COQ8A

Summary

COQ8A (coenzyme Q8A, HGNC:16812) is a protein-coding gene on chromosome 1q42.13, encoding Atypical kinase COQ8A, mitochondrial (Q8NI60). Atypical kinase involved in the biosynthesis of coenzyme Q, also named ubiquinone, an essential lipid-soluble electron transporter for aerobic cellular respiration.

This gene encodes a mitochondrial protein similar to yeast ABC1, which functions in an electron-transferring membrane protein complex in the respiratory chain. It is not related to the family of ABC transporter proteins. Expression of this gene is induced by the tumor suppressor p53 and in response to DNA damage, and inhibiting its expression partially suppresses p53-induced apoptosis. Alternatively spliced transcript variants have been found; however, their full-length nature has not been determined.

Source: NCBI Gene 56997 — RefSeq curated summary.

At a glance

• Gene–disease (curated): coenzyme Q10 deficiency (Definitive, GenCC) — +1 more curated relationship
• GWAS associations: 21
• Clinical variants (ClinVar): 825 total — 53 pathogenic, 47 likely-pathogenic
• Phenotypes (HPO): 38
• Druggable target: yes — 14 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_020247

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:16812
Approved symbol	COQ8A
Name	coenzyme Q8A
Location	1q42.13
Locus type	gene with protein product
Status	Approved
Aliases	COQ8, SCAR9
Ensembl gene	ENSG00000163050
Ensembl biotype	protein_coding
OMIM	606980
Entrez	56997

Gene structure

Transcript identifiers

Ensembl transcripts: 77 — 72 protein_coding, 5 protein_coding_CDS_not_defined

ENST00000366777, ENST00000366778, ENST00000476488, ENST00000478406, ENST00000479852, ENST00000485462, ENST00000489044, ENST00000873690, ENST00000873691, ENST00000873692, ENST00000873693, ENST00000873694, ENST00000873695, ENST00000873696, ENST00000873697, ENST00000873698, ENST00000873699, ENST00000873700, ENST00000873701, ENST00000873702, ENST00000873703, ENST00000873704, ENST00000873705, ENST00000873706, ENST00000873707, ENST00000873708, ENST00000873709, ENST00000873710, ENST00000873711, ENST00000873712, ENST00000873713, ENST00000873714, ENST00000873715, ENST00000873716, ENST00000873717, ENST00000873718, ENST00000873719, ENST00000873720, ENST00000873721, ENST00000912836, ENST00000912837, ENST00000912838, ENST00000912839, ENST00000950267, ENST00000950268, ENST00000950269, ENST00000950270, ENST00000950271, ENST00000950272, ENST00000950273, ENST00000950274, ENST00000950275, ENST00000950276, ENST00000950277, ENST00000950278, ENST00000950279, ENST00000950280, ENST00000950281, ENST00000950282, ENST00000950283, ENST00000950284, ENST00000950285, ENST00000950286, ENST00000950287, ENST00000950288, ENST00000950289, ENST00000950290, ENST00000950291, ENST00000950292, ENST00000950293, ENST00000950294, ENST00000950295, ENST00000950296, ENST00000950297, ENST00000950298, ENST00000950299, ENST00000950300

RefSeq mRNA: 1 — MANE Select: NM_020247 NM_020247

CCDS: CCDS1557

Canonical transcript exons

ENST00000366777 — 15 exons

Exon	Start	End
ENSE00001442588	226940294	226940399
ENSE00003478570	226986453	226987544
ENSE00003484517	226984876	226984941
ENSE00003501755	226982678	226982763
ENSE00003507175	226983552	226983633
ENSE00003523471	226984548	226984655
ENSE00003534044	226984094	226984235
ENSE00003553064	226977449	226977523
ENSE00003561805	226965000	226965410
ENSE00003581102	226982027	226982149
ENSE00003587494	226983761	226983854
ENSE00003597680	226965671	226965737
ENSE00003615429	226985254	226985340
ENSE00003663561	226982894	226983034
ENSE00003909988	226961377	226961562

Expression profiles

Bgee: expression breadth ubiquitous, 134 present calls, max score 99.61.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 14.8672 / max 472.8238, expressed in 1721 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
8890	12.0974	1662
8891	1.6138	572
8889	0.6706	426
8893	0.3371	105
8894	0.1483	42

Top tissues by expression

134 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
gastrocnemius	UBERON:0001388	99.61	gold quality
skeletal muscle tissue	UBERON:0001134	99.43	gold quality
hindlimb stylopod muscle	UBERON:0004252	99.33	gold quality
muscle of leg	UBERON:0001383	99.15	gold quality
apex of heart	UBERON:0002098	98.80	gold quality
body of pancreas	UBERON:0001150	98.40	gold quality
heart left ventricle	UBERON:0002084	98.40	gold quality
right adrenal gland	UBERON:0001233	98.39	gold quality
right adrenal gland cortex	UBERON:0035827	98.31	gold quality
left adrenal gland	UBERON:0001234	98.10	gold quality
left adrenal gland cortex	UBERON:0035825	97.80	gold quality
right atrium auricular region	UBERON:0006631	97.35	gold quality
fundus of stomach	UBERON:0001160	97.07	gold quality
body of stomach	UBERON:0001161	96.99	gold quality
right lobe of liver	UBERON:0001114	96.58	gold quality
heart	UBERON:0000948	96.54	gold quality
cerebellar hemisphere	UBERON:0002245	96.54	gold quality
cerebellum	UBERON:0002037	96.48	gold quality
cerebellar cortex	UBERON:0002129	96.47	gold quality
muscle tissue	UBERON:0002385	96.41	gold quality
right hemisphere of cerebellum	UBERON:0014890	96.41	gold quality
adrenal gland	UBERON:0002369	96.40	gold quality
subcutaneous adipose tissue	UBERON:0002190	96.17	gold quality
right uterine tube	UBERON:0001302	95.83	gold quality
left ovary	UBERON:0002119	95.71	gold quality
right ovary	UBERON:0002118	95.68	gold quality
lower esophagus muscularis layer	UBERON:0035833	95.48	gold quality
lower esophagus	UBERON:0013473	95.43	gold quality
ovary	UBERON:0000992	95.30	gold quality
stomach	UBERON:0000945	95.23	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-MTAB-6142	no	154.32
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): SP1, ZBTB4

miRNA regulators (miRDB)

27 targeting COQ8A, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-188-3P	100.00	68.76	1240
HSA-MIR-4510	100.00	66.60	2050
HSA-MIR-6127	100.00	66.76	2188
HSA-MIR-6129	100.00	66.46	2080
HSA-MIR-6130	100.00	66.69	2012
HSA-MIR-6133	100.00	66.48	2064
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-493-5P	99.96	72.47	2382
HSA-LET-7C-3P	99.95	73.42	2862
HSA-LET-7A-2-3P	99.87	70.53	1921
HSA-MIR-3151-5P	99.86	63.83	1069
HSA-LET-7G-3P	99.85	70.43	1929
HSA-MIR-4306	99.72	70.50	3630
HSA-MIR-3202	99.66	67.70	2737
HSA-MIR-4804-3P	99.65	67.78	866
HSA-MIR-510-3P	99.54	70.06	2965
HSA-MIR-543	99.52	69.03	2595
HSA-MIR-185-5P	99.35	68.60	2497
HSA-MIR-452-3P	99.01	66.25	1241
HSA-MIR-6784-3P	98.39	64.88	662
HSA-MIR-6842-3P	98.07	66.33	1325
HSA-MIR-6862-3P	97.92	64.86	531
HSA-MIR-3652	97.71	65.43	1890
HSA-MIR-4430	97.47	65.61	1813
HSA-MIR-214-5P	97.34	66.50	617
HSA-MIR-4653-3P	96.26	67.03	725
HSA-MIR-4442	92.35	67.08	98

Literature-anchored findings (GeneRIF, showing 12)

• play an important role in mediating p53-inducible apoptosis through the mitochondrial pathway. (PMID:11888884)
• CABC1 gene mutations in four ubiquinone-deficient patients in three distinct families were reported. (PMID:18319072)
• Five additional mutations in ADCK3 were found in three patients with sporadic ataxia, including one known to have CoQ10 deficiency in muscle. (PMID:18319074)
• These observations highlight the importance of screening for a potentially treatable cause, CABC1/ADCK3 mutations (PMID:22036850)
• a structural foundation for investigating the role of transmembrane association in regulating the biological activity of ADCK3 (PMID:25216398)
• Mitochondrial ADCK3 employs an atypical protein kinase-like fold to enable coenzyme Q biosynthesis. (PMID:25498144)
• work reveals Mg(2+)-dependent ATPase activity of ADCK3, providing strong support for the theoretical prediction of this protein being a functional atypical kinase. (PMID:25540914)
• ADCK3/COQ8 localises to mitochondrial cristae and is targeted to this organelle via the presence of an N-terminal localisation signal (PMID:26866375)
• Loss of COQ8a results in cerebellar ataxia and coenzyme Q deficiency. (PMID:27499294)
• expand the clinical, molecular and biochemical spectrum of ADCK3 related CoQ10 deficiencies (PMID:30968303)
• Clinico-Genetic, Imaging and Molecular Delineation of COQ8A-Ataxia: A Multicenter Study of 59 Patients. (PMID:32337771)
• Photoparoxysmal response in ADCK3 autosomal recessive ataxia: a case report and literature review. (PMID:33622667)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	coq8aa	ENSDARG00000020123
danio_rerio	coq8ab	ENSDARG00000032426
mus_musculus	Coq8a	ENSMUSG00000026489
rattus_norvegicus	Coq8a	ENSRNOG00000043201

Paralogs (4): ADCK1 (ENSG00000063761), COQ8B (ENSG00000123815), ADCK2 (ENSG00000133597), ADCK5 (ENSG00000173137)

Protein

Protein identifiers

Atypical kinase COQ8A, mitochondrial — Q8NI60 (reviewed: Q8NI60)

Alternative names: Chaperone activity of bc1 complex-like, Coenzyme Q protein 8A, aarF domain-containing protein kinase 3

All UniProt accessions (1): Q8NI60

UniProt curated annotations — full annotation on UniProt →

Function. Atypical kinase involved in the biosynthesis of coenzyme Q, also named ubiquinone, an essential lipid-soluble electron transporter for aerobic cellular respiration. Its substrate specificity is still unclear: may act as a protein kinase that mediates phosphorylation of COQ3. According to other reports, acts as a small molecule kinase, possibly a lipid kinase that phosphorylates a prenyl lipid in the ubiquinone biosynthesis pathway, as suggested by its ability to bind coenzyme Q lipid intermediates. However, the small molecule kinase activity was not confirmed by another publication. Shows an unusual selectivity for binding ADP over ATP.

Subunit / interactions. Homodimer; homodimerizes via its transmembrane region. Interacts with the multi-subunit COQ enzyme complex, composed of at least COQ3, COQ4, COQ5, COQ6, COQ7 and COQ9.

Subcellular location. Mitochondrion membrane.

Tissue specificity. Widely expressed, with highest levels in adrenal gland, heart, pancreas, nasal mucosa, stomach, uterus and skeletal muscle.

Disease relevance. Coenzyme Q10 deficiency, primary, 4 (COQ10D4) [MIM:612016] An autosomal recessive disorder characterized by childhood-onset of cerebellar ataxia and exercise intolerance. Patient manifest gait ataxia and cerebellar atrophy with slow progression. Additional features include brisk tendon reflexes and Hoffmann sign, variable psychomotor retardation and variable seizures. The disease is caused by variants affecting the gene represented in this entry.

Activity regulation. Autoinhibited by the N-terminal domain, containing the KxGQ motif, that completely occludes the typical substrate binding pocket. Nucleotide-binding relieves inhibition. Specifically inhibited by 4-anilinoquinoline compound TPP-UNC-CA157.

Domain organisation. Adopts an atypical protein kinase-like fold: while it adopts a core fold similar to that of well-characterized protein kinase-like domains, a number of features are positioned to inhibit the kinase activity: (1) an atypical AAAS motif in an alanine-rich (A-rich) loop that replaces the canonical glycine-rich (G-rich) nucleotide-binding loop and limits ATP binding by establishing an unusual selectivity for ADP and (2) an N-terminal domain, containing the KxGQ motif, that completely occludes the typical substrate binding pocket. Nucleotide-binding opens the substrate binding pocket and flips the active site from inside the hydrophobic core into a catalytically competent, solvent-exposed posture.

Induction. By p53/TP53.

Pathway. Cofactor biosynthesis; ubiquinone biosynthesis.

Similarity. Belongs to the protein kinase superfamily. ADCK protein kinase family.

Isoforms (4)

UniProt ID	Names	Canonical?
Q8NI60-1	1	yes
Q8NI60-2	2
Q8NI60-3	3
Q8NI60-4	4

RefSeq proteins (1): NP_064632* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR004147	ABC1_dom	Domain
IPR011009	Kinase-like_dom_sf	Homologous_superfamily
IPR034646	ADCK3_dom	Domain
IPR051409	Atypical_kinase_ADCK	Family

Pfam: PF03109

UniProt features (105 total): mutagenesis site 30, helix 23, sequence variant 16, strand 14, binding site 5, splice variant 3, turn 3, region of interest 2, short sequence motif 2, transit peptide 1, chain 1, transmembrane region 1, domain 1, sequence conflict 1, compositionally biased region 1, active site 1

Structure

Experimental structures (PDB)

4 structures.

PDB	Method	Resolution (Å)
4PED	X-RAY DIFFRACTION	1.64
7UDQ	X-RAY DIFFRACTION	1.9
7UDP	X-RAY DIFFRACTION	2.01
5I35	X-RAY DIFFRACTION	2.3

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8NI60-F1	70.65	0.33

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 488 (proton acceptor)

Ligand- & substrate-binding residues (5): 340; 358; 445–448; 493; 507

Mutagenesis-validated functional residues (30):

Position	Phenotype
214	strongly impairs homodimerization.
214	slightly impaired homodimerization.
215	does not impair homodimerization.
216	does not impair homodimerization.
217	slightly impaired homodimerization.
218	slightly impaired homodimerization.
219	slightly impaired homodimerization.
219	strongly impairs homodimerization.
220	impaired homodimerization.
221	slightly impaired homodimerization.
222	slightly impaired homodimerization.
223	strongly impairs homodimerization.
224	impaired homodimerization.
225	slightly impaired homodimerization.
226	slightly impaired homodimerization.
227	strongly impairs homodimerization.
228	does not impair homodimerization.
229	slightly impaired homodimerization.
230	slightly impaired homodimerization.
276	does not affect selectivity for binding adp or atp. impaired multi-subunit coq enzyme complex.
279	does not affect selectivity for binding adp or atp.
339	enables autophosphorylation but inhibits coenzyme q biosynthesis in vivo.
358	abolishes binding adp or atp.
405	slightly affects selectivity for binding adp or atp.
411	impaired binding adp or atp.

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-2142789	Ubiquinol biosynthesis

MSigDB gene sets: 293 (showing top): MODULE_255, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, MODULE_317, DARWICHE_SKIN_TUMOR_PROMOTER_DN, DARWICHE_PAPILLOMA_RISK_LOW_DN, DARWICHE_PAPILLOMA_RISK_HIGH_DN, DARWICHE_SQUAMOUS_CELL_CARCINOMA_DN, GOBP_KETONE_METABOLIC_PROCESS, GOBP_SMALL_MOLECULE_BIOSYNTHETIC_PROCESS, MCBRYAN_PUBERTAL_BREAST_4_5WK_DN, SHETH_LIVER_CANCER_VS_TXNIP_LOSS_PAM4, BLALOCK_ALZHEIMERS_DISEASE_UP, GOCC_MITOCHONDRIAL_ENVELOPE, GOBP_KETONE_BIOSYNTHETIC_PROCESS, CAIRO_HEPATOBLASTOMA_UP

GO Biological Process (2): ubiquinone biosynthetic process (GO:0006744), phosphorylation (GO:0016310)

GO Molecular Function (8): protein kinase activity (GO:0004672), ATP binding (GO:0005524), enzyme activator activity (GO:0008047), kinase activity (GO:0016301), ADP binding (GO:0043531), nucleotide binding (GO:0000166), protein binding (GO:0005515), transferase activity (GO:0016740)

GO Cellular Component (4): mitochondrion (GO:0005739), extrinsic component of mitochondrial inner membrane (GO:0031314), membrane (GO:0016020), mitochondrial membrane (GO:0031966)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Metabolism of cofactors	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
adenyl ribonucleotide binding	2
catalytic activity	2
ubiquinone metabolic process	1
quinone biosynthetic process	1
phosphate-containing compound metabolic process	1
kinase activity	1
phosphotransferase activity, alcohol group as acceptor	1
catalytic activity, acting on a protein	1
purine ribonucleoside triphosphate binding	1
enzyme regulator activity	1
molecular function activator activity	1
transferase activity, transferring phosphorus-containing groups	1
anion binding	1
nucleoside phosphate binding	1
heterocyclic compound binding	1
binding	1
cytoplasm	1
intracellular membrane-bounded organelle	1
mitochondrial inner membrane	1
extrinsic component of organelle membrane	1
cellular anatomical structure	1
mitochondrion	1
mitochondrial envelope	1
organelle membrane	1

Protein interactions and networks

STRING

1189 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
COQ8A	PDSS1	Q5T2R2	988
COQ8A	COQ9	O75208	985
COQ8A	COQ2	Q96H96	984
COQ8A	PDSS2	Q86YH6	969
COQ8A	COQ6	Q9Y2Z9	964
COQ8A	COQ4	Q9Y3A0	919
COQ8A	COQ7	Q99807	887
COQ8A	COQ5	Q5HYK3	886
COQ8A	APTX	Q7Z2E3	885
COQ8A	COQ3	Q9NZJ6	877
COQ8A	ADCK2	Q7Z695	729
COQ8A	COQ10A	Q96MF6	676
COQ8A	COQ10B	Q9H8M1	657
COQ8A	ETFDH	Q16134	631
COQ8A	ANO10	Q9NW15	608

IntAct

314 interactions, top by confidence:

A	B	Type	Score
COQ8A	TFIP11	psi-mi:“MI:0915”(physical association)	0.850
RABAC1	COQ8A	psi-mi:“MI:0915”(physical association)	0.850
TFIP11	COQ8A	psi-mi:“MI:0915”(physical association)	0.850
COQ8A	RABAC1	psi-mi:“MI:0915”(physical association)	0.850
COQ8A	SH3GLB1	psi-mi:“MI:0915”(physical association)	0.810
SH3GLB1	COQ8A	psi-mi:“MI:0915”(physical association)	0.810
COQ8A	REEP6	psi-mi:“MI:0915”(physical association)	0.780
REEP6	COQ8A	psi-mi:“MI:0915”(physical association)	0.780

BioGRID (262): ADCK3 (Two-hybrid), ADCK3 (Two-hybrid), AGTRAP (Two-hybrid), TMEM159 (Two-hybrid), REEP6 (Two-hybrid), TMEM239 (Two-hybrid), ADCK3 (Affinity Capture-MS), ADCK3 (Two-hybrid), COQ5 (Co-fractionation), ADCK3 (Reconstituted Complex), ADCK3 (Reconstituted Complex), ADCK3 (Reconstituted Complex), ADCK3 (Reconstituted Complex), ADCK3 (Affinity Capture-MS), ADCK3 (Affinity Capture-MS)

ESM2 similar proteins: A0A179HKZ8, A0A2Z4HQ03, A2RAF6, A2WSH0, A3QJU3, A4RHN5, A7EGZ3, B2B2N5, C5E4D9, G4N2B5, G4YM00, H6WS94, O13861, O42653, O60111, P12063, P16638, P28669, P30628, P36101, P53396, P53585, P9WQI0, P9WQI1, Q05531, Q06567, Q0JLC5, Q0V3D6, Q18486, Q29RI0, Q2H0G2, Q3MIX3, Q4WYP6, Q5BJQ0, Q5RGU1, Q60936, Q6C8A3, Q6C9T3, Q6DW75, Q6YW62

Diamond homologs: A3QJU3, B1XWR5, P27697, Q18486, Q29RI0, Q54IH6, Q566J8, Q5BJQ0, Q5RGU1, Q5ZMT7, Q60936, Q6AY19, Q7NZD1, Q8NI60, Q92338, Q94BU1, Q96D53, Q9SBB2, A0A172M468, A3QIE3, C3K8U2, Q93Y08, A1V750, A2S8L4, A3MNU1, A3N5V1, A3NRJ7, B2JCV1, P9WQI0, P9WQI1, Q145N7, Q3JVZ2, Q3MIX3, Q5M7P6, Q62MP2, Q63X97, Q80V03, Q86TW2, Q9D0L4, A1JIF4

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

825 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	53
Likely pathogenic	47
Uncertain significance	297
Likely benign	257
Benign	45

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1027504	NM_020247.5(COQ8A):c.589-3C>G	Pathogenic
1027505	NM_020247.5(COQ8A):c.127del (p.Leu43fs)	Pathogenic
1075249	NM_020247.5(COQ8A):c.629_630del (p.Arg210fs)	Pathogenic
1186913	NM_020247.5(COQ8A):c.127_128delinsA (p.Leu43fs)	Pathogenic
1256286	NM_020247.5(COQ8A):c.1660-1G>A	Pathogenic
1408399	NM_020247.5(COQ8A):c.491dup (p.His164fs)	Pathogenic
1454457	NM_020247.5(COQ8A):c.1266_1267insT (p.Lys423Ter)	Pathogenic
1456268	NM_020247.5(COQ8A):c.972G>A (p.Trp324Ter)	Pathogenic
1458808	NC_000001.10:g.(?227165130)(227174438_?)del	Pathogenic
1460065	NC_000001.10:g.(?227149087)(227174438_?)del	Pathogenic
183336	NM_020247.5(COQ8A):c.1744dup (p.Ser582fs)	Pathogenic
1928062	NM_020247.5(COQ8A):c.250_253del (p.Pro84fs)	Pathogenic
1928840	NM_020247.5(COQ8A):c.1681dup (p.Asp561fs)	Pathogenic
210096	NM_020247.5(COQ8A):c.1334_1335del (p.Thr445fs)	Pathogenic
214046	NM_020247.5(COQ8A):c.1844dup (p.Ser616fs)	Pathogenic
242458	NM_020247.5(COQ8A):c.1042C>T (p.Arg348Ter)	Pathogenic
2578598	NM_020247.5(COQ8A):c.947_948del (p.Leu316fs)	Pathogenic
2631386	NM_020247.5(COQ8A):c.1085del (p.Pro362fs)	Pathogenic
2697995	NM_020247.5(COQ8A):c.1232_1233del (p.Glu411fs)	Pathogenic
2760714	NM_020247.5(COQ8A):c.650del (p.Phe217fs)	Pathogenic
2792753	NM_020247.5(COQ8A):c.1632dup (p.Lys545fs)	Pathogenic
280452	NM_020247.5(COQ8A):c.1702G>T (p.Glu568Ter)	Pathogenic
2986412	NM_020247.5(COQ8A):c.1225C>T (p.Gln409Ter)	Pathogenic
3062181	NM_020247.5(COQ8A):c.1579dup (p.Arg527fs)	Pathogenic
3248016	NC_000001.10:g.(?227149087)(227149283_?)del	Pathogenic
3254972	NM_020247.5(COQ8A):c.210del (p.Asn71fs)	Pathogenic
3638	NM_020247.5(COQ8A):c.815G>T (p.Gly272Val)	Pathogenic
3639	NM_020247.5(COQ8A):c.815G>A (p.Gly272Asp)	Pathogenic
3640	NM_020247.5(COQ8A):c.1813dup (p.Glu605fs)	Pathogenic
3641	NM_020247.5(COQ8A):c.1398+2T>C	Pathogenic

SpliceAI

2771 predictions. Top by Δscore:

Variant	Effect	Δscore
1:226961375:A:AG	acceptor_gain	1.0000
1:226961376:G:GA	acceptor_gain	1.0000
1:226961376:GC:G	acceptor_gain	1.0000
1:226961376:GCC:G	acceptor_gain	1.0000
1:226961376:GCCC:G	acceptor_gain	1.0000
1:226961376:GCCCT:G	acceptor_gain	1.0000
1:226961560:CAGGT:C	donor_loss	1.0000
1:226961561:AGGTA:A	donor_loss	1.0000
1:226961562:GGTAA:G	donor_loss	1.0000
1:226964998:AG:A	acceptor_gain	1.0000
1:226964999:GG:G	acceptor_gain	1.0000
1:226965053:G:T	donor_gain	1.0000
1:226965125:G:GG	donor_gain	1.0000
1:226965407:GACG:G	donor_gain	1.0000
1:226965411:G:GG	donor_gain	1.0000
1:226965411:GTG:G	donor_loss	1.0000
1:226965668:CA:C	acceptor_loss	1.0000
1:226965669:A:AG	acceptor_gain	1.0000
1:226965669:A:AT	acceptor_loss	1.0000
1:226965670:G:GG	acceptor_gain	1.0000
1:226965670:GCTCA:G	acceptor_gain	1.0000
1:226965733:CGGAG:C	donor_loss	1.0000
1:226965737:GGTA:G	donor_loss	1.0000
1:226965738:G:GC	donor_loss	1.0000
1:226965739:T:G	donor_loss	1.0000
1:226977443:TTGCA:T	acceptor_loss	1.0000
1:226977444:TGCA:T	acceptor_loss	1.0000
1:226977445:GCAGG:G	acceptor_loss	1.0000
1:226977446:CA:C	acceptor_loss	1.0000
1:226977447:A:AC	acceptor_loss	1.0000

AlphaMissense

4281 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
1:226984612:A:G	D488G	1.000
1:226977455:C:A	A221D	0.999
1:226982110:G:C	G272R	0.999
1:226982120:T:A	L275H	0.999
1:226982120:T:C	L275P	0.999
1:226982122:A:G	K276E	0.999
1:226982124:G:C	K276N	0.999
1:226982124:G:T	K276N	0.999
1:226982140:A:C	S282R	0.999
1:226982142:C:A	S282R	0.999
1:226982142:C:G	S282R	0.999
1:226982964:C:A	A337D	0.999
1:226982970:C:A	A339E	0.999
1:226982978:G:T	G342W	0.999
1:226982979:G:A	G342E	0.999
1:226982987:C:G	H345D	0.999
1:226983021:C:A	A356D	0.999
1:226983026:A:G	K358E	0.999
1:226983028:G:C	K358N	0.999
1:226983028:G:T	K358N	0.999
1:226983803:T:C	L402P	0.999
1:226983830:A:T	E411V	0.999
1:226983831:G:C	E411D	0.999
1:226983831:G:T	E411D	0.999
1:226984611:G:C	D488H	0.999
1:226984612:A:T	D488V	0.999
1:226984628:C:A	N493K	0.999
1:226984628:C:G	N493K	0.999
1:226984889:A:C	D507A	0.999
1:226984889:A:T	D507V	0.999

dbSNP variants (sampled 300 via entrez): RS1000036496 (1:226959762 G>A), RS1000066744 (1:226961810 G>A), RS1000163931 (1:226959531 G>A,C,T), RS1000249693 (1:226971510 G>A), RS1000279625 (1:226945466 T>A), RS1000309062 (1:226985440 GCC>G,GC,GCCC), RS1000318459 (1:226978715 CACACACCCACCTCATACCTGCACACCTCCTT>C), RS1000372381 (1:226965262 C>T), RS1000444018 (1:226977489 C>T), RS1000460974 (1:226964970 T>C), RS1000475151 (1:226970500 A>G), RS1000555881 (1:226959291 T>G), RS1000571928 (1:226964763 G>A), RS1000634936 (1:226976964 G>T), RS1000681417 (1:226982228 C>T)

Disease associations

OMIM: gene MIM:606980 | disease phenotypes: MIM:612016, MIM:614615, MIM:607426

GenCC curated gene-disease

Disease	Classification	Inheritance
coenzyme Q10 deficiency	Definitive	Autosomal recessive
autosomal recessive ataxia due to ubiquinone deficiency	Definitive	Autosomal recessive

Mondo (8): autosomal recessive ataxia due to ubiquinone deficiency (MONDO:0012784), cerebellar ataxia (MONDO:0000437), pathologic nystagmus (MONDO:0004843), mitochondrial disease (MONDO:0044970), congenital nervous system disorder (MONDO:0002320), Joubert syndrome 17 (MONDO:0013824), coenzyme Q10 deficiency (MONDO:0018151), coenzyme Q10 deficiency, primary, 1 (MONDO:0011829)

Orphanet (6): Autosomal recessive ataxia due to ubiquinone deficiency (Orphanet:139485), Rare ataxia (Orphanet:102002), Mitochondrial disease (Orphanet:68380), Coenzyme Q10 deficiency (Orphanet:35656), Isolated Joubert syndrome (Orphanet:475), Leigh syndrome with nephrotic syndrome (Orphanet:255249)

HPO phenotypes

38 total (30 of 38 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000365	Hearing impairment
HP:0000486	Strabismus
HP:0000508	Ptosis
HP:0000771	Gynecomastia
HP:0001249	Intellectual disability
HP:0001250	Seizure
HP:0001251	Ataxia
HP:0001252	Hypotonia
HP:0001263	Global developmental delay
HP:0001272	Cerebellar atrophy
HP:0001332	Dystonia
HP:0001336	Myoclonus
HP:0001337	Tremor
HP:0001347	Hyperreflexia
HP:0001348	Brisk reflexes
HP:0001761	Pes cavus
HP:0002073	Progressive cerebellar ataxia
HP:0002151	Increased circulating lactate concentration
HP:0002342	Moderate intellectual disability
HP:0002376	Developmental regression
HP:0002490	Increased CSF lactate
HP:0003128	Lactic acidosis
HP:0003457	EMG abnormality
HP:0003546	Exercise intolerance
HP:0003593	Infantile onset
HP:0003701	Proximal muscle weakness
HP:0004696	Talipes cavus equinovarus
HP:0007256	Abnormal pyramidal sign
HP:0008936	Axial hypotonia

GWAS associations

21 associations (top):

Study	Trait	p-value
GCST004608_46	Granulocyte percentage of myeloid white cells	4.000000e-12
GCST004613_4	Sum neutrophil eosinophil counts	7.000000e-13
GCST004614_121	Granulocyte count	1.000000e-12
GCST004620_9	Sum basophil neutrophil counts	4.000000e-13
GCST004629_16	Neutrophil count	3.000000e-13
GCST004632_125	Lymphocyte percentage of white cells	3.000000e-11
GCST007876_41	Estimated glomerular filtration rate	4.000000e-08
GCST009391_978	Metabolite levels	3.000000e-06
GCST009963_3	Cataracts (operation)	6.000000e-12
GCST010002_355	Refractive error	1.000000e-12
GCST010320_118	PR interval	3.000000e-14
GCST010321_182	PR interval	2.000000e-14
GCST010396_310	Gut microbiota (bacterial taxa, hurdle binary method)	6.000000e-06
GCST012013_19	Cataracts	3.000000e-15
GCST012013_6	Cataracts	1.000000e-20
GCST90002389_97	Lymphocyte percentage of white cells	3.000000e-17
GCST90002397_754	Mean spheric corpuscular volume	7.000000e-10
GCST90014268_6	Cataracts	2.000000e-33
GCST90020024_851	A body shape index	1.000000e-08
GCST90020029_598	Waist circumference adjusted for body mass index	4.000000e-13
GCST90020029_599	Waist circumference adjusted for body mass index	3.000000e-12

EFO canonical traits (10, from GWAS)

EFO ID	Trait name
EFO:0007997	granulocyte percentage of myeloid white cells
EFO:0004833	neutrophil count
EFO:0004842	eosinophil count
EFO:0007987	granulocyte count
EFO:0005090	basophil count
EFO:0007993	lymphocyte percentage of leukocytes
EFO:0010538	taurocholate measurement
EFO:0004462	PR interval
EFO:0007874	gut microbiome measurement
EFO:0007789	BMI-adjusted waist circumference

MeSH disease descriptors (4)

Descriptor	Name	Tree numbers
D002524	Cerebellar Ataxia	C10.228.140.252.190; C10.597.350.090.500; C23.888.592.350.090.200
D009759	Nystagmus, Pathologic	C10.292.562.675; C11.590.400
C564403	Coenzyme Q10 Deficiency (supp.)
C567436	Spinocerebellar Ataxia, Autosomal Recessive 9 (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5550 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

14 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 174,040 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL1287853	FEDRATINIB	4	3,554
CHEMBL24828	VANDETANIB	4	42,230
CHEMBL5416410	DASATINIB	4	655
CHEMBL553	ERLOTINIB	4	108,300
CHEMBL217092	SARACATINIB	3	3,982
CHEMBL31965	CANERTINIB	3	8,083
CHEMBL230011	TG100-115	2	1,504
CHEMBL2364611	GALUNISERTIB	2	1,929
CHEMBL253969	OSI-632	2	1,150
CHEMBL475251	R-406	2	762
CHEMBL564829	MILCICLIB	2	821
CHEMBL1230122	R-1487	1	42
CHEMBL482967	CYC-116	1	651
CHEMBL551064	AEW-541	1	377

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — ABC1-B subfamily

Binding affinities (BindingDB)

5 measured of 5 human assays (5 total across all organisms); most potent 5 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
BMS-354825	KD	27 nM
N-(4-bromo-2-fluorophenyl)-6-methoxy-7-[(1-methylpiperidin-4-yl)methoxy]quinazolin-4-amine	KD	150 nM
ERLOTINIB HYDROCHLORIDE	KD	1200 nM
CI-1033	KD	1700 nM
1-Acyl-1H-[1,2,4]triazole-3,5-diamine Analogue 3b	KD	3100 nM

ChEMBL bioactivities

40 potent at pChembl≥5 of 42 total, top 34 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.18	Kd	66	nM	CHEMBL4575895
7.03	Kd	94	nM	TG100-115
6.77	Kd	170	nM	CHEMBL4556662
6.77	Kd	170	nM	CHEMBL4585158
6.72	Kd	190	nM	CHEMBL4517424
6.72	Kd	190	nM	CHEMBL4443342
6.72	Kd	190	nM	DASATINIB
6.66	Kd	220	nM	CHEMBL535429
6.60	Kd	250	nM	CHEMBL311959
6.58	Kd	260	nM	CHEMBL4443342
6.56	Kd	275	nM	SARACATINIB
6.52	Kd	300	nM	CHEMBL535429
6.50	Kd	320	nM	R-1487
6.46	Kd	347	nM	CHEMBL3752910
6.41	ED50	389.6	nM	CHEMBL3752910
6.31	Kd	490	nM	CHEMBL2425628
6.13	Kd	740	nM	CHEMBL530635
6.08	Kd	835	nM	AEW-541
6.04	Kd	910	nM	CHEMBL386051
5.96	Kd	1100	nM	R-406
5.92	Kd	1200	nM	CHEMBL4586530
5.92	Kd	1200	nM	JNJ-7706621
5.82	Kd	1500	nM	CANERTINIB
5.77	Kd	1700	nM	TAE-684
5.72	Kd	1900	nM	ERLOTINIB
5.70	Kd	2000	nM	CHEMBL4592501
5.52	Kd	3012	nM	MILCICLIB
5.51	Kd	3053	nM	OSI-632
5.50	Kd	3200	nM	CHEMBL1241674
5.39	Kd	4100	nM	CHEMBL4586588
5.35	Kd	4500	nM	VANDETANIB
5.16	Kd	7000	nM	FEDRATINIB
5.12	Kd	7639	nM	CHEMBL5653589
5.07	ED50	8576	nM	CHEMBL5653589

PubChem BioAssay actives

38 with measured affinity, of 456 total; 31 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-(3,4,5-trimethoxyanilino)quinoline-7-carbonitrile	1638750: Binding affinity to biotinylated full length human ADCK3 expressed in Escherichia coli incubated for 1.5 hrs by fluorescent tracer dependent TR-FRET based competitive ligand binding displacement assay	kd	0.0660	uM
3-[2,4-diamino-7-(3-hydroxyphenyl)pteridin-6-yl]phenol	625116: Binding constant for ADCK3 kinase domain	kd	0.0940	uM
6-chloro-N-(3,4,5-trimethoxyphenyl)quinolin-4-amine	1638750: Binding affinity to biotinylated full length human ADCK3 expressed in Escherichia coli incubated for 1.5 hrs by fluorescent tracer dependent TR-FRET based competitive ligand binding displacement assay	kd	0.1700	uM
4-(3,4,5-trimethoxyanilino)quinoline-6-carbonitrile	1638750: Binding affinity to biotinylated full length human ADCK3 expressed in Escherichia coli incubated for 1.5 hrs by fluorescent tracer dependent TR-FRET based competitive ligand binding displacement assay	kd	0.1700	uM
N-(2-chloro-6-methylphenyl)-2-[[6-[4-(2-hydroxyethyl)piperazin-1-yl]-2-methylpyrimidin-4-yl]amino]-1,3-thiazole-5-carboxamide;hydrate	435516: Binding constant for ADCK3 kinase domain	kd	0.1900	uM
6-bromo-N-(3,4,5-trimethoxyphenyl)quinolin-4-amine	1638750: Binding affinity to biotinylated full length human ADCK3 expressed in Escherichia coli incubated for 1.5 hrs by fluorescent tracer dependent TR-FRET based competitive ligand binding displacement assay	kd	0.1900	uM
6-iodo-N-(3,4,5-trimethoxyphenyl)quinolin-4-amine	1638750: Binding affinity to biotinylated full length human ADCK3 expressed in Escherichia coli incubated for 1.5 hrs by fluorescent tracer dependent TR-FRET based competitive ligand binding displacement assay	kd	0.1900	uM
6-(trifluoromethyl)-N-(3,4,5-trimethoxyphenyl)quinolin-4-amine	1638750: Binding affinity to biotinylated full length human ADCK3 expressed in Escherichia coli incubated for 1.5 hrs by fluorescent tracer dependent TR-FRET based competitive ligand binding displacement assay	kd	0.2200	uM
6,7-dimethoxy-N-(3,4,5-trimethoxyphenyl)quinolin-4-amine	1638750: Binding affinity to biotinylated full length human ADCK3 expressed in Escherichia coli incubated for 1.5 hrs by fluorescent tracer dependent TR-FRET based competitive ligand binding displacement assay	kd	0.2500	uM
N-(5-chloro-1,3-benzodioxol-4-yl)-7-[2-(4-methylpiperazin-1-yl)ethoxy]-5-(oxan-4-yloxy)quinazolin-4-amine	1424905: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	0.2750	uM
6-(2,4-difluorophenoxy)-8-methyl-2-(oxan-4-ylamino)pyrido[2,3-d]pyrimidin-7-one	592320: Inhibition of ADCK3	kd	0.3200	uM
4-methyl-3-[(1-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2147806: Binding affinity to human ADCK3 incubated for 45 mins by Kinobead based pull down assay	kd	0.3470	uM
(4-hydroxypiperidin-1-yl)-[4-[[4-[4-(3-methylsulfonylpropoxy)indol-1-yl]pyrimidin-2-yl]amino]cyclohexyl]methanone	769540: Binding affinity to ADCK3 (unknown origin)	kd	0.4900	uM
6-tert-butyl-N-(3,4,5-trimethoxyphenyl)quinolin-4-amine	1638750: Binding affinity to biotinylated full length human ADCK3 expressed in Escherichia coli incubated for 1.5 hrs by fluorescent tracer dependent TR-FRET based competitive ligand binding displacement assay	kd	0.7400	uM
7-[3-(azetidin-1-yl)cyclobutyl]-5-(3-phenylmethoxyphenyl)pyrrolo[2,3-d]pyrimidin-4-amine	1424905: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	0.8350	uM
6-(2,6-dichlorophenyl)-8-methyl-2-(3-methylsulfanylanilino)pyrido[2,3-d]pyrimidin-7-one	625116: Binding constant for ADCK3 kinase domain	kd	0.9100	uM
6-[[5-fluoro-2-(3,4,5-trimethoxyanilino)pyrimidin-4-yl]amino]-2,2-dimethyl-4H-pyrido[3,2-b][1,4]oxazin-3-one	625116: Binding constant for ADCK3 kinase domain	kd	1.1000	uM
7-methoxy-N-(3,4,5-trimethoxyphenyl)quinolin-4-amine	1638750: Binding affinity to biotinylated full length human ADCK3 expressed in Escherichia coli incubated for 1.5 hrs by fluorescent tracer dependent TR-FRET based competitive ligand binding displacement assay	kd	1.2000	uM
4-[[5-amino-1-(2,6-difluorobenzoyl)-1,2,4-triazol-3-yl]amino]benzenesulfonamide	435516: Binding constant for ADCK3 kinase domain	kd	1.2000	uM
N-[4-(3-chloro-4-fluoroanilino)-7-(3-morpholin-4-ylpropoxy)quinazolin-6-yl]prop-2-enamide	435516: Binding constant for ADCK3 kinase domain	kd	1.5000	uM
5-chloro-2-N-[2-methoxy-4-[4-(4-methylpiperazin-1-yl)piperidin-1-yl]phenyl]-4-N-(2-propan-2-ylsulfonylphenyl)pyrimidine-2,4-diamine	625116: Binding constant for ADCK3 kinase domain	kd	1.7000	uM
Erlotinib	435516: Binding constant for ADCK3 kinase domain	kd	1.9000	uM
6-methoxy-N-(3,4,5-trimethoxyphenyl)quinolin-4-amine	1638750: Binding affinity to biotinylated full length human ADCK3 expressed in Escherichia coli incubated for 1.5 hrs by fluorescent tracer dependent TR-FRET based competitive ligand binding displacement assay	kd	2.0000	uM
N,1,4,4-tetramethyl-8-[4-(4-methylpiperazin-1-yl)anilino]-5H-pyrazolo[4,5-h]quinazoline-3-carboxamide	1424905: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	3.0120	uM
3-[(4-bromo-2,6-difluorophenyl)methoxy]-5-(4-pyrrolidin-1-ylbutylcarbamoylamino)-1,2-thiazole-4-carboxamide	1424905: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	3.0530	uM
2-(4-amino-1-propan-2-ylpyrazolo[3,4-d]pyrimidin-3-yl)-1H-indol-5-ol	625116: Binding constant for ADCK3 kinase domain	kd	3.2000	uM
N-(3,4,5-trimethoxyphenyl)quinolin-4-amine	1638750: Binding affinity to biotinylated full length human ADCK3 expressed in Escherichia coli incubated for 1.5 hrs by fluorescent tracer dependent TR-FRET based competitive ligand binding displacement assay	kd	4.1000	uM
Vandetanib	435516: Binding constant for ADCK3 kinase domain	kd	4.5000	uM
Fedratinib	625116: Binding constant for ADCK3 kinase domain	kd	7.0000	uM
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2147806: Binding affinity to human ADCK3 incubated for 45 mins by Kinobead based pull down assay	kd	7.6389	uM
4-methyl-5-[2-(4-morpholin-4-ylanilino)pyrimidin-4-yl]-1,3-thiazol-2-amine	1424905: Kinobeads (epsilon), multiple immobilized ATP-competitive broad spectrum kinase inhibitors, used to assess residual binding of ~300 proteins simultaneously from cell lysate in the presence of a compound. Quantitative readout performed by mass spectrometry.	kd	65.3020	uM

CTD chemical–gene interactions

46 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Cisplatin	affects cotreatment, increases expression, decreases reaction	3
Acetaminophen	decreases expression	2
Benzo(a)pyrene	affects methylation, decreases expression	2
Cyclosporine	decreases expression	2
aristolochic acid I	decreases expression	1
bisphenol F	affects cotreatment, increases methylation	1
triphenyl phosphate	affects expression	1
pirinixic acid	affects binding, increases activity, increases expression	1
deoxynivalenol	decreases expression	1
kojic acid	increases expression	1
beta-lapachone	increases expression	1
sodium arsenite	decreases expression	1
di-n-butylphosphoric acid	affects expression	1
perfluorooctane sulfonic acid	increases expression	1
K 7174	decreases expression	1
ICG 001	decreases expression	1
MRK 003	increases expression	1
jinfukang	affects cotreatment, increases expression	1
NSC 689534	affects binding, decreases expression	1
Resveratrol	affects cotreatment, increases expression	1
Temozolomide	increases expression	1
Fulvestrant	affects cotreatment, increases methylation	1
Artesunate	decreases response to substance	1
Atrazine	increases expression	1
Cadmium	increases expression	1
Carbonyl Cyanide p-Trifluoromethoxyphenylhydrazone	increases expression	1
Copper	affects binding, decreases expression	1
Diuron	decreases expression	1
Doxorubicin	increases expression	1
Estradiol	affects expression	1

ChEMBL screening assays

93 unique, capped per target: 93 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1032243	Binding	Inhibition of ADCK3 at 3 uM	Discovery of substituted 4-(pyrazol-4-yl)-phenylbenzodioxane-2-carboxamides as potent and highly selective Rho kinase (ROCK-II) inhibitors. — J Med Chem

Cellosaurus cell lines

4 cell lines: 2 cancer cell line, 1 transformed cell line, 1 finite cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B2UZ	Abcam HEK293T COQ8A KO	Transformed cell line	Female
CVCL_EZ67	ND41007	Finite cell line	Female
CVCL_SB61	HAP1 COQ8A (-) 1	Cancer cell line	Male
CVCL_SB62	HAP1 COQ8A (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

154 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00950196	PHASE4	COMPLETED	Amantadine for Improving Neurologic Symptoms in Ataxia-Telangiectasia
NCT04107740	PHASE4	COMPLETED	C-Trelin Orally Disintegrated(OD) Tablet 5mg in Ataxia Due to Spinocerebellar Degeneration
NCT03351998	PHASE4	COMPLETED	Impact of Statin Therapy on Muscle Mitochondrial Function and Aerobic Capacity
NCT01970098	PHASE3	COMPLETED	A Confirmatory Study of KPS-0373 in Patients With Spinocerebellar Degeneration (SCD)
NCT01970111	PHASE3	COMPLETED	An Extension Study of KPS-0373 in Patients With Spinocerebellar Degeneration (SCD)
NCT01970124	PHASE3	COMPLETED	A Long-Term Study of KPS-0373 in Patients With Spinocerebellar Degeneration (SCD)
NCT01970137	PHASE3	COMPLETED	A 24-week Open-label Study of KPS-0373 in Patients With Spinocerebellar Degeneration (SCD)
NCT02889302	PHASE3	COMPLETED	An Additional Confirmatory Study of KPS-0373 in Patients With Spinocerebellar Degeneration (SCD)
NCT03408080	PHASE3	ACTIVE_NOT_RECRUITING	Open Pilot Trial of BHV-4157
NCT03701399	PHASE3	ACTIVE_NOT_RECRUITING	Troriluzole in Adult Participants With Spinocerebellar Ataxia
NCT03901638	PHASE3	TERMINATED	Tllsh2910 for Ataxia and Gut Microbiota Alteration in Patients of Multiple System Atrophy
NCT07040137	PHASE3	RECRUITING	Confirmatory Study 3 of KPS-0373 in Patients With Spinocerebellar Degeneration
NCT00432744	PHASE3	COMPLETED	Phase III Trial of Coenzyme Q10 in Mitochondrial Disease
NCT05162768	PHASE3	COMPLETED	Study to Evaluate Efficacy and Safety of Elamipretide in Subjects With Primary Mitochondrial Disease From Nuclear DNA Mutations (nPMD)
NCT06451757	PHASE3	RECRUITING	KHENERFIN Study: A Trial to Evaluate the Efficacy and Safety of Sonlicromanol in Primary Mitochondrial Diseases
NCT00034242	PHASE2	COMPLETED	High-Dose Intravenous Immunoglobulin to Treat Cerebellar Degeneration
NCT00202397	PHASE2	COMPLETED	Effect of Riluzole as a Symptomatic Approach in Patients With Chronic Cerebellar Ataxia
NCT00863538	PHASE2	COMPLETED	Phase II Study of KPS-0373 in Patients With Spinocerebellar Degeneration (SCD)
NCT01004016	PHASE2	COMPLETED	A Study of KPS-0373 in Patients With Spinocerebellar Degeneration (SCD)
NCT01350440	PHASE2	COMPLETED	Safety and Efficacy of Intravenous Immune Globulin in Treating Spinocerebellar Ataxia
NCT02540655	PHASE2	COMPLETED	Efficacy and Safety Study of Stemchymal® in Polyglutamine Spinocerebellar Ataxia
NCT03932669	PHASE2	COMPLETED	Effect of Nilotinib in Cerebellar Ataxia Patients
NCT04301284	PHASE2	WITHDRAWN	Study of CAD-1883 for Spinocerebellar Ataxia
NCT05125666	PHASE2	UNKNOWN	Efficacy of Dual Task Training on Children With Ataxia After Medulloblastoma Resection
NCT06397274	PHASE2	NOT_YET_RECRUITING	Stemchymal® for Polyglutamine Spinocerebellar Ataxia
NCT02398201	PHASE2	COMPLETED	A Study of Bezafibrate in Mitochondrial Myopathy
NCT00683943	PHASE1	COMPLETED	Lithium Treatment for Patients With Spinocerebellar Ataxia Type I
NCT02287064	PHASE1	UNKNOWN	An Open-label Trial of Intravenous Immune Globulin (IVIG)in Treating Spinocerebellar Ataxias
NCT05157802	PHASE1	ACTIVE_NOT_RECRUITING	Promoting Physical Activity Engagement for People With Early-stage Cerebellar Ataxia
NCT05554835	Not specified	RECRUITING	Global Registry and Natural History Study for Mitochondrial Disorders
NCT01793168	Not specified	RECRUITING	Rare Disease Patient Registry & Natural History Study - Coordination of Rare Diseases at Sanford
NCT01104649	PHASE2/PHASE3	COMPLETED	Efficacy of Riluzole in Hereditary Cerebellar Ataxia
NCT02960893	PHASE2/PHASE3	COMPLETED	Trial in Adult Participants With Spinocerebellar Ataxia (SCA)
NCT00244361	PHASE1/PHASE2	COMPLETED	Effectiveness of Rituximab in Pediatric OMS Patients.
NCT01649687	PHASE1/PHASE2	COMPLETED	Treatment of Cerebellar Ataxia With Mesenchymal Stem Cells
NCT01958177	PHASE1/PHASE2	UNKNOWN	Clinical Study to Evaluate the Safety and Efficacy BMMNC in Cerebellar Ataxia
NCT02829268	PHASE1/PHASE2	COMPLETED	A Clinical Trial of Dantrolene Sodium in Pediatric and Adult Patients With Wolfram Syndrome
NCT00001324	Not specified	COMPLETED	PET Scan to Study Brain Control of Human Movement
NCT00006492	Not specified	COMPLETED	Gluten-Free Diet in Patients With Gluten Sensitivity and Cerebellar Ataxia
NCT00136630	Not specified	COMPLETED	Natural History, Genetic Bases and Phenotype-genotype Correlations in Autosomal Dominant Spinocerebellar Degenerations