CNTN2

Summary

CNTN2 (contactin 2, HGNC:2172) is a protein-coding gene on chromosome 1q32.1, encoding Contactin-2 (Q02246). In conjunction with another transmembrane protein, CNTNAP2, contributes to the organization of axonal domains at nodes of Ranvier by maintaining voltage-gated potassium channels at the juxtaparanodal region.

This gene encodes a member of the contactin family of proteins, part of the immunoglobulin superfamily of cell adhesion molecules. The encoded glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein plays a role in the proliferation, migration, and axon guidance of neurons of the developing cerebellum. A mutation in this gene may be associated with adult myoclonic epilepsy.

Source: NCBI Gene 6900 — RefSeq curated summary.

At a glance

• Gene–disease (curated): complex neurodevelopmental disorder (Definitive, ClinGen) — +2 more curated relationships
• GWAS associations: 21
• Clinical variants (ClinVar): 888 total — 26 pathogenic, 14 likely-pathogenic
• Phenotypes (HPO): 16
• MANE Select transcript: NM_005076

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2172
Approved symbol	CNTN2
Name	contactin 2
Location	1q32.1
Locus type	gene with protein product
Status	Approved
Aliases	TAG-1, TAX1
Ensembl gene	ENSG00000184144
Ensembl biotype	protein_coding
OMIM	190197
Entrez	6900

Gene structure

Transcript identifiers

Ensembl transcripts: 35 — 20 retained_intron, 7 protein_coding, 7 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

ENST00000331830, ENST00000481872, ENST00000525433, ENST00000527340, ENST00000530117, ENST00000530594, ENST00000532366, ENST00000636312, ENST00000636641, ENST00000636809, ENST00000638050, ENST00000638378, ENST00000638449, ENST00000638577, ENST00000638715, ENST00000638928, ENST00000638980, ENST00000639015, ENST00000639023, ENST00000639122, ENST00000639156, ENST00000639302, ENST00000639354, ENST00000639503, ENST00000639788, ENST00000639831, ENST00000639843, ENST00000639971, ENST00000640227, ENST00000640326, ENST00000640352, ENST00000640428, ENST00000640714, ENST00000853778, ENST00000853779

RefSeq mRNA: 2 — MANE Select: NM_005076 NM_001346083, NM_005076

CCDS: CCDS1449

Canonical transcript exons

ENST00000331830 — 23 exons

Exon	Start	End
ENSE00001075785	205057921	205058065
ENSE00001075789	205053100	205053255
ENSE00001075800	205058181	205058356
ENSE00001075801	205058568	205058663
ENSE00001298856	205073656	205078289
ENSE00003459538	205071947	205072133
ENSE00003459967	205065789	205065909
ENSE00003466962	205069491	205069561
ENSE00003471408	205070426	205070538
ENSE00003481198	205073068	205073236
ENSE00003496246	205065087	205065262
ENSE00003518522	205059583	205059682
ENSE00003545283	205067101	205067250
ENSE00003549347	205069827	205070061
ENSE00003554258	205059084	205059293
ENSE00003568730	205072483	205072595
ENSE00003570133	205061245	205061420
ENSE00003597317	205064322	205064472
ENSE00003628359	205066441	205066599
ENSE00003650006	205062440	205062569
ENSE00003678815	205064623	205064750
ENSE00003694352	205061865	205062001
ENSE00003805444	205043212	205043394

Expression profiles

Bgee: expression breadth ubiquitous, 190 present calls, max score 98.79.

FANTOM5 (CAGE): breadth broad, TPM avg 23.0165 / max 3639.9063, expressed in 277 samples.

FANTOM5 promoters (9 alternative TSS)

Promoter ID	TPM avg	Samples expressed
8013	17.3765	236
8012	4.2255	212
8014	0.4439	127
8011	0.3956	140
8016	0.1744	59
8017	0.1669	53
8010	0.1017	61
8015	0.0849	40
8009	0.0473	32

Top tissues by expression

290 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
inferior vagus X ganglion	UBERON:0005363	98.79	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	98.47	gold quality
corpus callosum	UBERON:0002336	98.30	gold quality
medial globus pallidus	UBERON:0002477	98.14	gold quality
globus pallidus	UBERON:0001875	97.89	gold quality
spinal cord	UBERON:0002240	97.89	gold quality
subthalamic nucleus	UBERON:0001906	97.86	gold quality
substantia nigra pars reticulata	UBERON:0001966	97.04	gold quality
ventral tegmental area	UBERON:0002691	96.76	gold quality
dorsal plus ventral thalamus	UBERON:0001897	96.58	gold quality
superior vestibular nucleus	UBERON:0007227	96.36	gold quality
lateral globus pallidus	UBERON:0002476	96.06	gold quality
pons	UBERON:0000988	96.03	gold quality
medulla oblongata	UBERON:0001896	95.66	gold quality
substantia nigra pars compacta	UBERON:0001965	95.66	gold quality
lateral nuclear group of thalamus	UBERON:0002736	95.13	gold quality
midbrain	UBERON:0001891	94.73	gold quality
substantia nigra	UBERON:0002038	94.49	gold quality
Ammon’s horn	UBERON:0001954	93.95	gold quality
putamen	UBERON:0001874	93.68	gold quality
amygdala	UBERON:0001876	92.81	gold quality
prefrontal cortex	UBERON:0000451	92.70	gold quality
postcentral gyrus	UBERON:0002581	92.64	gold quality
parietal lobe	UBERON:0001872	92.60	gold quality
inferior olivary complex	UBERON:0002127	92.58	gold quality
middle frontal gyrus	UBERON:0002702	92.47	gold quality
right frontal lobe	UBERON:0002810	92.33	gold quality
occipital lobe	UBERON:0002021	92.16	gold quality
caudate nucleus	UBERON:0001873	92.14	gold quality
Brodmann (1909) area 9	UBERON:0013540	92.07	gold quality

Single-cell (SCXA)

Detected in 7 experiment(s), a significant marker in 5.

Experiment	Marker?	Max mean expression
E-HCAD-56	yes	1273.55
E-MTAB-11121	yes	983.60
E-HCAD-25	yes	50.19
E-GEOD-84465	yes	14.10
E-ANND-3	yes	5.29
E-MTAB-7606	no	18.39
E-GEOD-124858	no	12.13

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): AP1, ATF1, ATF4, CEBPB, CEBPG, CREM, CTNNBL1, CUX1, EGR1, EGR2, ESR1, GLI2, HBP1, HNF4A, IER2, IRF4, JUN, MAF, MYB, MYBL2, MYOD1, NFIC, NFKB1, NFKB, NFKBIA, NR4A1, PAX1, PAX6, REL, RELA, RELB, SP1, SPI1, SSRP1, TAF1, TAL1, TBP, TCF12, TCF3, TP53

miRNA regulators (miRDB)

162 targeting CNTN2, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-4692	100.00	67.32	2066
HSA-MIR-4673	100.00	66.64	1490
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-4768-5P	100.00	69.49	2861
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-1193	100.00	65.93	529
HSA-MIR-4514	99.99	67.10	1870
HSA-MIR-34A-5P	99.99	71.21	1784
HSA-MIR-449A	99.99	71.05	1776
HSA-MIR-6077	99.99	68.04	2299
HSA-MIR-4645-5P	99.98	65.81	1284
HSA-MIR-34C-5P	99.97	70.45	1577
HSA-MIR-449B-5P	99.97	70.26	1580
HSA-MIR-4267	99.96	66.53	2368
HSA-MIR-5688	99.96	73.23	4504
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-495-3P	99.96	72.81	4197
HSA-MIR-3658	99.96	73.87	4379
HSA-MIR-185-3P	99.95	67.01	1743
HSA-MIR-7-1-3P	99.91	71.53	4384
HSA-MIR-7-2-3P	99.91	71.40	4394
HSA-MIR-95-5P	99.89	72.17	3973
HSA-MIR-4731-5P	99.89	67.23	2537
HSA-MIR-4271	99.88	68.32	2244
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-548D-3P	99.87	70.67	4362
HSA-MIR-548BB-3P	99.86	70.58	4354

Literature-anchored findings (GeneRIF, showing 19)

• The domains responsible for the neurite outgrowth promoting activity of TAG-1 have been investigated as well as its interactions with other cell adhesion molecules. (PMID:12139915)
• TAG-1 homophilic interaction is based on dimer formation rather than formation of a molecular zipper as proposed for the chicken ortholog. (PMID:17766378)
• Contactin-2 is expressed by various neuronal populations and sequestered in the juxtaparanodal domain of myelinated axons both at the axonal and myelin sides; is an autoantigen targeted by T cells and autoantibodies in MS. (PMID:19416878)
• immune response to CNTN2 and possible involvement in multiple sclerosis and EAE [REVIEW] (PMID:19451620)
• single nucleotide polymorphisms in TAG-1 are related to the IVIg responsiveness of Chronic inflammatory demyelinating polyneuropathy patients. (PMID:21696500)
• allelic variation in TAG-1 does not play a major role in determining multifocal motor neuropathy susceptibility. (PMID:22003931)
• The single-nucleotide polymorphism (SNP) rs2275697 in the TAG-) gene was not associated with treatment responsiveness, treatment dependence, disability, or mortality in chronic inflammatory demyelinating polyneuropathy (PMID:22462668)
• A single nucleotide deletion in exon 6 of CNTN2 results in a frameshift mutation, segregating in a recessive manner in a consanguineous Egyptian family with epilepsy. (PMID:23518707)
• Our results clearly demonstrate that mouse and human contactin-2 are physiological substrates for BACE1 (PMID:24405708)
• RACK1 interacts with CNTN2, and the effects of RACK1 on glioma cell growth and differentiation are mediated by CNTN2. (PMID:26718491)
• the ectodomains of CNTNAP2 and contactin 2 (CNTN2) bind directly and specifically, with low nanomolar affinity. (PMID:27621318)
• the selective distribution of Caspr2 and TAG-1 may be regulated, allowing them to modulate the strategic function of the Kv1 complex along axons (PMID:28533267)
• The strongest associations between protein abundance and Alzheimer’s disease severity were found for APLP1, CNTN2 and SPP1 proteins (PMID:29684683)
• The data of this study reveal that the contactin-2 changes observed in tissues are reflected in CSF, suggesting that decreased contactin-2 CSF levels might be a biomarker reflecting synaptic or axonal loss. (PMID:29859129)
• Cord blood exosomal CNTN2 is an attractive candidate for further determination as a molecular marker for neonates at risk for brain iron deficiency, particularly for male neonates. (PMID:31623079)
• Contactin-1 Is Reduced in Cerebrospinal Fluid of Parkinson’s Disease Patients and Is Present within Lewy Bodies. (PMID:32806791)
• The molecular mechanism of gamma-aminobutyric acid against AD: the role of CEBPalpha/circAPLP2/miR-671-5p in regulating CNTN1/2 expression. (PMID:36734072)
• Assessment of Bcl-xL, TAX, and HBZ Gene Expression in Adult T cell Leukemia/Lymphoma Patients. (PMID:37565279)
• Gene-gene interaction network analysis indicates CNTN2 is a candidate gene for idiopathic generalized epilepsy. (PMID:38460076)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	robo4	ENSDARG00000009387
mus_musculus	Cntn2	ENSMUSG00000053024
rattus_norvegicus	Cntn2	ENSRNOG00000009033

Paralogs (36): CNTN1 (ENSG00000018236), CDON (ENSG00000064309), NEO1 (ENSG00000067141), SDK2 (ENSG00000069188), IGSF9B (ENSG00000080854), IGSF9 (ENSG00000085552), NRCAM (ENSG00000091129), MXRA5 (ENSG00000101825), IGDCC4 (ENSG00000103742), CNTN3 (ENSG00000113805), IGSF21 (ENSG00000117154), CNTN6 (ENSG00000134115), CHL1 (ENSG00000134121), PTPRQ (ENSG00000139304), CNTN4 (ENSG00000144619), BOC (ENSG00000144857), SDK1 (ENSG00000146555), HMCN2 (ENSG00000148357), NCAM1 (ENSG00000149294), CNTN5 (ENSG00000149972), IGSF10 (ENSG00000152580), ROBO4 (ENSG00000154133), ROBO3 (ENSG00000154134), NCAM2 (ENSG00000154654), VCAM1 (ENSG00000162692), NFASC (ENSG00000163531), PRTG (ENSG00000166450), ROBO1 (ENSG00000169855), DSCAM (ENSG00000171587), IGDCC3 (ENSG00000174498), VSIG10 (ENSG00000176834), DSCAML1 (ENSG00000177103), ROBO2 (ENSG00000185008), VSIG10L (ENSG00000186806), DCC (ENSG00000187323), L1CAM (ENSG00000198910)

Protein

Protein identifiers

Contactin-2 — Q02246 (reviewed: Q02246)

Alternative names: Axonal glycoprotein TAG-1, Axonin-1, Transient axonal glycoprotein 1

All UniProt accessions (8): A0A1B0GTL7, A0A1W2PPQ9, A0A1W2PPY1, A0A1W2PQ11, A0A1W2PQ86, A0A1W2PQJ4, A0A1W2PR60, Q02246

UniProt curated annotations — full annotation on UniProt →

Function. In conjunction with another transmembrane protein, CNTNAP2, contributes to the organization of axonal domains at nodes of Ranvier by maintaining voltage-gated potassium channels at the juxtaparanodal region. May be involved in cell adhesion.

Subcellular location. Cell membrane.

Disease relevance. Epilepsy, early-onset, 5, with or without developmental delay (EPEO5) [MIM:615400] An autosomal recessive neurologic disorder characterized by a combination of various seizure types with onset in the first decade of life or during adolescence. Most patients have developmental delay, impaired intellectual development, and behavioral abnormalities. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the immunoglobulin superfamily. Contactin family.

RefSeq proteins (2): NP_001333012, NP_005067* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR003598	Ig_sub2	Domain
IPR003599	Ig_sub	Domain
IPR003961	FN3_dom	Domain
IPR007110	Ig-like_dom	Domain
IPR013098	Ig_I-set	Domain
IPR013783	Ig-like_fold	Homologous_superfamily
IPR036116	FN3_sf	Homologous_superfamily
IPR036179	Ig-like_dom_sf	Homologous_superfamily
IPR047102	Contactin-1_2_Ig1	Domain

Pfam: PF00041, PF07679, PF13927

UniProt features (100 total): strand 58, glycosylation site 11, domain 10, helix 5, disulfide bond 4, sequence variant 4, region of interest 2, signal peptide 1, chain 1, short sequence motif 1, lipid moiety-binding region 1, propeptide 1, turn 1

Structure

Experimental structures (PDB)

5 structures.

PDB	Method	Resolution (Å)
2OM5	X-RAY DIFFRACTION	3.07
8K3J	ELECTRON MICROSCOPY	3.3
9BA5	ELECTRON MICROSCOPY	3.51
9BA4	ELECTRON MICROSCOPY	3.54
8K53	ELECTRON MICROSCOPY	3.8

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q02246-F1	86.13	0.58

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 1012

Disulfide bonds (4): 61–111, 155–207, 261–306, 348–395

Glycosylation sites (11): 76, 198, 204, 461, 477, 498, 525, 830, 904, 918, 940

Function

Pathways and Gene Ontology

Reactome pathways

3 pathways

ID	Pathway
R-HSA-373760	L1CAM interactions
R-HSA-419037	NCAM1 interactions
R-HSA-447038	NrCAM interactions

MSigDB gene sets: 0 (showing top):

GO Biological Process (32): microtubule cytoskeleton organization (GO:0000226), G protein-coupled adenosine receptor signaling pathway (GO:0001973), reduction of food intake in response to dietary excess (GO:0002023), cell adhesion (GO:0007155), homophilic cell-cell adhesion (GO:0007156), axon guidance (GO:0007411), axonal fasciculation (GO:0007413), learning (GO:0007612), adult walking behavior (GO:0007628), positive regulation of protein processing (GO:0010954), protein processing (GO:0016485), cerebral cortex GABAergic interneuron migration (GO:0021853), central nervous system myelination (GO:0022010), regulation of cell morphogenesis (GO:0022604), regulation of axon diameter (GO:0031133), receptor internalization (GO:0031623), clustering of voltage-gated potassium channels (GO:0045163), fat cell differentiation (GO:0045444), negative regulation of neuron differentiation (GO:0045665), regulation of neuronal synaptic plasticity (GO:0048168), regulation of astrocyte differentiation (GO:0048710), synapse organization (GO:0050808), establishment of localization in cell (GO:0051649), positive regulation of adenosine receptor signaling pathway (GO:0060168), dendrite self-avoidance (GO:0070593), protein localization to juxtaparanode region of axon (GO:0071205), establishment of protein localization to juxtaparanode region of axon (GO:0071206), presynaptic membrane organization (GO:0097090), neuron migration (GO:0001764), response to dietary excess (GO:0002021), central nervous system neuron differentiation (GO:0021953), neuron projection development (GO:0031175)

GO Molecular Function (4): carbohydrate binding (GO:0030246), cell-cell adhesion mediator activity (GO:0098632), protein binding (GO:0005515), cell adhesion mediator activity (GO:0098631)

GO Cellular Component (13): plasma membrane (GO:0005886), cell surface (GO:0009986), axon (GO:0030424), node of Ranvier (GO:0033268), neuronal cell body (GO:0043025), axon initial segment (GO:0043194), myelin sheath (GO:0043209), juxtaparanode region of axon (GO:0044224), synapse (GO:0045202), postsynaptic membrane (GO:0045211), side of membrane (GO:0098552), membrane (GO:0016020), neuron projection (GO:0043005)

Reactome top-level categories

Rollup of top-3 pathways:

Category	Pathways
Axon guidance	1
NCAM signaling for neurite out-growth	1
L1CAM interactions	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	7
main axon	3
cell-cell adhesion	2
binding	2
membrane	2
cytoskeleton organization	1
microtubule-based process	1
G protein-coupled purinergic receptor signaling pathway	1
response to dietary excess	1
eating behavior	1
cellular process	1
axonogenesis	1
neuron projection guidance	1
neuron recognition	1
axon development	1
neuron projection fasciculation	1
learning or memory	1
adult locomotory behavior	1
walking behavior	1
protein processing	1
positive regulation of proteolysis	1
regulation of protein processing	1
positive regulation of protein maturation	1
proteolysis	1
protein maturation	1
interneuron migration from the subpallium to the cortex	1
cerebral cortex GABAergic interneuron development	1
interneuron migration	1
oligodendrocyte development	1
axon ensheathment in central nervous system	1
myelination	1
cell morphogenesis	1
regulation of anatomical structure morphogenesis	1
regulation of cell projection size	1
regulation of axonogenesis	1
receptor-mediated endocytosis	1
neuronal ion channel clustering	1
cell differentiation	1
neuron differentiation	1
negative regulation of cell differentiation	1

Protein interactions and networks

STRING

0 interactions, top by confidence (×1000):

IntAct

8 interactions, top by confidence:

A	B	Type	Score
APP	CNTN2	psi-mi:“MI:0915”(physical association)	0.560
EGFR	CNTN2	psi-mi:“MI:0915”(physical association)	0.550
CNTN2	EGFR	psi-mi:“MI:0915”(physical association)	0.550
CNTN2	MAP3K7	psi-mi:“MI:0915”(physical association)	0.400
CNTN2	RTCA	psi-mi:“MI:0914”(association)	0.350

BioGRID (24): CNTN2 (Affinity Capture-Western), CNTN2 (Affinity Capture-Western), CHEK1 (Affinity Capture-Western), CHEK1 (Reconstituted Complex), CNTN2 (Reconstituted Complex), CNTNAP2 (Affinity Capture-Western), CNTN2 (Affinity Capture-Western), CNTN2 (Affinity Capture-Western), CNTN2 (Affinity Capture-Western), UBE4B (Affinity Capture-Western), CNTN2 (Affinity Capture-Western), CNTN2 (Affinity Capture-Western), CNTN2 (Biochemical Activity), RTCA (Affinity Capture-MS), CSPG4 (Affinity Capture-MS)

ESM2 similar proteins: A2A8L5, A4IFW2, A7MBJ4, B0V2N1, F1NWE3, O00533, O42414, O55005, O89026, O94856, O97394, P10586, P11627, P16621, P22063, P23468, P28685, P32004, P70232, P97685, P97686, Q02246, Q05695, Q13332, Q28902, Q2EY14, Q2EY15, Q2VWP7, Q2VWP9, Q3UH53, Q589G5, Q58EX2, Q61330, Q64487, Q64604, Q64605, Q6V4S5, Q7Z5N4, Q810U3, Q810U4

Diamond homologs: A0N0X6, A2AJ76, A2CG49, A4IGL7, A4IIW9, B3NS99, B4GBH0, B4HNW4, B4KPU0, B4MR28, B4P5Q9, B4QC63, G5EBF1, O75325, O95428, P0C6S8, P11627, P12960, P22063, P28685, P32004, P97924, Q02246, Q07409, Q09024, Q12860, Q290N5, Q32Q07, Q3UQ28, Q3URE9, Q3V1M1, Q5R482, Q61330, Q61809, Q62682, Q62845, Q63198, Q66HV9, Q69Z26, Q6AWJ9

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

888 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	26
Likely pathogenic	14
Uncertain significance	364
Likely benign	425
Benign	29

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1069884	NM_005076.5(CNTN2):c.2587C>T (p.Arg863Ter)	Pathogenic
1367262	NM_005076.5(CNTN2):c.2773del (p.Ser925fs)	Pathogenic
1406570	NM_005076.5(CNTN2):c.1180C>T (p.Gln394Ter)	Pathogenic
1424788	NM_005076.5(CNTN2):c.2740C>T (p.Arg914Ter)	Pathogenic
1456315	NM_005076.5(CNTN2):c.2697dup (p.Ser900fs)	Pathogenic
1526248	NM_005076.5(CNTN2):c.1699G>T (p.Glu567Ter)	Pathogenic
2111360	NM_005076.5(CNTN2):c.851G>A (p.Trp284Ter)	Pathogenic
2425292	NC_000001.10:g.(?205022314)(205042893_?)del	Pathogenic
2577932	NM_005076.5(CNTN2):c.1748_1749delinsC (p.Gly583fs)	Pathogenic
2767108	NM_005076.5(CNTN2):c.1327dup (p.Arg443fs)	Pathogenic
2808573	NM_005076.5(CNTN2):c.2081_2099del (p.Gly694fs)	Pathogenic
2809835	NM_005076.5(CNTN2):c.124C>T (p.Gln42Ter)	Pathogenic
2826422	NM_005076.5(CNTN2):c.766C>T (p.Gln256Ter)	Pathogenic
2826844	NM_005076.5(CNTN2):c.2067_2068del (p.Ile690fs)	Pathogenic
2888349	NM_005076.5(CNTN2):c.159_160delinsTT (p.Glu54Ter)	Pathogenic
3233305	NM_005076.5(CNTN2):c.2874_2875del (p.Pro959fs)	Pathogenic
3638617	NM_005076.5(CNTN2):c.1884G>A (p.Trp628Ter)	Pathogenic
3661528	NM_005076.5(CNTN2):c.1696A>T (p.Lys566Ter)	Pathogenic
3701041	NM_005076.5(CNTN2):c.1711del (p.Asp571fs)	Pathogenic
3727307	NM_005076.5(CNTN2):c.943_944del (p.Asp315fs)	Pathogenic
4712628	NM_005076.5(CNTN2):c.247G>T (p.Glu83Ter)	Pathogenic
4717459	NM_005076.5(CNTN2):c.1048_1049del (p.Ala350fs)	Pathogenic
4736591	NM_005076.5(CNTN2):c.22A>T (p.Lys8Ter)	Pathogenic
541408	NM_005076.5(CNTN2):c.586C>T (p.Arg196Ter)	Pathogenic
64618	NM_005076.5(CNTN2):c.504del (p.Trp168fs)	Pathogenic
992243	NM_005076.5(CNTN2):c.940C>T (p.Arg314Ter)	Pathogenic
1068043	NM_005076.5(CNTN2):c.2731+1G>A	Likely pathogenic
1468336	NM_005076.5(CNTN2):c.1695+2T>C	Likely pathogenic
1484408	NM_005076.5(CNTN2):c.1240+1G>A	Likely pathogenic
1515118	NM_005076.5(CNTN2):c.2126-1G>C	Likely pathogenic

SpliceAI

3653 predictions. Top by Δscore:

Variant	Effect	Δscore
1:205053251:TTCAG:T	donor_loss	1.0000
1:205053252:TCAGG:T	donor_loss	1.0000
1:205053253:CAGG:C	donor_loss	1.0000
1:205053254:AGGTA:A	donor_loss	1.0000
1:205053255:GGT:G	donor_loss	1.0000
1:205053256:G:A	donor_loss	1.0000
1:205053257:T:G	donor_loss	1.0000
1:205058278:G:GT	donor_gain	1.0000
1:205058314:G:GG	donor_gain	1.0000
1:205058334:G:GT	donor_gain	1.0000
1:205058335:G:T	donor_gain	1.0000
1:205058357:G:GG	donor_gain	1.0000
1:205058566:A:AG	acceptor_gain	1.0000
1:205058567:G:GA	acceptor_gain	1.0000
1:205058660:CCAGG:C	donor_loss	1.0000
1:205058661:CAGGT:C	donor_loss	1.0000
1:205058662:AGGT:A	donor_loss	1.0000
1:205058663:GGT:G	donor_loss	1.0000
1:205058665:T:A	donor_loss	1.0000
1:205059289:TGAAG:T	donor_loss	1.0000
1:205059291:AAGG:A	donor_loss	1.0000
1:205059292:AGGT:A	donor_loss	1.0000
1:205059294:G:C	donor_loss	1.0000
1:205059295:T:G	donor_loss	1.0000
1:205059581:A:AG	acceptor_gain	1.0000
1:205059582:G:GG	acceptor_gain	1.0000
1:205059678:GGGAA:G	donor_gain	1.0000
1:205059679:GGAA:G	donor_gain	1.0000
1:205059679:GGAAG:G	donor_gain	1.0000
1:205059680:G:GT	donor_gain	1.0000

AlphaMissense

6748 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:205058184:G:C	W73C	1.000
1:205058184:G:T	W73C	1.000
1:205058290:T:G	Y109D	1.000
1:205061266:G:C	W273C	1.000
1:205061266:G:T	W273C	1.000
1:205061971:G:C	W360C	1.000
1:205061971:G:T	W360C	1.000
1:205062506:T:G	Y393D	1.000
1:205065197:T:A	W544R	1.000
1:205065197:T:C	W544R	1.000
1:205065199:G:C	W544C	1.000
1:205065199:G:T	W544C	1.000
1:205066583:G:C	W653C	1.000
1:205066583:G:T	W653C	1.000
1:205058182:T:A	W73R	0.999
1:205058182:T:C	W73R	0.999
1:205058183:G:C	W73S	0.999
1:205058249:T:C	L95P	0.999
1:205058639:T:C	C155R	0.999
1:205058640:G:A	C155Y	0.999
1:205059098:T:A	W168R	0.999
1:205059098:T:C	W168R	0.999
1:205059100:G:C	W168C	0.999
1:205059100:G:T	W168C	0.999
1:205059171:T:C	L192P	0.999
1:205059217:T:G	C207W	0.999
1:205061264:T:A	W273R	0.999
1:205061264:T:C	W273R	0.999
1:205061377:C:A	N310K	0.999
1:205061377:C:G	N310K	0.999

dbSNP variants (sampled 300 via entrez): RS1000023507 (1:205044723 C>T), RS1000054487 (1:205044461 G>A,C,T), RS1000140661 (1:205070291 TG>T,TGG), RS1000169856 (1:205052475 G>A), RS1000324930 (1:205067894 C>T), RS1000427401 (1:205074196 G>A), RS1000518848 (1:205063167 C>T), RS1000568245 (1:205065582 GAAACAAACTTTGCTGTTTAGTCCCCAGTGGTTC>G), RS1000655624 (1:205068069 G>T), RS1000703068 (1:205075974 G>A), RS1000781069 (1:205063747 G>T), RS1000910455 (1:205045049 CTGA>C), RS1000985790 (1:205075042 T>A), RS1001050302 (1:205056290 C>T), RS1001128812 (1:205075551 A>G)

Disease associations

OMIM: gene MIM:190197 | disease phenotypes: MIM:615400, MIM:616875, MIM:601068

GenCC curated gene-disease

Disease	Classification	Inheritance
epilepsy, familial adult myoclonic, 5	Strong	Autosomal recessive
benign adult familial myoclonic epilepsy	Supportive	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
complex neurodevelopmental disorder	Definitive	AR

Mondo (5): epilepsy, familial adult myoclonic, 5 (MONDO:0014167), complex neurodevelopmental disorder (MONDO:0100038), cerebellar atrophy, visual impairment, and psychomotor retardation; (MONDO:0014811), epilepsy, familial adult myoclonic, 1 (MONDO:0010985), benign adult familial myoclonic epilepsy (MONDO:0019448)

Orphanet (2): Familial adult myoclonic epilepsy (Orphanet:86814), Non-specific syndromic intellectual disability (Orphanet:528084)

HPO phenotypes

16 total (16 of 16 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0001249	Intellectual disability
HP:0001336	Myoclonus
HP:0001337	Tremor
HP:0002069	Bilateral tonic-clonic seizure
HP:0002197	Generalized-onset seizure
HP:0002315	Headache
HP:0002353	EEG abnormality
HP:0002378	Hand tremor
HP:0002384	Focal impaired awareness seizure
HP:0003621	Juvenile onset
HP:0007359	Focal-onset seizure
HP:0011165	Focal sensory seizure with visual features
HP:0011182	Interictal epileptiform activity
HP:0033715	Hippocampal sclerosis
HP:0100576	Amaurosis fugax

GWAS associations

21 associations (top):

Study	Trait	p-value
GCST002184_3	Mean platelet volume	3.000000e-13
GCST004601_9	Red blood cell count	2.000000e-12
GCST006585_1612	Blood protein levels	1.000000e-67
GCST007201_14	Schizophrenia	9.000000e-07
GCST007201_450	Schizophrenia	3.000000e-06
GCST007324_165	Adventurousness	2.000000e-11
GCST007326_55	Number of sexual partners	3.000000e-09
GCST010143_34	Meat-related diet	1.000000e-08
GCST010143_9	Meat-related diet	4.000000e-11
GCST010242_93	HDL cholesterol levels	3.000000e-08
GCST010697_12	Cortical surface area (min-P)	6.000000e-10
GCST010698_16	Subcortical volume (min-P)	8.000000e-09
GCST010699_52	Brain morphology (min-P)	5.000000e-08
GCST010700_66	Cortical thickness (MOSTest)	3.000000e-09
GCST010701_17	Cortical surface area (MOSTest)	5.000000e-08
GCST010702_2	Subcortical volume (MOSTest)	3.000000e-08
GCST010703_27	Brain morphology (MOSTest)	5.000000e-09
GCST012245_4	Periodontitis (stage III/IV grade C)	3.000000e-06
GCST90011899_38	Aspartate aminotransferase levels	1.000000e-17
GCST90020025_1241	Waist-to-hip ratio adjusted for BMI	3.000000e-10
GCST90020027_1929	Waist-hip index	8.000000e-10

EFO canonical traits (8, from GWAS)

EFO ID	Trait name
EFO:0004305	erythrocyte count
EFO:0008579	risk-taking behaviour
EFO:0008111	diet measurement
EFO:0004612	high density lipoprotein cholesterol measurement
EFO:0004346	neuroimaging measurement
EFO:0004840	cortical thickness
EFO:0004736	aspartate aminotransferase measurement
EFO:0007788	BMI-adjusted waist-hip ratio

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
C563399	Epilepsy, Myoclonic, Benign Adult Familial, Type 1 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

27 total (human), top 27 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, decreases expression, affects expression, increases methylation	8
trichostatin A	affects cotreatment, decreases expression	3
mercuric bromide	affects cotreatment, decreases expression	2
Panobinostat	affects cotreatment, decreases expression	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
p-Chloromercuribenzoic Acid	affects cotreatment, decreases expression	2
aristolochic acid I	increases expression	1
methylmercuric chloride	decreases expression	1
sodium arsenate	decreases expression	1
decabromobiphenyl ether	increases expression	1
sodium arsenite	decreases expression	1
tetrabromobisphenol A	increases expression	1
tetrachlorodian	increases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, decreases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	increases expression	1
dorsomorphin	affects cotreatment, decreases expression	1
licochalcone B	increases expression	1
Decitabine	affects expression	1
Benzo(a)pyrene	affects methylation	1
Diethylhexyl Phthalate	decreases expression	1
Folic Acid	decreases expression	1
Lead	affects expression	1
Rotenone	decreases expression	1
Thiram	increases expression	1
Triclosan	increases expression	1
Copper Sulfate	increases expression	1
Acrylamide	decreases expression	1

Clinical trials (associated diseases)

2 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT06310681	Not specified	COMPLETED	Pilot Testing of a Co-adapted Group Programme for Parents/Carers of Children With Complex Neurodisability
NCT07303049	Not specified	NOT_YET_RECRUITING	Cognitive Benefit of Intensive Rehabilitation Using Rhythmic Music Training in Children With Complex Neurodevelopmental Disorder