CNEP1R1

Summary

CNEP1R1 (CTD nuclear envelope phosphatase 1 regulatory subunit 1, HGNC:26759) is a protein-coding gene on chromosome 16q12.1, encoding Nuclear envelope phosphatase-regulatory subunit 1 (Q8N9A8). Forms with the serine/threonine protein phosphatase CTDNEP1 an active complex which dephosphorylates and may activate LPIN1 and LPIN2.

This gene encodes a transmembrane protein that belongs to the Tmemb_18A family. A similar protein in yeast is a component of an endoplasmic reticulum-associated protein phosphatase complex and is thought to play a role in the synthesis of triacylglycerol. Alternate splicing results in multiple transcript variants.

Source: NCBI Gene 255919 — RefSeq curated summary.

At a glance

• GWAS associations: 5
• Clinical variants (ClinVar): 19 total
• MANE Select transcript: NM_001281789

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:26759
Approved symbol	CNEP1R1
Name	CTD nuclear envelope phosphatase 1 regulatory subunit 1
Location	16q12.1
Locus type	gene with protein product
Status	Approved
Aliases	FLJ38101, NEP1-R1
Ensembl gene	ENSG00000205423
Ensembl biotype	protein_coding
OMIM	616869
Entrez	255919

Gene structure

Transcript identifiers

Ensembl transcripts: 15 — 9 protein_coding, 4 nonsense_mediated_decay, 2 protein_coding_CDS_not_defined

ENST00000389134, ENST00000427478, ENST00000458059, ENST00000562576, ENST00000565457, ENST00000565556, ENST00000566093, ENST00000566482, ENST00000567712, ENST00000568890, ENST00000569647, ENST00000885508, ENST00000933447, ENST00000933448, ENST00000961445

RefSeq mRNA: 2 — MANE Select: NM_001281789 NM_001281789, NM_153261

CCDS: CCDS45480, CCDS61931

Canonical transcript exons

ENST00000427478 — 6 exons

Exon	Start	End
ENSE00001717585	50029725	50029798
ENSE00001725872	50035417	50037081
ENSE00003658853	50026396	50026467
ENSE00003659213	50025225	50025340
ENSE00003668576	50033397	50033506
ENSE00003788946	50034102	50034156

Expression profiles

Bgee: expression breadth ubiquitous, 255 present calls, max score 95.72.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 10.3870 / max 120.3360, expressed in 1787 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
153975	9.4048	1783
153976	0.9823	591

Top tissues by expression

256 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
left ventricle myocardium	UBERON:0006566	95.72	gold quality
upper arm skin	UBERON:0004263	95.13	gold quality
cardiac muscle of right atrium	UBERON:0003379	95.08	gold quality
epithelial cell of pancreas	CL:0000083	94.68	gold quality
deltoid	UBERON:0001476	93.50	gold quality
esophagus squamous epithelium	UBERON:0006920	92.96	gold quality
tibialis anterior	UBERON:0001385	92.81	gold quality
quadriceps femoris	UBERON:0001377	92.55	gold quality
monocyte	CL:0000576	92.50	gold quality
vastus lateralis	UBERON:0001379	92.32	gold quality
myocardium	UBERON:0002349	92.24	gold quality
leukocyte	CL:0000738	92.14	gold quality
ileal mucosa	UBERON:0000331	91.98	gold quality
cerebellar vermis	UBERON:0004720	91.98	gold quality
endothelial cell	CL:0000115	91.91	gold quality
gingival epithelium	UBERON:0001949	91.85	gold quality
pons	UBERON:0000988	91.32	gold quality
germinal epithelium of ovary	UBERON:0001304	91.21	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	91.05	gold quality
kidney epithelium	UBERON:0004819	90.81	silver quality
layer of synovial tissue	UBERON:0007616	90.68	gold quality
synovial joint	UBERON:0002217	90.54	gold quality
blood	UBERON:0000178	90.23	gold quality
body of tongue	UBERON:0011876	90.12	gold quality
heart right ventricle	UBERON:0002080	89.88	gold quality
gingiva	UBERON:0001828	89.61	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	89.56	gold quality
vermiform appendix	UBERON:0001154	89.38	gold quality
skeletal muscle tissue	UBERON:0001134	89.23	gold quality
caecum	UBERON:0001153	89.18	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	3.53

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

139 targeting CNEP1R1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-4668-3P	100.00	68.74	2635
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-126-5P	100.00	72.71	3180
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-223-3P	99.99	70.14	1140
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-4775	99.98	75.00	6394
HSA-MIR-499A-5P	99.98	70.79	1323
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-9-3P	99.96	70.88	2068
HSA-MIR-1468-3P	99.96	72.74	3797
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-548J-3P	99.94	72.61	4881

Literature-anchored findings (GeneRIF, showing 3)

• Nuclear envelope phosphatase 1-regulatory subunit 1 (formerly TMEM188) is the metazoan Spo7p ortholog and functions in the lipin activation pathway. (PMID:22134922)
• The endoplasmic reticulum adaptor protein ERAdP initiates NK cell activation via the Ubc13-mediated NF-kappaB pathway. (PMID:25548215)
• Structure and mechanism of the human CTDNEP1-NEP1R1 membrane protein phosphatase complex necessary to maintain ER membrane morphology. (PMID:38776370)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	cnep1r1	ENSDARG00000036064
mus_musculus	Cnep1r1	ENSMUSG00000036810
rattus_norvegicus	Cnep1r1	ENSRNOG00000015534
drosophila_melanogaster	Cnep1r2	FBGN0036090
drosophila_melanogaster	Cnep1r1	FBGN0069938
caenorhabditis_elegans	nepr-1	WBGENE00011828

Protein

Protein identifiers

Nuclear envelope phosphatase-regulatory subunit 1 — Q8N9A8 (reviewed: Q8N9A8)

Alternative names: Transmembrane protein 188

All UniProt accessions (6): Q8N9A8, B8YCP3, H3BLY8, H3BMF1, H3BN40, H3BUT5

UniProt curated annotations — full annotation on UniProt →

Function. Forms with the serine/threonine protein phosphatase CTDNEP1 an active complex which dephosphorylates and may activate LPIN1 and LPIN2. LPIN1 and LPIN2 are phosphatidate phosphatases that catalyze the conversion of phosphatidic acid to diacylglycerol and control the metabolism of fatty acids at different levels. May indirectly modulate the lipid composition of nuclear and/or endoplasmic reticulum membranes and be required for proper nuclear membrane morphology and/or dynamics. May also indirectly regulate the production of lipid droplets and triacylglycerol.

Subunit / interactions. Interacts with CTDNEP1; the complex dephosphorylates LPIN1 and LPIN2.

Subcellular location. Nucleus membrane. Cytoplasm.

Tissue specificity. Muscle specific with lower expression in other metabolic tissues.

Similarity. Belongs to the CNEP1R1 family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q8N9A8-1	1	yes
Q8N9A8-2	2
Q8N9A8-3	3

RefSeq proteins (2): NP_001268718, NP_694993 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR019168	NEP1-R1	Family

Pfam: PF09771

UniProt features (9 total): splice variant 3, transmembrane region 2, chain 1, modified residue 1, sequence conflict 1, helix 1

Structure

Experimental structures (PDB)

2 structures.

PDB	Method	Resolution (Å)
8UJL	X-RAY DIFFRACTION	1.91
8UJM	X-RAY DIFFRACTION	2.16

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8N9A8-F1	90.14	0.70

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 1

Function

Pathways and Gene Ontology

Reactome pathways

6 pathways

ID	Pathway
R-HSA-4419969	Depolymerization of the Nuclear Lamina
R-HSA-1640170	Cell Cycle
R-HSA-2980766	Nuclear Envelope Breakdown
R-HSA-68875	Mitotic Prophase
R-HSA-68886	M Phase
R-HSA-69278	Cell Cycle, Mitotic

MSigDB gene sets: 154 (showing top): GOBP_REGULATION_OF_TRIGLYCERIDE_METABOLIC_PROCESS, TTTGTAG_MIR520D, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_DN, GOBP_GLYCEROLIPID_METABOLIC_PROCESS, GTGCCTT_MIR506, GOBP_REGULATION_OF_LIPID_BIOSYNTHETIC_PROCESS, GOBP_REGULATION_OF_LIPID_METABOLIC_PROCESS, ROZANOV_MMP14_TARGETS_UP, GOBP_POSITIVE_REGULATION_OF_TRIGLYCERIDE_BIOSYNTHETIC_PROCESS, GOBP_GLYCEROLIPID_BIOSYNTHETIC_PROCESS, GOBP_NEUTRAL_LIPID_BIOSYNTHETIC_PROCESS, GOBP_LIPID_METABOLIC_PROCESS, GOBP_NEUTRAL_LIPID_METABOLIC_PROCESS, GOBP_LIPID_BIOSYNTHETIC_PROCESS

GO Biological Process (3): lipid metabolic process (GO:0006629), positive regulation of triglyceride biosynthetic process (GO:0010867), protein localization to nucleus (GO:0034504)

GO Molecular Function (2): protein phosphatase regulator activity (GO:0019888), protein binding (GO:0005515)

GO Cellular Component (7): nuclear envelope (GO:0005635), cytoplasm (GO:0005737), cytosol (GO:0005829), nuclear membrane (GO:0031965), Nem1-Spo7 phosphatase complex (GO:0071595), nucleus (GO:0005634), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-5 pathways:

Category	Pathways
Nuclear Envelope Breakdown	1
Mitotic Prophase	1
M Phase	1
Cell Cycle, Mitotic	1
Cell Cycle	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	3
nucleus	2
primary metabolic process	1
regulation of triglyceride biosynthetic process	1
triglyceride biosynthetic process	1
positive regulation of lipid biosynthetic process	1
positive regulation of triglyceride metabolic process	1
protein localization to organelle	1
phosphoprotein phosphatase activity	1
phosphatase regulator activity	1
protein phosphatase binding	1
binding	1
endomembrane system	1
organelle envelope	1
intracellular anatomical structure	1
cytoplasm	1
nuclear envelope	1
organelle membrane	1
protein serine/threonine phosphatase complex	1
nuclear outer membrane-endoplasmic reticulum membrane network	1
membrane protein complex	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

470 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CNEP1R1	CTDNEP1	O95476	930
CNEP1R1	C16orf78	Q8WTQ4	596
CNEP1R1	HEATR3	Q7Z4Q2	525
CNEP1R1	LPIN1	Q14693	525
CNEP1R1	TENT4B	Q8NDF8	489
CNEP1R1	TYSND1	Q2T9J0	482
CNEP1R1	WAC	Q9BTA9	473
CNEP1R1	BRINP1	O60477	449
CNEP1R1	CACNG1	Q06432	408
CNEP1R1	NUDT8	Q8WV74	371
CNEP1R1	POGK	Q9P215	370
CNEP1R1	FBXW5	Q969U6	367
CNEP1R1	LPIN2	Q92539	363
CNEP1R1	PPIL1	Q9Y3C6	362
CNEP1R1	TOR1B	O14657	357
CNEP1R1	TTC9B	Q8N6N2	357

IntAct

7 interactions, top by confidence:

A	B	Type	Score
CNEP1R1	CTDNEP1	psi-mi:“MI:0915”(physical association)	0.460
CTDNEP1	CNEP1R1	psi-mi:“MI:0403”(colocalization)	0.460
ESR1	ESYT2	psi-mi:“MI:0914”(association)	0.350
ORF4	CTDNEP1	psi-mi:“MI:0914”(association)	0.350

BioGRID (13): UBE2N (Two-hybrid), UBE2N (Reconstituted Complex), CNEP1R1 (Reconstituted Complex), CNEP1R1 (Affinity Capture-Western), UBE2N (Affinity Capture-Western), CNEP1R1 (Affinity Capture-MS), CNEP1R1 (Affinity Capture-MS), CNEP1R1 (Positive Genetic), CNEP1R1 (Proximity Label-MS), CNEP1R1 (Proximity Label-MS), CNEP1R1 (Affinity Capture-RNA), CTDNEP1 (Affinity Capture-Western), CNEP1R1 (Affinity Capture-RNA)

ESM2 similar proteins: A0A1B0GST9, A0A1B0GTU2, A0A1B0GV90, A0A590UK83, A2RRL7, A7S641, A8WG88, A9JTJ0, B9X187, K7EJ46, O00168, O08589, O13001, P0C2S0, P15383, P41237, P56513, P60606, P63160, P63161, Q04645, Q04646, Q04679, Q04680, Q0P467, Q28EH9, Q3SZX0, Q3UJ81, Q3URE8, Q3ZBP2, Q4LDR2, Q4R6L9, Q502I1, Q592E4, Q5XF36, Q6AXF6, Q6NWH5, Q6PBK8, Q6Q3F5, Q71RC9

Diamond homologs: Q3UJ81, Q3ZBP2, Q561X0, Q5M8F7, Q5R7J7, Q7ZY85, Q8N9A8, Q8T0B1, Q9XXN3

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

19 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	10
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

1307 predictions. Top by Δscore:

Variant	Effect	Δscore
16:50026468:G:GG	donor_gain	1.0000
16:50029723:A:AG	acceptor_gain	1.0000
16:50029724:G:GG	acceptor_gain	1.0000
16:50033522:GAT:G	donor_gain	1.0000
16:50025338:A:T	donor_gain	0.9900
16:50025338:AAGGT:A	donor_loss	0.9900
16:50025339:AGGTA:A	donor_loss	0.9900
16:50025341:GTA:G	donor_loss	0.9900
16:50025342:T:G	donor_loss	0.9900
16:50025707:G:GT	donor_gain	0.9900
16:50026465:GAA:G	donor_gain	0.9900
16:50033487:A:T	donor_gain	0.9900
16:50035580:G:GT	donor_gain	0.9900
16:50025447:G:GT	donor_gain	0.9800
16:50025454:C:G	donor_gain	0.9800
16:50026463:GAGAA:G	donor_gain	0.9800
16:50029721:T:G	acceptor_gain	0.9800
16:50029724:GT:G	acceptor_gain	0.9800
16:50025337:G:GT	donor_gain	0.9600
16:50025901:GTCTA:G	donor_gain	0.9600
16:50026464:AGAAG:A	donor_loss	0.9600
16:50026465:GAAGT:G	donor_loss	0.9600
16:50026466:AAGT:A	donor_loss	0.9600
16:50026467:AGT:A	donor_loss	0.9600
16:50026468:G:A	donor_loss	0.9600
16:50026469:TAAG:T	donor_loss	0.9600
16:50026470:A:AG	donor_loss	0.9600
16:50026868:G:GT	donor_gain	0.9600
16:50033491:T:TA	donor_gain	0.9600
16:50033492:A:AA	donor_gain	0.9600

AlphaMissense

808 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
16:50026399:T:C	L10P	1.000
16:50026407:T:C	F13L	1.000
16:50026409:T:A	F13L	1.000
16:50026409:T:G	F13L	1.000
16:50026420:T:C	L17P	1.000
16:50026461:T:A	W31R	1.000
16:50026461:T:C	W31R	1.000
16:50029748:T:C	C41R	1.000
16:50029754:G:C	A43P	1.000
16:50029755:C:A	A43D	1.000
16:50029760:G:C	G45R	1.000
16:50029761:G:A	G45D	1.000
16:50029772:T:A	W49R	1.000
16:50029772:T:C	W49R	1.000
16:50029776:T:C	L50S	1.000
16:50033433:T:C	F70L	1.000
16:50033435:C:A	F70L	1.000
16:50033435:C:G	F70L	1.000
16:50033442:A:C	S73R	1.000
16:50033444:C:A	S73R	1.000
16:50033444:C:G	S73R	1.000
16:50033445:T:C	C74R	1.000
16:50033455:T:C	L77P	1.000
16:50033476:G:A	G84E	1.000
16:50033479:T:A	I85K	1.000
16:50034107:C:A	A96D	1.000
16:50034128:T:C	L103S	1.000
16:50034148:T:C	C110R	1.000
16:50034149:G:A	C110Y	1.000
16:50034150:T:G	C110W	1.000

dbSNP variants (sampled 300 via entrez): RS1000412326 (16:50027603 TAGTGAGCTATGTAGTGAGCTA>T), RS1000466731 (16:50025201 G>A), RS1000477184 (16:50027350 A>C), RS1000604642 (16:50023250 CTGAG>C), RS1000616365 (16:50027573 G>A), RS1001215793 (16:50028906 A>C), RS1001258352 (16:50029333 G>C,T), RS1001394814 (16:50033367 A>C,G,T), RS1001470146 (16:50023780 G>A,T), RS1001864716 (16:50027608 A>G), RS1001989541 (16:50034786 C>T), RS1002100807 (16:50034490 T>A), RS1002339872 (16:50027377 G>A), RS1002835696 (16:50036615 A>G), RS1002928560 (16:50026080 C>G)

Disease associations

OMIM: gene MIM:616869 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

5 associations (top):

Study	Trait	p-value
GCST004072_2	Cold medicine-related Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN) with severe ocular complications	2.000000e-07
GCST004072_3	Cold medicine-related Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN) with severe ocular complications	1.000000e-07
GCST007267_87	Systolic blood pressure	5.000000e-10
GCST009066_27	Mosaic loss of chromosome Y (Y chromosome dosage)	4.000000e-12
GCST009067_21	Mosaic loss of chromosome Y (Y chromosome dosage)	8.000000e-07

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0006997	response to cold medicine
EFO:0006335	systolic blood pressure
EFO:0007783	mosaic loss of chromosome Y measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

27 total (human), top 27 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	affects cotreatment, increases abundance, increases expression	2
Formaldehyde	decreases expression, increases expression	2
Valproic Acid	affects expression, increases expression	2
Cadmium Chloride	increases expression, decreases expression	2
3-((6-(2-methoxyphenyl)pyrimidin-4-yl)amino)phenyl)methane sulfonamide	decreases expression	1
dicrotophos	decreases expression	1
triphenyl phosphate	affects expression	1
bisphenol A	decreases expression	1
manganese chloride	affects cotreatment, increases abundance, increases expression	1
beta-methylcholine	affects expression	1
jinfukang	decreases expression	1
Leflunomide	decreases expression	1
Acetaminophen	increases expression	1
Air Pollutants	decreases expression, increases abundance	1
Arsenic	affects cotreatment, increases abundance, increases expression	1
Benzo(a)pyrene	affects methylation	1
Cadmium	decreases expression	1
Ethyl Methanesulfonate	increases expression	1
Manganese	affects cotreatment, increases abundance, increases expression	1
Methyl Methanesulfonate	increases expression	1
Dronabinol	decreases expression	1
Urethane	increases expression	1
Vanadates	increases expression	1
Sodium Selenite	decreases expression	1
Copper Sulfate	decreases expression	1
Lactic Acid	decreases expression	1
Particulate Matter	decreases expression, increases abundance	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.