CLNS1A

Summary

CLNS1A (chloride nucleotide-sensitive channel 1A, HGNC:2080) is a protein-coding gene on chromosome 11q14.1, encoding Methylosome subunit pICln (P54105). Involved in both the assembly of spliceosomal snRNPs and the methylation of Sm proteins. It is a common-essential gene (DepMap: required in 98.5% of cancer cell lines).

This gene encodes a protein that functions in multiple regulatory pathways. The encoded protein complexes with numerous cytosolic proteins and performs diverse functions including regulation of small nuclear ribonucleoprotein biosynthesis, platelet activation and cytoskeletal organization. The protein is also found associated with the plasma membrane where it functions as a chloride current regulator. Pseudogenes of this gene are found on chromosomes 1, 4 and 6. Several transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 1207 — RefSeq curated summary.

At a glance

• GWAS associations: 3
• Clinical variants (ClinVar): 38 total
• Druggable target: yes
• Cancer dependency (DepMap): dependent in 98.5% of screened cell lines (common-essential)
• MANE Select transcript: NM_001293

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2080
Approved symbol	CLNS1A
Name	chloride nucleotide-sensitive channel 1A
Location	11q14.1
Locus type	gene with protein product
Status	Approved
Aliases	ICln
Ensembl gene	ENSG00000074201
Ensembl biotype	protein_coding
OMIM	602158
Entrez	1207

Gene structure

Transcript identifiers

Ensembl transcripts: 31 — 24 protein_coding, 3 retained_intron, 3 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

ENST00000263309, ENST00000525064, ENST00000525359, ENST00000525428, ENST00000526009, ENST00000526761, ENST00000527133, ENST00000527265, ENST00000527299, ENST00000528364, ENST00000532069, ENST00000533957, ENST00000878768, ENST00000878769, ENST00000878770, ENST00000878771, ENST00000878772, ENST00000878773, ENST00000878774, ENST00000878775, ENST00000925522, ENST00000925523, ENST00000925524, ENST00000925525, ENST00000925526, ENST00000925527, ENST00000925528, ENST00000925529, ENST00000925530, ENST00000925531, ENST00000956553

RefSeq mRNA: 5 — MANE Select: NM_001293 NM_001293, NM_001311199, NM_001311200, NM_001311201, NM_001311202

CCDS: CCDS81600, CCDS81601, CCDS81602, CCDS8252

Canonical transcript exons

ENST00000525428 — 7 exons

Exon	Start	End
ENSE00001040439	77629763	77629899
ENSE00002146634	77637590	77637794
ENSE00002195859	77614530	77616695
ENSE00003488474	77624963	77625070
ENSE00003533923	77625717	77625818
ENSE00003540064	77622500	77622673
ENSE00003700999	77619606	77619695

Expression profiles

Bgee: expression breadth ubiquitous, 303 present calls, max score 99.24.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 87.5904 / max 632.5256, expressed in 1826 samples.

FANTOM5 promoters (4 alternative TSS)

Promoter ID	TPM avg	Samples expressed
121440	67.5610	1824
121439	18.9207	1799
121437	0.6499	370
121438	0.4588	157

Top tissues by expression

303 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ventricular zone	UBERON:0003053	99.24	gold quality
calcaneal tendon	UBERON:0003701	99.13	gold quality
ganglionic eminence	UBERON:0004023	98.89	gold quality
adrenal tissue	UBERON:0018303	98.37	gold quality
body of pancreas	UBERON:0001150	98.04	gold quality
right adrenal gland	UBERON:0001233	97.95	gold quality
right adrenal gland cortex	UBERON:0035827	97.95	gold quality
left ovary	UBERON:0002119	97.83	gold quality
embryo	UBERON:0000922	97.82	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	97.69	gold quality
left adrenal gland	UBERON:0001234	97.65	gold quality
ovary	UBERON:0000992	97.64	gold quality
monocyte	CL:0000576	97.60	gold quality
left adrenal gland cortex	UBERON:0035825	97.60	gold quality
adrenal gland	UBERON:0002369	97.56	gold quality
rectum	UBERON:0001052	97.54	gold quality
right ovary	UBERON:0002118	97.52	gold quality
mononuclear cell	CL:0000842	97.46	gold quality
adrenal cortex	UBERON:0001235	97.44	gold quality
leukocyte	CL:0000738	97.41	gold quality
spinal cord	UBERON:0002240	97.34	gold quality
cortical plate	UBERON:0005343	97.29	gold quality
colonic epithelium	UBERON:0000397	97.21	gold quality
tendon	UBERON:0000043	97.17	gold quality
corpus callosum	UBERON:0002336	97.03	gold quality
choroid plexus epithelium	UBERON:0003911	97.03	gold quality
lymph node	UBERON:0000029	96.99	gold quality
tonsil	UBERON:0002372	96.99	gold quality
esophagus mucosa	UBERON:0002469	96.95	gold quality
stromal cell of endometrium	CL:0002255	96.92	gold quality

Single-cell (SCXA)

Detected in 5 experiment(s), a significant marker in 5.

Experiment	Marker?	Max mean expression
E-HCAD-4	yes	67.09
E-HCAD-5	yes	38.02
E-MTAB-10042	yes	14.25
E-CURD-112	yes	5.32
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): MYC

miRNA regulators (miRDB)

37 targeting CLNS1A, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-3148	99.97	75.06	6478
HSA-MIR-6755-5P	99.95	65.59	464
HSA-MIR-4760-3P	99.93	70.50	2385
HSA-MIR-6124	99.87	69.78	3551
HSA-MIR-3133	99.81	70.92	3506
HSA-MIR-548M	99.70	68.87	1749
HSA-MIR-2053	99.57	69.15	1635
HSA-MIR-549A-3P	99.54	68.17	825
HSA-MIR-6081	99.48	66.07	1446
HSA-MIR-1224-5P	99.48	65.59	803
HSA-MIR-302A-5P	99.39	68.21	1913
HSA-MIR-3692-5P	99.29	67.04	1421
HSA-MIR-133A-5P	99.28	69.13	941
HSA-MIR-10399-5P	99.17	69.87	2610
HSA-MIR-6504-3P	99.17	69.31	2891
HSA-MIR-6071	99.16	67.77	1780
HSA-MIR-922	99.02	67.23	1838
HSA-MIR-12135	98.99	70.26	1814
HSA-MIR-138-5P	98.43	70.49	1292
HSA-MIR-93-3P	98.15	66.65	1309
HSA-MIR-7850-5P	98.12	67.28	1111
HSA-MIR-197-3P	98.09	69.23	1004
HSA-MIR-4468	98.01	66.85	1187
HSA-MIR-5585-5P	97.95	68.80	1024
HSA-MIR-12127	97.93	66.67	793
HSA-MIR-1914-5P	97.83	66.21	807
HSA-MIR-3652	97.71	65.43	1890
HSA-MIR-4797-3P	97.48	67.14	989

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 98.5% of screened cell lines, common-essential.

Literature-anchored findings (GeneRIF, showing 9)

• revealed an increase of ICln in the mesothelioma cell membrane under hypotonic conditions, an event possibly related to the activation of Cl(-) channels (PMID:14960305)
• ICln interacts with integrin alphaIIbbeta3 and regulates platelet activation. (PMID:15075326)
• Data show that ICln159, a truncated ICln mutant, belongs to the pleckstrin homology (PH) domain family of proteins and interacts with LSm4, a protein involved in splicing and mRNA degradation. (PMID:15905169)
• Lsm10 and Lsm11, which replace the Sm proteins D1 and D2 in the histone RNA processing U7 snRNPs, associate with pICln in vitro and in vivo without receiving sDMA modifications and with PRMT5 and SMN complexes (PMID:16087681)
• RioK1, a new interactor of protein arginine methyltransferase 5 (PRMT5), competes with pICln for binding and modulates PRMT5 complex composition and substrate specificity. (PMID:21081503)
• functional interaction between ICln and HSPC038 (PMID:21917931)
• the S. pombe ICln protein is required for optimal production of the spliceosomal snRNPs and for efficient splicing in vivo (PMID:24298023)
• Protein Arginine Methyltransferase 5 Promotes pICln-Dependent Androgen Receptor Transcription in Castration-Resistant Prostate Cancer. (PMID:32999000)
• O-GlcNAcylated LARP1 positively regulated by circCLNS1A facilitates hepatoblastoma progression through DKK4/beta-catenin signalling. (PMID:37070251)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	clns1a	ENSDARG00000103027
mus_musculus	Clns1a	ENSMUSG00000025439
rattus_norvegicus	Clns1a	ENSRNOG00000012788
drosophila_melanogaster	icln	FBGN0029079
caenorhabditis_elegans		WBGENE00002046

Protein

Protein identifiers

Methylosome subunit pICln — P54105 (reviewed: P54105)

Alternative names: Chloride channel, nucleotide sensitive 1A, Chloride conductance regulatory protein ICln, Chloride ion current inducer protein, Reticulocyte pICln

All UniProt accessions (7): P54105, E9PJF4, E9PMI6, E9PQ83, H0YEN9, J3KN38, U3KPU0

UniProt curated annotations — full annotation on UniProt →

Function. Involved in both the assembly of spliceosomal snRNPs and the methylation of Sm proteins. Chaperone that regulates the assembly of spliceosomal U1, U2, U4 and U5 small nuclear ribonucleoproteins (snRNPs), the building blocks of the spliceosome, and thereby plays an important role in the splicing of cellular pre-mRNAs. Most spliceosomal snRNPs contain a common set of Sm proteins SNRPB, SNRPD1, SNRPD2, SNRPD3, SNRPE, SNRPF and SNRPG that assemble in a heptameric protein ring on the Sm site of the small nuclear RNA to form the core snRNP (Sm core). In the cytosol, the Sm proteins SNRPD1, SNRPD2, SNRPE, SNRPF and SNRPG are trapped in an inactive 6S pICln-Sm complex by the chaperone CLNS1A that controls the assembly of the core snRNP. Dissociation by the SMN complex of CLNS1A from the trapped Sm proteins and their transfer to an SMN-Sm complex triggers the assembly of core snRNPs and their transport to the nucleus.

Subunit / interactions. Component of the methylosome, a 20S complex containing at least PRMT5/SKB1, WDR77/MEP50 and CLNS1A/pICln. May mediate SNRPD1 and SNRPD3 methylation. Forms a 6S pICln-Sm complex composed of CLNS1A/pICln, SNRPD1, SNRPD2, SNRPE, SNRPF and SNRPG; ring-like structure where CLNS1A/pICln mimics additional Sm proteins and which is unable to assemble into the core snRNP. Interacts with LSM10 and LSM11.

Subcellular location. Cytoplasm. Cytosol. Nucleus. Cytoskeleton.

Similarity. Belongs to the pICln (TC 1.A.47) family.

RefSeq proteins (5): NP_001284, NP_001298128, NP_001298129, NP_001298130, NP_001298131 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003521	ICln	Family
IPR011993	PH-like_dom_sf	Homologous_superfamily
IPR039924	ICln/Lot5/Saf5	Family

Pfam: PF03517

UniProt features (15 total): modified residue 8, sequence variant 2, initiator methionine 1, chain 1, turn 1, region of interest 1, compositionally biased region 1

Structure

Experimental structures (PDB)

3 structures.

PDB	Method	Resolution (Å)
6V0O	X-RAY DIFFRACTION	2.86
9E3B	ELECTRON MICROSCOPY	3.06
9E3A	ELECTRON MICROSCOPY	3.36

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P54105-F1	75.27	0.41

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (8): 210, 223, 2, 102, 144, 193, 195, 198

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-191859	snRNP Assembly

MSigDB gene sets: 233 (showing top): GOBP_POSITIVE_REGULATION_OF_RNA_SPLICING, GOBP_POSITIVE_REGULATION_OF_MRNA_PROCESSING, TTTGTAG_MIR520D, STARK_PREFRONTAL_CORTEX_22Q11_DELETION_DN, CHIANG_LIVER_CANCER_SUBCLASS_UNANNOTATED_DN, GOBP_INORGANIC_ANION_TRANSPORT, MORF_HDAC2, CACCAGC_MIR138, MARTINEZ_RB1_TARGETS_UP, GOBP_REGULATION_OF_ANATOMICAL_STRUCTURE_SIZE, GOBP_CHLORIDE_TRANSPORT, MARTINEZ_RB1_TARGETS_DN, GOBP_REGULATION_OF_CELL_SIZE, GOBP_PROTEIN_RNA_COMPLEX_ORGANIZATION, GOBP_RNA_SPLICING

GO Biological Process (7): spliceosomal snRNP assembly (GO:0000387), chloride transport (GO:0006821), cell volume homeostasis (GO:0006884), mRNA cis splicing, via spliceosome (GO:0045292), positive regulation of mRNA splicing, via spliceosome (GO:0048026), mRNA processing (GO:0006397), RNA splicing (GO:0008380)

GO Molecular Function (2): RNA binding (GO:0003723), protein binding (GO:0005515)

GO Cellular Component (13): nucleus (GO:0005634), nucleoplasm (GO:0005654), spliceosomal complex (GO:0005681), cytosol (GO:0005829), cytoskeleton (GO:0005856), plasma membrane (GO:0005886), cilium (GO:0005929), methylosome (GO:0034709), pICln-Sm protein complex (GO:0034715), sperm midpiece (GO:0097225), sperm principal piece (GO:0097228), sperm head-tail coupling apparatus (GO:0120212), cytoplasm (GO:0005737)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Metabolism of non-coding RNA	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	6
mRNA splicing, via spliceosome	3
cytoplasm	3
RNA processing	2
sperm flagellum	2
protein-RNA complex assembly	1
monoatomic anion transport	1
inorganic anion transport	1
regulation of cell size	1
cellular homeostasis	1
positive regulation of RNA splicing	1
regulation of mRNA splicing, via spliceosome	1
positive regulation of mRNA processing	1
mRNA metabolic process	1
nucleic acid binding	1
binding	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
nuclear protein-containing complex	1
ribonucleoprotein complex	1
intracellular membraneless organelle	1
membrane	1
cell periphery	1
intraciliary transport particle	1
membrane-bounded organelle	1
plasma membrane bounded cell projection	1
methyltransferase complex	1
Sm-like protein family complex	1
intracellular anatomical structure	1

Protein interactions and networks

STRING

2308 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CLNS1A	TDRKH	Q9Y2W6	957
CLNS1A	PRMT5	O14744	934
CLNS1A	WDR77	Q9BQA1	928
CLNS1A	RIOK1	Q9BRS2	668
CLNS1A	SNRPB	P14678	632
CLNS1A	SNRPD2	P43330	613
CLNS1A	SNRPD1	P13641	590
CLNS1A	ACTB	P02570	544
CLNS1A	LSM6	P62312	497
CLNS1A	CLCN3	P51790	490
CLNS1A	MOCS3	O95396	478
CLNS1A	CAMSAP1	Q5T5Y3	476
CLNS1A	CLCN6	P51797	462
CLNS1A	LRRC8A	Q8IWT6	453
CLNS1A	FAM120A	Q9NZB2	452

IntAct

175 interactions, top by confidence:

A	B	Type	Score
LSM3	LSM1	psi-mi:“MI:0914”(association)	0.950
CLNS1A	LSM6	psi-mi:“MI:0915”(physical association)	0.930
LSM6	CLNS1A	psi-mi:“MI:0915”(physical association)	0.930
CLNS1A	SNRPD3	psi-mi:“MI:0915”(physical association)	0.910
SNRPD3	CLNS1A	psi-mi:“MI:0915”(physical association)	0.910
SNRPF	GEMIN2	psi-mi:“MI:0914”(association)	0.910
CLNS1A	SNRPD1	psi-mi:“MI:0915”(physical association)	0.880
SNRPD2	CLNS1A	psi-mi:“MI:0915”(physical association)	0.880
CLNS1A	SNRPD2	psi-mi:“MI:0915”(physical association)	0.880
SNRPD1	CLNS1A	psi-mi:“MI:0915”(physical association)	0.880
SNRPG	CLNS1A	psi-mi:“MI:0915”(physical association)	0.840
CLNS1A	SNRPG	psi-mi:“MI:0915”(physical association)	0.840
LSM6	LSM1	psi-mi:“MI:0914”(association)	0.840
LSM3	CLNS1A	psi-mi:“MI:0915”(physical association)	0.830
LSM2	CLNS1A	psi-mi:“MI:0915”(physical association)	0.830

BioGRID (355): EPB41 (Two-hybrid), SNRPD1 (Two-hybrid), SNRPD2 (Two-hybrid), SNRPG (Two-hybrid), LSM6 (Two-hybrid), LSM3 (Two-hybrid), LSM2 (Two-hybrid), CLNS1A (Affinity Capture-MS), CLNS1A (Affinity Capture-MS), CLNS1A (Affinity Capture-MS), CLNS1A (Affinity Capture-MS), CLNS1A (Affinity Capture-MS), CLNS1A (Affinity Capture-MS), CLNS1A (Affinity Capture-MS), CLNS1A (Affinity Capture-MS)

ESM2 similar proteins: E9PSK7, O12940, O35815, O43815, O48726, O55106, O60271, P04973, P09496, P35521, P54105, P54106, P54252, P54731, P70483, Q04753, Q05B58, Q15650, Q28678, Q3ZBU9, Q58A65, Q5EAE3, Q5R4I3, Q5R719, Q5RGJ6, Q5XIJ6, Q5ZKG8, Q61189, Q640W6, Q68FJ8, Q6DG43, Q6DKA1, Q6PGH0, Q8CFK2, Q8UVK2, Q924K2, Q92575, Q92994, Q96MW1, Q9CR27

Diamond homologs: P35521, P54105, P54106, Q04753, Q28678, Q5R719, Q61189, Q9LVA7, A1ZAW5

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 105 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Metabolism of non-coding RNA	8	70.5×	1e-11
mRNA decay by 5’ to 3’ exoribonuclease	5	52.9×	8e-07
SARS-CoV-2 modulates host translation machinery	9	28.0×	2e-09
snRNP Assembly	9	26.4×	3e-09
mRNA Splicing - Minor Pathway	8	24.9×	5e-08
mRNA Splicing	13	19.8×	1e-11
RNA Polymerase II Transcription Termination	5	15.2×	4e-04
CHD1 and CHD2 subfamily	10	15.1×	5e-08

GO biological processes:

GO term	Partners	Fold	FDR
spliceosomal snRNP assembly	10	63.9×	2e-13
U2-type prespliceosome assembly	8	54.9×	2e-10
spliceosomal complex assembly	6	39.7×	9e-07
RNA splicing	15	14.5×	2e-11
mRNA splicing, via spliceosome	14	14.1×	2e-10

Disease & clinical

Clinical variants and AI predictions

ClinVar

38 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	26
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1891 predictions. Top by Δscore:

Variant	Effect	Δscore
11:77624958:CTAA:C	donor_loss	1.0000
11:77624971:T:TA	donor_gain	1.0000
11:77625066:CTCCA:C	acceptor_gain	1.0000
11:77625067:TCCA:T	acceptor_gain	1.0000
11:77625068:CCA:C	acceptor_gain	1.0000
11:77625068:CCAC:C	acceptor_gain	1.0000
11:77625069:CA:C	acceptor_gain	1.0000
11:77625069:CAC:C	acceptor_gain	1.0000
11:77625071:C:CC	acceptor_gain	1.0000
11:77625712:CTCA:C	donor_loss	1.0000
11:77625713:TCAC:T	donor_loss	1.0000
11:77625714:CACAC:C	donor_loss	1.0000
11:77625716:CA:C	donor_gain	1.0000
11:77625716:CACG:C	donor_gain	1.0000
11:77625814:TTCTT:T	acceptor_gain	1.0000
11:77625816:CTT:C	acceptor_gain	1.0000
11:77625817:TT:T	acceptor_gain	1.0000
11:77625819:C:CC	acceptor_gain	1.0000
11:77637585:CCTAC:C	donor_loss	1.0000
11:77637587:TACCT:T	donor_loss	1.0000
11:77637588:ACCT:A	donor_loss	1.0000
11:77637589:C:CA	donor_loss	1.0000
11:77637589:CCT:C	donor_gain	1.0000
11:77590548:G:GT	donor_gain	0.9900
11:77609292:TTTCA:T	acceptor_loss	0.9900
11:77609293:TTCAG:T	acceptor_loss	0.9900
11:77609294:TCAG:T	acceptor_loss	0.9900
11:77609295:CA:C	acceptor_loss	0.9900
11:77609296:A:C	acceptor_loss	0.9900
11:77609297:GGT:G	acceptor_gain	0.9900

AlphaMissense

1561 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
11:77622583:A:G	L188S	0.999
11:77629852:T:C	Y58C	0.999
11:77629889:A:G	W46R	0.999
11:77629889:A:T	W46R	0.999
11:77622592:A:G	L185P	0.998
11:77622605:C:G	G181R	0.998
11:77625057:G:C	F126L	0.998
11:77625057:G:T	F126L	0.998
11:77625059:A:G	F126L	0.998
11:77625740:A:G	F114S	0.998
11:77629853:A:G	Y58H	0.998
11:77619652:A:C	F230L	0.997
11:77619652:A:T	F230L	0.997
11:77619654:A:G	F230L	0.997
11:77622599:C:G	A183P	0.997
11:77622604:C:T	G181D	0.997
11:77625029:G:C	H136D	0.997
11:77629786:A:T	V80D	0.997
11:77629843:A:T	I61N	0.997
11:77629853:A:C	Y58D	0.997
11:77629887:C:A	W46C	0.997
11:77629887:C:G	W46C	0.997
11:77622605:C:A	G181C	0.996
11:77622616:A:G	L177P	0.996
11:77625039:G:C	C132W	0.996
11:77625058:A:G	F126S	0.996
11:77629852:T:G	Y58S	0.996
11:77629864:A:G	F54S	0.996
11:77629888:C:G	W46S	0.996
11:77622604:C:A	G181V	0.995

dbSNP variants (sampled 300 via entrez): RS1000147774 (11:77628089 G>A), RS1000279384 (11:77632987 T>TGAGGCAGGAGAATTGGTTG), RS1000377583 (11:77634429 C>A,T), RS1000436919 (11:77615214 A>C), RS1000449124 (11:77621118 G>A), RS1000608543 (11:77623248 A>C), RS1000678528 (11:77621850 T>A,C), RS1000693854 (11:77634162 C>G), RS1000975035 (11:77614769 A>G), RS1001062857 (11:77622995 A>C), RS1001125612 (11:77633577 G>A), RS1001168835 (11:77628803 A>G), RS1001494952 (11:77622404 T>C,G), RS1001778936 (11:77622785 T>C), RS1001816727 (11:77629449 A>G)

Disease associations

OMIM: gene MIM:602158 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

3 associations (top):

Study	Trait	p-value
GCST006627_80	Diastolic blood pressure	4.000000e-09
GCST007277_15	Tourette syndrome	5.000000e-06
GCST90002401_188	Platelet distribution width	1.000000e-14

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0006336	diastolic blood pressure
EFO:0007984	platelet component distribution width

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6066867 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

2 potent at pChembl≥5 of 2 total, top 2 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
5.08	Kd	8354	nM	CHEMBL5653589
5.08	ED50	8354	nM	CHEMBL5653589

PubChem BioAssay actives

1 with measured affinity, of 2 total; 1 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2148086: Binding affinity to human CLNS1A incubated for 45 mins by Kinobead based pull down assay	kd	8.3540	uM

CTD chemical–gene interactions

31 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Cadmium Chloride	decreases expression, increases abundance, increases expression	3
sodium arsenite	decreases expression	2
Okadaic Acid	decreases expression	2
aristolochic acid I	decreases expression	1
FR900359	decreases phosphorylation	1
dicrotophos	decreases expression	1
bisphenol A	decreases expression	1
sodium arsenate	decreases expression	1
arsenite	affects binding, increases reaction	1
di-n-butylphosphoric acid	affects expression	1
JP8 aviation fuel	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
candoxin	decreases expression	1
abrine	decreases expression	1
LDN 193189	affects cotreatment, increases expression	1
Acetaminophen	decreases expression	1
Cadmium	increases abundance, increases expression	1
Caffeine	increases phosphorylation	1
Dichlorodiphenyl Dichloroethylene	increases expression	1
Doxorubicin	decreases expression	1
Enzyme Inhibitors	decreases activity, increases O-linked glycosylation	1
Ivermectin	decreases expression	1
Mitoxantrone	affects response to substance	1
Sarin	decreases expression	1
Smoke	decreases expression	1
Thiram	decreases expression	1
Tretinoin	decreases expression	1
Zinc	decreases expression	1
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression	1
Sodium Selenite	increases expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5651128	Binding	Binding affinity to human CLNS1A incubated for 45 mins by Kinobead based pull down assay	NVP-BHG712: Effects of Regioisomers on the Affinity and Selectivity toward the EPHrin Family. — ChemMedChem

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.