETED	Head Circumference Growth in Children With Ehlers-Danlos Syndrome Who Develop Dysautonomia Later in Life
NCT02050113	Not specified	RECRUITING	Complex Aortic Aneurysm Repair Using Physician Modified Endografts and Custom Made Devices
NCT02435745	Not specified	COMPLETED	Obstructive Sleep Apnoea in Ehlers-Danlos Syndrome
NCT02721797	Not specified	UNKNOWN	Origins and Impact of EDS in Connective Tissues and Skin
NCT02985710	Not specified	COMPLETED	Assessment of Small Fiber Neuropathy in Rare Diseases Using Sudoscan
NCT03093493	Not specified	COMPLETED	Genetics of Ehlers-Danlos Syndrome
NCT03330977	Not specified	UNKNOWN	Efficiency Clinical Study of NOVATEX MEDICAL Compression Garments in Patients With Ehlers-Danlos Syndrome
NCT03575182	Not specified	UNKNOWN	Gait Retraining in Patients With Joint Hypermobility Syndrome/Hypermobile Ehlers Danlos Syndrome
NCT03596437	Not specified	UNKNOWN	Study of Arterial Properties by Ultra-high Frequency Ultrasound in Fibromuscular Dysplasia and Vascular Ehlers-Danlos Syndrome
NCT03602482	Not specified	COMPLETED	Standing Cognition and Co-morbidities of POTS Evaluation
NCT03681080	Not specified	COMPLETED	Concentration and Attentional Deficits in POTS and Other Autonomic Neuropathies
NCT03986229	Not specified	COMPLETED	Evaluation of the Effect of Custom Compression Garments on Standing Static Balance in Ehlers Danlos Syndrome
NCT04036305	Not specified	ACTIVE_NOT_RECRUITING	Local Anesthetic Response in Ehlers-Danlos Syndrome (EDS) and Healthy Volunteers
NCT04133272	Not specified	RECRUITING	Registry of Ehlers-Danlos Syndrome
NCT04437589	Not specified	COMPLETED	Opioid-Free Anesthesia for Patients With Joint Hypermobility Syndrome Undergoing Craneo-Cervical Fixation: A Case-series
NCT04680793	Not specified	COMPLETED	Effects of a Multidisciplinary Outpatient Rehabilitation Program in Patients With Ehlers-Danlos Syndrome.
NCT04734041	Not specified	COMPLETED	Integrative Medicine for Hypermobility Spectrum Disorder and Ehlers-Danlos Syndromes (IMforHSDandEDS)
NCT04742803	Not specified	COMPLETED	Straberi Epistamp Needling Treatment For Skin Rejuvenation
NCT04806620	Not specified	RECRUITING	Unhide® Project: A Digital Health Platform to Collect Lifestyle Data for Brain Inflammation Research
NCT05137379	Not specified	COMPLETED	Evaluation of a Cohort of Patients With Ehlers-Danlos Syndrome Treated With Orthopedic Surgery (SED-eval)
NCT05366114	Not specified	UNKNOWN	Vision-based Assessment of Joint Extensibility in Ehlers Danlos Syndrome
NCT05389865	Not specified	ACTIVE_NOT_RECRUITING	Proximal Aortopathy in Scotland - Epidemiology and Surgical Outcomes
NCT05429996	Not specified	UNKNOWN	Ultrastructural Collagen Markers in Ehlers Danlos Syndromes
NCT05434728	Not specified	UNKNOWN	Characterization of Bleeding Disorders in EDS
NCT05516043	Not specified	COMPLETED	Safety and Performance of POLYTHESE® Vascular Prosthesis
NCT05561270	Not specified	RECRUITING	Light Exposure on Pain in Hypermobile Ehlers-Danlos Syndrome
NCT05720923	Not specified	ACTIVE_NOT_RECRUITING	Analysis of Muscular Properties in Patients With MFS and EDS
NCT05871216	Not specified	RECRUITING	Functional Instability in Patients Suffering From Collagen Disease and Joint Hypermobility
NCT05945784	Not specified	COMPLETED	Exploring Accessible Beauty for Individuals With Upper Extremity Deficits
NCT06074276	Not specified	RECRUITING	The Effects of Almond on Facial Skin Collagen and Wrinkles
NCT06105541	Not specified	COMPLETED	Hypermobile Ehlers-Danlos Syndrome - Transcutaneous Auricular Neuromodulation