CLPS

Summary

CLPS (colipase, HGNC:2085) is a protein-coding gene on chromosome 6p21.31, encoding Colipase (P04118). Colipase is a cofactor of pancreatic lipase.

The protein encoded by this gene is a cofactor needed by pancreatic lipase for efficient dietary lipid hydrolysis. It binds to the C-terminal, non-catalytic domain of lipase, thereby stabilizing an active conformation and considerably increasing the overall hydrophobic binding site. The gene product allows lipase to anchor noncovalently to the surface of lipid micelles, counteracting the destabilizing influence of intestinal bile salts. This cofactor is only expressed in pancreatic acinar cells, suggesting regulation of expression by tissue-specific elements. Three transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 1208 — RefSeq curated summary.

At a glance

• GWAS associations: 1
• Clinical variants (ClinVar): 17 total
• GTEx eGene: eQTL in 9 tissues, sQTL in 1 (q < 0.05)
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.42 (unconstrained)
• MANE Select transcript: NM_001832

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2085
Approved symbol	CLPS
Name	colipase
Location	6p21.31
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000137392
Ensembl biotype	protein_coding
OMIM	120105
Entrez	1208

Gene structure

Transcript identifiers

Ensembl transcripts: 5 — 5 protein_coding

MANE Select: ENST00000259938

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 2, TSL 5: 1

ENST00000259938, ENST00000616014, ENST00000622413, ENST00000912425, ENST00001139944

RefSeq mRNA: 3 — MANE Select: NM_001832 NM_001252597, NM_001252598, NM_001832

CCDS: CCDS4811, CCDS75437, CCDS75438

Canonical transcript exons

ENST00000259938 — 3 exons

Exon	Start	End
ENSE00000929523	35795731	35795853
ENSE00000929524	35797205	35797323
ENSE00001031985	35794982	35795277

Expression profiles

Bgee: expression breadth ubiquitous, 156 present calls, max score 99.99.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 244.7918 / max 372553.2649, expressed in 28 samples.

Highest expression (Bgee): body of pancreas, pancreas, islet of Langerhans, male germ line stem cell (sensu Vertebrata) in testis, epithelial cell of pancreas.

Genetic regulation across tissues (GTEx eQTL / sQTL)

CLPS is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 9 tissues and its splicing (sQTL) in 1 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

10 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Pancreas	eqtl	5.2e-14	+0.41	6:35780476:A:C
Spleen	eqtl	8.4e-05	+1.67	6:34861810:C:A
Brain Amygdala	eqtl	7.8e-03	+0.53	6:35764754:T:C
Esophagus Muscularis	eqtl	8.0e-03	-0.86	6:36568727:G:A
Cells Cultured fibroblasts	eqtl	1.8e-02	+0.74	6:35508133:G:C
Adipose Visceral Omentum	sqtl	2.0e-02	+1.11	6:36268773:G:C
Brain Anterior cingulate cortex BA24	eqtl	2.2e-02	+1.45	6:36142157:G:A
Adipose Visceral Omentum	eqtl	3.2e-02	-0.40	6:36376552:T:C
Whole Blood	eqtl	4.1e-02	+0.23	6:36643387:G:GGGGAGCACAGAGCTGGGCCCACA
Testis	eqtl	4.1e-02	+0.33	6:35809731:T:A

FANTOM5 promoters

1 alternative TSS:

Promoter ID	TPM avg	Samples expressed
73324	244.7918	28

Top tissues by expression

showing 100 of 287 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
body of pancreas	UBERON:0001150	99.99	gold quality
pancreas	UBERON:0001264	99.19	gold quality
islet of Langerhans	UBERON:0000006	99.10	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	89.81	gold quality
epithelial cell of pancreas	CL:0000083	89.20	gold quality
type B pancreatic cell	CL:0000169	88.67	gold quality
right coronary artery	UBERON:0001625	84.54	gold quality
pancreatic ductal cell	CL:0002079	82.31	silver quality
ectocervix	UBERON:0012249	82.29	gold quality
right uterine tube	UBERON:0001302	80.97	gold quality
descending thoracic aorta	UBERON:0002345	80.64	gold quality
right lobe of liver	UBERON:0001114	80.55	gold quality
oocyte	CL:0000023	80.32	gold quality
endocervix	UBERON:0000458	79.92	gold quality
body of stomach	UBERON:0001161	79.68	gold quality
metanephros cortex	UBERON:0010533	79.10	gold quality
right adrenal gland	UBERON:0001233	78.69	gold quality
left uterine tube	UBERON:0001303	78.65	gold quality
fundus of stomach	UBERON:0001160	76.78	gold quality
right adrenal gland cortex	UBERON:0035827	74.95	gold quality
lower esophagus mucosa	UBERON:0035834	74.61	gold quality
left adrenal gland cortex	UBERON:0035825	74.34	gold quality
secondary oocyte	CL:0000655	73.91	gold quality
stomach	UBERON:0000945	73.31	gold quality
adrenal cortex	UBERON:0001235	73.03	gold quality
left adrenal gland	UBERON:0001234	72.68	gold quality
thoracic aorta	UBERON:0001515	71.90	gold quality
mucosa of stomach	UBERON:0001199	71.86	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	71.77	gold quality
right ovary	UBERON:0002118	71.70	gold quality
spleen	UBERON:0002106	70.93	gold quality
transverse colon	UBERON:0001157	70.71	gold quality
ascending aorta	UBERON:0001496	70.67	gold quality
esophagus mucosa	UBERON:0002469	70.44	gold quality
left ovary	UBERON:0002119	70.23	gold quality
body of uterus	UBERON:0009853	69.61	gold quality
adult organism	UBERON:0007023	69.04	gold quality
duodenum	UBERON:0002114	68.88	gold quality
parotid gland	UBERON:0001831	68.81	gold quality
small intestine Peyer’s patch	UBERON:0003454	68.59	gold quality
small intestine	UBERON:0002108	68.31	gold quality
lower esophagus	UBERON:0013473	68.24	gold quality
apex of heart	UBERON:0002098	68.19	gold quality
esophagus	UBERON:0001043	68.16	gold quality
lower esophagus muscularis layer	UBERON:0035833	68.02	gold quality
jejunal mucosa	UBERON:0000399	67.79	gold quality
uterine cervix	UBERON:0000002	66.29	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	66.25	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	65.75	gold quality
omental fat pad	UBERON:0010414	65.28	gold quality
peritoneum	UBERON:0002358	65.25	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	65.07	gold quality
adipose tissue of abdominal region	UBERON:0007808	64.89	gold quality
saliva-secreting gland	UBERON:0001044	64.72	gold quality
right hemisphere of cerebellum	UBERON:0014890	64.68	gold quality
metanephros	UBERON:0000081	64.64	gold quality
adrenal gland	UBERON:0002369	64.25	gold quality
aorta	UBERON:0000947	63.97	gold quality
muscle layer of sigmoid colon	UBERON:0035805	63.87	gold quality
ovary	UBERON:0000992	63.83	gold quality
buccal mucosa cell	CL:0002336	63.48	gold quality
vagina	UBERON:0000996	63.21	gold quality
jejunum	UBERON:0002115	62.72	gold quality
cingulate cortex	UBERON:0003027	62.68	gold quality
right atrium auricular region	UBERON:0006631	62.62	gold quality
colon	UBERON:0001155	62.40	gold quality
anterior cingulate cortex	UBERON:0009835	62.36	gold quality
intestine	UBERON:0000160	62.27	gold quality
sigmoid colon	UBERON:0001159	62.20	gold quality
minor salivary gland	UBERON:0001830	61.99	gold quality
tongue squamous epithelium	UBERON:0006919	61.85	gold quality
cardiac atrium	UBERON:0002081	61.84	gold quality
prostate gland	UBERON:0002367	61.57	gold quality
mouth mucosa	UBERON:0003729	61.43	gold quality
vastus lateralis	UBERON:0001379	61.33	gold quality
left testis	UBERON:0004533	61.33	gold quality
large intestine	UBERON:0000059	61.26	gold quality
mucosa of transverse colon	UBERON:0004991	61.16	gold quality
pituitary gland	UBERON:0000007	61.10	gold quality
right frontal lobe	UBERON:0002810	60.99	gold quality
coronary artery	UBERON:0001621	60.78	gold quality
biceps brachii	UBERON:0001507	60.34	gold quality
quadriceps femoris	UBERON:0001377	60.19	gold quality
orbitofrontal cortex	UBERON:0004167	59.96	gold quality
amygdala	UBERON:0001876	59.33	gold quality
Ammon’s horn	UBERON:0001954	59.32	gold quality
left coronary artery	UBERON:0001626	59.10	gold quality
skin of abdomen	UBERON:0001416	58.97	gold quality
Brodmann (1909) area 46	UBERON:0006483	58.87	gold quality
decidua	UBERON:0002450	58.67	gold quality
tibial artery	UBERON:0007610	58.38	gold quality
myometrium	UBERON:0001296	58.29	gold quality
right lobe of thyroid gland	UBERON:0001119	58.22	gold quality
gingiva	UBERON:0001828	58.12	gold quality
popliteal artery	UBERON:0002250	58.11	gold quality
esophagus squamous epithelium	UBERON:0006920	58.11	silver quality
placenta	UBERON:0001987	57.92	gold quality
testis	UBERON:0000473	57.89	gold quality
right testis	UBERON:0004534	57.88	gold quality
anatomical system	UBERON:0000467	57.75	gold quality

Single-cell (SCXA)

Detected in 5 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-GEOD-81547	yes	52515.73
E-ENAD-27	yes	6.95
E-HCAD-31	no	3.26
E-GEOD-83139	no	3.18
E-ANND-3	no	0.00

HPA expression

RNA tissue specificity: Tissue enriched

41 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Pancreas	tissue	246873.6	medium
Ovary	tissue	61.9	not detected
Heart muscle	tissue	43.3	not detected
Salivary gland	tissue	39.2	not detected
Duodenum	tissue	37.9	not detected
Stomach 1	tissue	26.1	not detected
Small intestine	tissue	22.5	not detected
Placenta	tissue	11.2	not detected
Lymph node	tissue	9.9	not detected
Bone marrow	tissue	8.5	not detected
Pituitary gland	tissue	5.7
Endometrium 1	tissue	5.7	not detected
Appendix	tissue	5.4	not detected
Epididymis	tissue	5.3	not detected
Vagina	tissue	4.7	not detected
Skin 1	tissue	3.0	not detected
Hippocampus	tissue	2.2	not detected
Spleen	tissue	2.0	not detected
Choroid plexus	tissue	1.9
Locus coeruleus	tissue	1.7
Prostate	tissue	1.6	not detected
Postcentral gyrus	tissue	1.6
Nucleus accumbens	tissue	1.2
Testis	tissue	1.0	not detected
Lung	tissue	0.8	not detected
Thyroid gland	tissue	0.4	not detected
Cerebral cortex	tissue	0.2	not detected
Urinary bladder	tissue	0.2	not detected
Motor cortex	tissue	0.2
Hippocampal formation	tissue	0.2
Insular cortex	tissue	0.2
Breast	tissue	0.1	not detected
Prefrontal cortex	tissue	0.1
Adipose tissue	tissue	0.1	not detected
Esophagus	tissue	0.1	not detected
Putamen	tissue	0.1
Kidney	tissue	0.1	not detected
Retrosplenial and cingulate cortex	tissue	0.1
Fallopian tube	tissue	0.1	not detected
Somatosensory cortex	tissue	0.1
Retrosplenial cortex	tissue	0.1

Brain sub-regions (HPA Brain Atlas): detected in 184; highest nTPM — Blood vessel (25.0), Claustrum (5.1), Hippocampus, CA3 (3.5), Parahippocampal cortex (3.3), Stria terminalis, bed nucleus (3.3).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting CLPS by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

15 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-10401-5P	99.99	65.79	948
HSA-MIR-378G	99.71	64.90	1106
HSA-MIR-6722-3P	99.45	67.62	1919
HSA-MIR-2115-3P	99.31	69.68	2026
HSA-MIR-1909-3P	99.03	66.56	1662
HSA-MIR-4748	98.95	67.53	810
HSA-MIR-3611	98.76	68.76	1290
HSA-MIR-3187-5P	98.36	65.74	1776
HSA-MIR-1233-5P	98.19	66.71	1201
HSA-MIR-6778-5P	98.19	66.59	1239
HSA-MIR-1285-3P	97.72	67.02	1932
HSA-MIR-5189-5P	97.72	66.96	1814
HSA-MIR-6131	97.22	66.72	960
HSA-MIR-6860	97.21	66.31	1656
HSA-MIR-4486	96.96	60.61	931

Functional genomics

gnomAD constraint: pLI 0.00156, LOEUF 1.42, missense Z 0.15 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000259938 — one region, missense o/e 0.99.

Literature-anchored findings (GeneRIF, showing 6)

• evidence in two German Caucasian study populations that the variant of the rare colipase Arg109Cys polymorphism might contribute to increased susceptibility of type 2 diabetes (PMID:16189801)
• Our findings demonstrate that the Arg92Cys polymorphism decreases the function of Cys92 colipase. This change may contribute to the development of type 2 diabetes. (PMID:17715423)
• CLPS genetic variability associates with insulin secretory function in non-diabetic humans and may represent a novel candidate gene for development of type 2 diabetes (PMID:18726866)
• found no evidence for an association of pancreatic colipase(CLPS) single nucleotide polymorphisms rs2766597, rs41270082, rs3748050, and rs3748051 with obesity or percentage of dietary fat intake (PMID:20054203)
• humans with the Arg92Cys substitution will secrete less functional colipase (PMID:23204298)
• Low CLPS expression is associated with pancreatic cancer. (PMID:23918603)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Clps	ENSMUSG00000024225
rattus_norvegicus	Clps	ENSRNOG00000000510

Paralogs (3): CLPSL2 (ENSG00000196748), CLPSL1 (ENSG00000204140), LRCOL1 (ENSG00000204583)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:88421) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 16 distinct phenotype terms.

Mouse phenotype (MP)	Records
postnatal lethality	2
increased circulating cholesterol level	2
decreased circulating HDL cholesterol level	1
sparse hair	1
decreased body weight	1
decreased body size	1
polyphagia	1
abnormal coat appearance	1
decreased circulating triglyceride level	1
steatorrhea	1
abnormal facial morphology	1
greasy coat	1
decreased percent body fat/body weight	1
slow postnatal weight gain	1
preweaning lethality, complete penetrance	1
abnormal facial skin morphology	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Equus caballus	P02704	98.1%	Diamond
Bos taurus	A0JNQ7	83.6%	Diamond
Canis lupus familiaris	P19090	83.6%	Diamond
Oryctolagus cuniculus	P42890	83.0%	Diamond
Ictidomys tridecemlineatus	Q91XL7	81.1%	Diamond
Sus scrofa	P02703	80.9%	Diamond
Myocastor coypus	P42889	77.4%	Diamond
Xenopus tropicalis	A9JSD6	76.5%	Diamond
Gallus gallus	P11148	76.5%	Diamond
Squalus acanthias	P11149	66.7%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
SLC26A8	protein-coding	116369
LHFPL5	protein-coding	222662
SRPK1	protein-coding	6732
CLPSL1	protein-coding	340204
CLPSL2	protein-coding	389383
ARMC12	protein-coding	221481

Protein

Protein identifiers

Colipase — P04118 (reviewed: P04118)

All UniProt accessions (3): P04118, A0A087WZW1, A0A087X0Q7

UniProt curated annotations — full annotation on UniProt →

Function. Colipase is a cofactor of pancreatic lipase. It allows the lipase to anchor itself to the lipid-water interface. Without colipase the enzyme is washed off by bile salts, which have an inhibitory effect on the lipase. Enterostatin has a biological activity as a satiety signal.

Subunit / interactions. Forms a 1:1 stoichiometric complex with pancreatic lipase.

Subcellular location. Secreted.

Tissue specificity. Expressed by the pancreas.

Polymorphism. Variant Cys-109 is statistically significantly associated with an increased risk of type 2 diabetes.

Similarity. Belongs to the colipase family.

RefSeq proteins (3): NP_001239526, NP_001239527, NP_001823* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001981	Colipase	Family
IPR017913	Colipase_N	Domain
IPR017914	Colipase_C	Domain
IPR017915	Colipase_CS	Conserved_site
IPR047576	CLPS_chr	Family

Pfam: PF01114, PF02740

UniProt features (10 total): disulfide bond 5, sequence variant 2, signal peptide 1, propeptide 1, chain 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P04118-F1	87.89	0.62

Human Protein Atlas

Protein class: Metabolic proteins, Predicted secreted proteins, Predicted intracellular proteins, Plasma proteins

Protein evidence: Evidence at protein level

Antibody reliability (HPA): IH enhanced

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Disulfide bonds (5)

Type	Positions
Disulfide bond	34–45, 40–56, 44–78, 66–86, 80–104

Function

Pathways and Gene Ontology

Reactome pathways

2 curated (TAS) of 9; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

9 pathways:

ID	Pathway	Evidence
R-HSA-192456	Digestion of dietary lipid	curated
R-HSA-975634	Retinoid metabolism and transport	curated
R-HSA-8935690	Digestion	—
R-HSA-8963743	Digestion and absorption	—
R-HSA-1430728	Metabolism	—
R-HSA-6806667	Metabolism of fat-soluble vitamins	—
R-HSA-196854	Metabolism of vitamins and cofactors	—
R-HSA-9709957	Sensory Perception	—
R-HSA-2187338	Visual phototransduction	—

MSigDB gene sets: 78 (showing top): GOBP_DIGESTION, GRAESSMANN_APOPTOSIS_BY_SERUM_DEPRIVATION_UP, CAGCTG_AP4_Q5, GOBP_LIPID_METABOLIC_PROCESS, GOBP_LIPID_CATABOLIC_PROCESS, GOBP_ISOPRENOID_METABOLIC_PROCESS, AP4_01, REACTOME_METABOLISM_OF_VITAMINS_AND_COFACTORS, GOMF_ENZYME_ACTIVATOR_ACTIVITY, KIM_MYCN_AMPLIFICATION_TARGETS_UP, GOBP_RESPONSE_TO_BACTERIUM, GOMF_ENZYME_REGULATOR_ACTIVITY, YOSHIMURA_MAPK8_TARGETS_UP, MARTENS_TRETINOIN_RESPONSE_UP, BRUINS_UVC_RESPONSE_VIA_TP53_GROUP_A

GO Biological Process (5): retinoid metabolic process (GO:0001523), lipid metabolic process (GO:0006629), digestion (GO:0007586), lipid catabolic process (GO:0016042), positive regulation of catalytic activity (GO:0043085)

GO Molecular Function (2): enzyme activator activity (GO:0008047), lipase binding (GO:0035473)

GO Cellular Component (1): extracellular region (GO:0005576)

Reactome top-level categories

7 top-level categories:

Category	Pathways
Digestion	1
Visual phototransduction	1
Metabolism of fat-soluble vitamins	1
Metabolism	1
Sensory Perception	1
Metabolism of vitamins and cofactors	1
Digestion and absorption	1

GO top-level categories

12 GO namespaces:

Category	Terms
catalytic activity	2
diterpenoid metabolic process	1
primary metabolic process	1
multicellular organismal process	1
lipid metabolic process	1
catabolic process	1
positive regulation of molecular function	1
regulation of catalytic activity	1
enzyme regulator activity	1
molecular function activator activity	1
enzyme binding	1
cellular anatomical structure	1

Protein interactions and networks

STRING

showing 15 of 456 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CLPS	PNLIP	P16233	981
CLPS	LIPF	P07098	938
CLPS	PNLIPRP1	P54315	927
CLPS	PROK1	P58294	743
CLPS	REG1A	P05451	735
CLPS	PROK2	Q9HC23	700
CLPS	DKK4	Q9UBT3	695
CLPS	DKK2	Q9UBU2	689
CLPS	TBX22	Q9Y458	677
CLPS	CEL	P19835	664
CLPS	LIPC	P11150	577
CLPS	CTRB1	P17538	569
CLPS	LPL	P06858	563
CLPS	CLPX	O76031	557
CLPS	CTRB2	Q6GPI1	547

IntAct

BioGRID (3 interactions; top human partners by supporting records): GLP1R (PCA)

Disease & clinical

Genetic variants

Variant evidence for CLPS: 17 ClinVar records (0 pathogenic / likely pathogenic); 1 GWAS association.

ClinVar

17 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	11
Likely benign	2
Benign	2

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 27 predictions of 132):

Position(s)	Effect	Δscore	Sites
6:35797203–35797204	donor_loss	0.9900	5
6:35795278–35795279	acceptor_loss	0.9800	5
6:35795278	acceptor_loss	0.9700
6:35797203	donor_loss	0.9700
6:35795729–35795730	donor_loss	0.9500	5
6:35795854–35795855	acceptor_loss	0.9500	6
6:35795856	acceptor_loss	0.9400
6:35795290	acceptor_gain	0.9300
6:35795859	acceptor_loss	0.9300
6:35795280	acceptor_loss	0.9200

AlphaMissense

310 missense substitutions predicted likely pathogenic (of 730 scored), across 83 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D106	8	0.862	0.904
C104	7	0.991	0.997
C34	7	0.990	0.996
C56	7	0.989	0.997
C40	7	0.987	0.997
C45	7	0.987	0.995
C86	7	0.986	0.994
C80	7	0.985	0.993
C66	7	0.984	0.996
C78	7	0.979	0.991
C44	7	0.976	0.989
F101	7	0.893	0.975
E32	7	0.878	0.952
Q39	7	0.876	0.976
N98	7	0.872	0.967
E62	7	0.846	0.936
E81	7	0.839	0.946
G102	6	0.929	0.988
S37	6	0.910	0.965
G94	6	0.903	0.993

HPA cancer prognostics

RNA cancer specificity: Cancer enriched (Pancreatic Adenocarcinoma)

Disease associations

OMIM: gene MIM:120105 | disease phenotypes:

GWAS associations

1 associations:

Study	Trait	p-value
GCST006585_1362	Blood protein levels	6e-80

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

5 total (human), top 5 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	decreases methylation	1
sodium arsenite	affects expression	1
Olive Oil	affects cotreatment, decreases reaction, increases hydrolysis	1
Orlistat	increases hydrolysis, affects cotreatment, decreases reaction	1
Valproic Acid	increases methylation	1

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.