CORO1A

Summary

CORO1A (coronin 1A, HGNC:2252) is a protein-coding gene on chromosome 16p11.2, encoding Coronin-1A (P31146). May be a crucial component of the cytoskeleton of highly motile cells, functioning both in the invagination of large pieces of plasma membrane, as well as in forming protrusions of the plasma membrane involved in cell locomotion.

This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Alternative splicing results in multiple transcript variants. A related pseudogene has been defined on chromosome 16.

Source: NCBI Gene 11151 — RefSeq curated summary.

At a glance

• Gene–disease (curated): severe combined immunodeficiency due to CORO1A deficiency (Definitive, ClinGen) — +2 more curated relationships
• GWAS associations: 4
• Clinical variants (ClinVar): 377 total — 9 pathogenic, 9 likely-pathogenic
• Phenotypes (HPO): 14
• Druggable target: yes
• Dosage sensitivity (ClinGen): haploinsufficiency autosomal recessive, triplosensitivity no evidence
• MANE Select transcript: NM_007074

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2252
Approved symbol	CORO1A
Name	coronin 1A
Location	16p11.2
Locus type	gene with protein product
Status	Approved
Aliases	HCORO1, p57, coronin-1
Ensembl gene	ENSG00000102879
Ensembl biotype	protein_coding
OMIM	605000
Entrez	11151

Gene structure

Transcript identifiers

Ensembl transcripts: 30 — 20 protein_coding, 7 retained_intron, 3 protein_coding_CDS_not_defined

ENST00000219150, ENST00000561815, ENST00000561849, ENST00000562129, ENST00000563778, ENST00000564446, ENST00000564768, ENST00000565497, ENST00000566619, ENST00000567034, ENST00000568763, ENST00000568982, ENST00000569203, ENST00000569469, ENST00000569970, ENST00000570045, ENST00000570244, ENST00000696217, ENST00000891502, ENST00000891503, ENST00000891504, ENST00000891505, ENST00000891506, ENST00000891507, ENST00000891508, ENST00000891509, ENST00000891510, ENST00000891511, ENST00000928963, ENST00000949090

RefSeq mRNA: 2 — MANE Select: NM_007074 NM_001193333, NM_007074

CCDS: CCDS10673

Canonical transcript exons

ENST00000219150 — 11 exons

Exon	Start	End
ENSE00000868516	30188860	30189076
ENSE00002613049	30183602	30183725
ENSE00003461610	30188361	30188576
ENSE00003490414	30188192	30188249
ENSE00003510657	30185209	30185407
ENSE00003547749	30187942	30188087
ENSE00003601961	30187039	30187223
ENSE00003616241	30186816	30186945
ENSE00003632163	30186598	30186720
ENSE00003687987	30187382	30187501
ENSE00003784941	30187725	30187829

Expression profiles

Bgee: expression breadth ubiquitous, 252 present calls, max score 99.74.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 87.2878 / max 2310.8359, expressed in 1401 samples.

FANTOM5 promoters (11 alternative TSS)

Promoter ID	TPM avg	Samples expressed
153628	84.5328	1390
153629	0.9740	163
153630	0.7859	135
153633	0.2683	102
153626	0.1600	63
153635	0.1491	88
153627	0.1242	56
207833	0.1125	60
153634	0.1108	64
153631	0.0364	12

Top tissues by expression

293 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
granulocyte	CL:0000094	99.74	gold quality
monocyte	CL:0000576	99.57	gold quality
leukocyte	CL:0000738	99.55	gold quality
mononuclear cell	CL:0000842	99.54	gold quality
blood	UBERON:0000178	99.39	gold quality
spleen	UBERON:0002106	99.23	gold quality
vermiform appendix	UBERON:0001154	98.96	gold quality
bone marrow	UBERON:0002371	98.95	gold quality
bone marrow cell	CL:0002092	98.70	gold quality
lymph node	UBERON:0000029	98.06	gold quality
trabecular bone tissue	UBERON:0002483	97.88	gold quality
thymus	UBERON:0002370	97.57	gold quality
gall bladder	UBERON:0002110	96.09	gold quality
bone element	UBERON:0001474	95.94	gold quality
small intestine Peyer’s patch	UBERON:0003454	94.99	gold quality
upper lobe of left lung	UBERON:0008952	94.61	gold quality
right lung	UBERON:0002167	94.54	gold quality
caecum	UBERON:0001153	94.45	gold quality
prefrontal cortex	UBERON:0000451	94.27	gold quality
right frontal lobe	UBERON:0002810	94.10	gold quality
ileal mucosa	UBERON:0000331	94.08	gold quality
upper lobe of lung	UBERON:0008948	93.48	gold quality
anterior cingulate cortex	UBERON:0009835	93.38	gold quality
cortical plate	UBERON:0005343	93.32	gold quality
cingulate cortex	UBERON:0003027	93.30	gold quality
small intestine	UBERON:0002108	93.15	gold quality
mucosa of transverse colon	UBERON:0004991	93.14	gold quality
Brodmann (1909) area 9	UBERON:0013540	92.84	gold quality
right coronary artery	UBERON:0001625	92.66	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	92.16	gold quality

Single-cell (SCXA)

Detected in 43 experiment(s), a significant marker in 34.

Experiment	Marker?	Max mean expression
E-MTAB-9467	yes	2477.00
E-HCAD-24	yes	2453.75
E-CURD-97	yes	2288.11
E-MTAB-8221	yes	2026.13
E-MTAB-9906	yes	1888.06
E-MTAB-8410	yes	1846.76
E-MTAB-7407	yes	1734.50
E-HCAD-15	yes	1627.67
E-CURD-126	yes	1507.68
E-GEOD-130473	yes	1451.15
E-MTAB-10287	yes	964.86
E-MTAB-9388	yes	787.13
E-MTAB-10662	yes	782.72
E-HCAD-6	yes	743.97
E-GEOD-114530	yes	740.64

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

16 targeting CORO1A, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-6851-5P	100.00	65.63	1294
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-3689D	100.00	66.14	1181
HSA-MIR-9902	99.89	69.15	2250
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-30B-3P	99.70	65.76	2325
HSA-MIR-6716-5P	99.56	68.62	1244
HSA-MIR-4505	99.27	67.81	2678
HSA-MIR-5787	99.22	67.86	2628
HSA-MIR-7854-3P	99.08	66.26	1117
HSA-MIR-6871-5P	98.90	66.67	671
HSA-MIR-4769-3P	97.95	68.17	1002
HSA-MIR-6817-5P	97.95	67.86	1026
HSA-MIR-1238-5P	94.82	67.52	493
HSA-MIR-4758-5P	94.82	67.06	499

Functional genomics

ClinGen dosage: haploinsufficiency 30 (autosomal recessive), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 29)

• These results demonstrate that p57/coronin-1 forms homodimers, that the association is mediated by the leucine zipper structure in the C-terminal region, and that it plays a role in the cross-linking of F-actin in the cell. (PMID:15601263)
• The leukocyte plasma membrane associates with the actin cytoskeleton through coronin-1. (PMID:15800061)
• downregulation of TACO gene transcription restricts entry/survival of mycobacteria within macrophages (PMID:16040207)
• Our results strongly suggested that there was a new actin-binding region at the C-terminus of p57. (PMID:16467882)
• Coronin-1 accumulates at the leading edge of migrating neutrophils and at the nascent phagosome. (PMID:17442961)
• phosphorylation of p57/coronin-1 down-regulates its association with actin and modulates the reorganization of actin-containing cytoskeleton (PMID:18693254)
• Findings establish a function for coronin 1A in T cell egress, identify a surface of coronin involved in Arp2/3 regulation. (PMID:18836449)
• Circulating neutrophils from CF patients had more coronin-1 expression, associated with a lower apoptosis rate (PMID:19454722)
• Instead of regulating the F-actin cytoskeleton, coronin 1 functions in balancing pro- and antiapoptotic signals by regulating divalent calcium ion fluxes and calcineurin activation downstream of the T cell receptor. (PMID:21339362)
• Coronin 1A promotes a cytoskeletal-based feedback loop that facilitates Rac1 translocation and activation (PMID:21873980)
• Constitutive turnover of phosphorylation at Thr-412 of p57/coronin-1 regulates its interaction with actin. (PMID:23100250)
• PU.1 and CEBPA are direct transcriptional regulators of CORO1A in acute promyelocytic leukemia and acute myeloid leukemia. (PMID:23252456)
• Our findings define a new clinical entity of a primary immunodeficiency with increased susceptibility to EBV-induced lymphoproliferation in patients associated with hypomorphic Coronin-1A mutation. (PMID:23522482)
• These results demonstrate that coronin-1a is a novel antibody target for clinically isolated syndrome and multiple sclerosis. (PMID:23745754)
• Nox4-mediated redox regulation of PTP1B serves as a modulator, in part through coronin-1C, of the growth and migration of glioblastoma cells. (PMID:24239742)
• show a critical role for F-actin deconstruction in cytotoxic function and immunological secretion and identify Coro1A as its mediator (PMID:24760828)
• Results indicate that Coronin1 proteins are at the center of a regulatory hub that coordinates Rac1 activation, effector exchange, and the F-actin organization state during cell signaling. (PMID:24980436)
• mutatiions result in abnormal T-cells, severe combined immunodeficiency of an epidermodysplasia verruciformis-human papilloma virus mucocutaneous syndrome with B and NK defects and shortened telomeres (PMID:25073507)
• Coronin 1 trimerization is essential to promote mycobacterial survival within macrophages (PMID:25217836)
• Absence of coronin 1A is associated with severe combined immunodeficiency in humans, hypomorphic mutations lead to a profound defect in naive T cells, expansion of oligoclonal memory T cells, and susceptibility to Epstein Barr B lymphoproliferation. (PMID:25269405)
• Together, these findings both in Jurkat T cells as well as in primary T cells indicate a regulatory role of Coro1A on PKCtheta; recruitment and function downstream of the TCR leading to NF-kappaB transactivation. (PMID:25889880)
• These findings suggest that coronin 1A modulates endothelial cell apoptosis by regulating p38beta expression and activation. (PMID:25936522)
• Our studies demonstrate the importance of intact CORO1A C-terminal domains in thymic egress and T-cell survival, as well as in defense against viral pathogens. (PMID:26476480)
• Levels of p21 and p27 were decreased in TACO or pAKT overexpressing HCC due to SKP2 upregulation. (PMID:27779207)
• It has been shown that WDR26 promotes Rac1 membrane translocation following a Coro1A-like and Coro1A-dependent mechanism. (PMID:27835684)
• Data suggest that CORO1A plays key role in neuronal signaling; roles of CORO1A in multiple signaling pathways suggest that CORO1A may influence cross talk between key pathways. [REVIEW] (PMID:28215292)
• Coro1A has a role in platelet biology with impact on spreading, aggregation and thrombosis (PMID:30453345)
• Carbamazepine-modified HLA-A*24:02-bound peptidome: Implication of CORO1A in skin rash. (PMID:35526384)
• Serum exosomal coronin 1A and dynamin 2 as neural tube defect biomarkers. (PMID:35915349)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	coro1a	ENSDARG00000054610
mus_musculus	Coro1a	ENSMUSG00000030707
rattus_norvegicus	Coro1a	ENSRNOG00000019430
drosophila_melanogaster	coro	FBGN0265935
caenorhabditis_elegans		WBGENE00000768

Paralogs (6): CORO2B (ENSG00000103647), CORO2A (ENSG00000106789), CORO1C (ENSG00000110880), CORO6 (ENSG00000167549), CORO1B (ENSG00000172725), CORO7 (ENSG00000262246)

Protein

Protein identifiers

Coronin-1A — P31146 (reviewed: P31146)

Alternative names: Coronin-like protein A, Coronin-like protein p57, Tryptophan aspartate-containing coat protein

All UniProt accessions (7): P31146, H3BNA2, H3BRJ0, H3BRY3, H3BSL1, H3BTU6, H3BU76

UniProt curated annotations — full annotation on UniProt →

Function. May be a crucial component of the cytoskeleton of highly motile cells, functioning both in the invagination of large pieces of plasma membrane, as well as in forming protrusions of the plasma membrane involved in cell locomotion. In mycobacteria-infected cells, its retention on the phagosomal membrane prevents fusion between phagosomes and lysosomes.

Subunit / interactions. Binds actin.

Subcellular location. Cytoplasm. Cytoskeleton. Cell cortex. Cytoplasmic vesicle. Phagosome membrane.

Tissue specificity. Expressed in brain, thymus, spleen, bone marrow and lymph node. Low in lung and gut.

Post-translational modifications. phosphorylation at Thr-412 by PKC strongly down-regulates the association with actin. Polyubiquitinated by RNF128 with ‘Lys-48’-linked chains, leading to proteasomal degradation.

Disease relevance. Immunodeficiency 8 with lymphoproliferation (IMD8) [MIM:615401] A disease of the immune system leading to recurrent infections, and characterized by CD4+ T-cells lymphopenia. Patients can develop B-cell lymphoproliferation associated with Epstein-Barr virus infection. The disease is caused by variants affecting the gene represented in this entry.

Similarity. Belongs to the WD repeat coronin family.

RefSeq proteins (2): NP_001180262, NP_009005* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001680	WD40_rpt	Repeat
IPR015048	DUF1899	Domain
IPR015049	Trimer_CC	Domain
IPR015505	Coronin	Family
IPR015943	WD40/YVTN_repeat-like_dom_sf	Homologous_superfamily
IPR019775	WD40_repeat_CS	Conserved_site
IPR036322	WD40_repeat_dom_sf	Homologous_superfamily

Pfam: PF00400, PF08953, PF08954, PF16300

UniProt features (21 total): repeat 7, modified residue 5, sequence variant 2, sequence conflict 2, initiator methionine 1, chain 1, coiled-coil region 1, compositionally biased region 1, region of interest 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P31146-F1	93.25	0.87

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (5): 2, 2, 412, 422, 449

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-9636383	Prevention of phagosomal-lysosomal fusion

MSigDB gene sets: 566 (showing top): GSE45365_NK_CELL_VS_CD11B_DC_DN, GSE45365_NK_CELL_VS_CD8A_DC_UP, GOBP_REGULATION_OF_CELL_ACTIVATION, ELVIDGE_HYPOXIA_DN, GOBP_REGULATION_OF_LEUKOCYTE_PROLIFERATION, GOBP_NEGATIVE_REGULATION_OF_NEURON_APOPTOTIC_PROCESS, GOBP_REGULATION_OF_VESICLE_FUSION, GOBP_REGULATION_OF_PROTEIN_POLYMERIZATION, WALLACE_PROSTATE_CANCER_RACE_UP, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, MCLACHLAN_DENTAL_CARIES_UP, GOBP_REGULATION_OF_CELL_MORPHOGENESIS, GOBP_CELL_CHEMOTAXIS, GOBP_VACUOLE_ORGANIZATION, GOBP_RESPONSE_TO_INTERLEUKIN_4

GO Biological Process (38): phagolysosome assembly (GO:0001845), calcium ion transport (GO:0006816), vesicle fusion (GO:0006906), phagocytosis (GO:0006909), actin filament organization (GO:0007015), regulation of cell shape (GO:0008360), epithelial cell migration (GO:0010631), cell migration (GO:0016477), actin cytoskeleton organization (GO:0030036), leukocyte chemotaxis (GO:0030595), regulation of actin filament polymerization (GO:0030833), negative regulation of vesicle fusion (GO:0031339), cell-substrate adhesion (GO:0031589), uropod organization (GO:0032796), regulation of actin cytoskeleton organization (GO:0032956), nerve growth factor signaling pathway (GO:0038180), T cell proliferation (GO:0042098), positive regulation of T cell proliferation (GO:0042102), T cell homeostasis (GO:0043029), natural killer cell degranulation (GO:0043320), negative regulation of neuron apoptotic process (GO:0043524), innate immune response (GO:0045087), homeostasis of number of cells within a tissue (GO:0048873), positive chemotaxis (GO:0050918), negative regulation of actin nucleation (GO:0051126), regulation of release of sequestered calcium ion into cytosol (GO:0051279), neuron apoptotic process (GO:0051402), obsolete early endosome to recycling endosome transport (GO:0061502), cellular response to interleukin-4 (GO:0071353), thymocyte migration (GO:0072679), positive regulation of T cell migration (GO:2000406), regulation of actin polymerization or depolymerization (GO:0008064), response to cytokine (GO:0034097), T cell activation (GO:0042110), positive regulation of T cell activation (GO:0050870), negative regulation of cellular component organization (GO:0051129), establishment of localization in cell (GO:0051649), T cell migration (GO:0072678)

GO Molecular Function (10): RNA binding (GO:0003723), actin binding (GO:0003779), actin monomer binding (GO:0003785), cytoskeletal protein binding (GO:0008092), myosin heavy chain binding (GO:0032036), protein homodimerization activity (GO:0042803), phosphatidylinositol 3-kinase binding (GO:0043548), actin filament binding (GO:0051015), protein binding (GO:0005515), identical protein binding (GO:0042802)

GO Cellular Component (23): immunological synapse (GO:0001772), phagocytic cup (GO:0001891), cytoplasm (GO:0005737), early endosome (GO:0005769), cytosol (GO:0005829), actin filament (GO:0005884), plasma membrane (GO:0005886), cell-cell junction (GO:0005911), membrane (GO:0016020), lamellipodium (GO:0030027), axon (GO:0030424), phagocytic vesicle membrane (GO:0030670), cortical actin cytoskeleton (GO:0030864), protein-containing complex (GO:0032991), phagocytic vesicle (GO:0045335), extracellular exosome (GO:0070062), glutamatergic synapse (GO:0098978), cytoskeleton (GO:0005856), cell cortex (GO:0005938), actin cytoskeleton (GO:0015629), cell leading edge (GO:0031252), cytoplasmic vesicle (GO:0031410), synapse (GO:0045202)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Suppression of phagosomal maturation	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	5
protein binding	3
vesicle organization	2
actin cytoskeleton organization	2
actin binding	2
plasma membrane	2
cytoplasm	2
actin cytoskeleton	2
cell periphery	2
phagocytosis	1
lysosome organization	1
organelle assembly	1
phagosome maturation	1
metal ion transport	1
vesicle-mediated transport	1
organelle membrane fusion	1
endocytosis	1
supramolecular fiber organization	1
regulation of cell morphogenesis	1
regulation of biological quality	1
ameboidal-type cell migration	1
epithelium migration	1
cell motility	1
cytoskeleton organization	1
actin filament-based process	1
leukocyte migration	1
cell chemotaxis	1
regulation of actin polymerization or depolymerization	1
actin filament polymerization	1
regulation of protein polymerization	1
vesicle fusion	1
negative regulation of organelle organization	1
regulation of vesicle fusion	1
negative regulation of transport	1
cell adhesion	1
plasma membrane bounded cell projection organization	1
regulation of actin filament-based process	1
regulation of cytoskeleton organization	1
neurotrophin signaling pathway	1
cellular response to nerve growth factor stimulus	1

Protein interactions and networks

STRING

3290 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CORO1A	CFL1	P23528	822
CORO1A	CFL2	Q9Y281	811
CORO1A	ATP6V0B	Q99437	676
CORO1A	WDR1	O75083	612
CORO1A	WIPF1	O43516	608
CORO1A	SH2D1A	O60880	589
CORO1A	MAGT1	Q9H0U3	555
CORO1A	GOLPH3	Q9H4A6	547
CORO1A	TMC8	Q8IU68	546
CORO1A	ITGB2	P05107	537
CORO1A	ARPC1B	O15143	535
CORO1A	TLR2	O60603	527
CORO1A	WAS	P42768	522
CORO1A	DOCK8	Q8NF50	522
CORO1A	ASPHD1	Q5U4P2	521

IntAct

106 interactions, top by confidence:

A	B	Type	Score
IFT57	CORO1A	psi-mi:“MI:0914”(association)	0.790
PRKACB	PRKAR1A	psi-mi:“MI:0914”(association)	0.790
CORO1A	FSD2	psi-mi:“MI:0915”(physical association)	0.780
FSD2	CORO1A	psi-mi:“MI:0915”(physical association)	0.780
TUBA1C	TXNDC9	psi-mi:“MI:0914”(association)	0.730
IFT57	IFT56	psi-mi:“MI:0914”(association)	0.640
CORO1A	GOLGA2	psi-mi:“MI:0915”(physical association)	0.560
GOLGA2	CORO1A	psi-mi:“MI:0915”(physical association)	0.560
COX4I1	DBT	psi-mi:“MI:0914”(association)	0.560
CORO1A	MAGEA11	psi-mi:“MI:0915”(physical association)	0.560
CORO1A	IFT20	psi-mi:“MI:0915”(physical association)	0.560
APP	CORO1A	psi-mi:“MI:0915”(physical association)	0.560
SLC25A41	NUDT19	psi-mi:“MI:0914”(association)	0.530
TMEM205	RBP4	psi-mi:“MI:0914”(association)	0.530
CORO1A	VARS1	psi-mi:“MI:0914”(association)	0.530
FOXA3	CORO1A	psi-mi:“MI:0914”(association)	0.530
RASSF8	CORO1A	psi-mi:“MI:0914”(association)	0.530
TMCC2	CORO1A	psi-mi:“MI:0914”(association)	0.530
CORO1A	STAT3	psi-mi:“MI:0915”(physical association)	0.510

BioGRID (224): CORO1A (Two-hybrid), FSD2 (Two-hybrid), CORO1A (Affinity Capture-MS), CORO1A (Affinity Capture-MS), CORO1A (Affinity Capture-MS), POC1B (Affinity Capture-MS), CORO6 (Affinity Capture-MS), CORO1B (Affinity Capture-MS), BICD2 (Affinity Capture-MS), IFT172 (Affinity Capture-MS), VARS (Affinity Capture-MS), RABGAP1L (Affinity Capture-MS), RABGAP1 (Affinity Capture-MS), IFT20 (Affinity Capture-MS), TRAF7 (Affinity Capture-MS)

ESM2 similar proteins: A5PK39, A8WGE3, B0R0D7, O89046, O89053, P31146, P49754, Q4R4J2, Q569Z1, Q5E9L7, Q5KU39, Q5MNZ6, Q5NVK4, Q5R7W0, Q5RJG1, Q5T5C0, Q5VZK9, Q5ZL16, Q640T2, Q66H99, Q68F45, Q6DJD8, Q6EDY6, Q6H8D5, Q6H8D6, Q6NVM6, Q6NYH1, Q7T0Q5, Q7ZUW6, Q8BH44, Q8C0P5, Q8K400, Q8NI36, Q8QFR2, Q91VM3, Q91W86, Q91ZN1, Q920J3, Q920Q4, Q92176

Diamond homologs: A8WGE3, B0R0D7, O13923, O89046, O89053, P27133, P31146, P57737, Q06440, Q21624, Q32LP9, Q4R4J2, Q54JS5, Q5NVK4, Q6DJD8, Q6QEF8, Q7K0L4, Q8BH44, Q8C0P5, Q91ZN1, Q920J3, Q920M5, Q92176, Q92828, Q9BR76, Q9ULV4, Q9UQ03, Q9WUM3, Q9WUM4, Q9XS70, A6ZPA9, A7TMF9, B3RNR8, B6QC56, B8N9H4, C5FWH1, C7Z6H2, F1LTR1, G0S8H7, O13637

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
CDK5	“up-regulates activity”	CORO1A	phosphorylation

Disease & clinical

Clinical variants and AI predictions

ClinVar

377 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	9
Likely pathogenic	9
Uncertain significance	132
Likely benign	204
Benign	8

Top pathogenic / likely-pathogenic (18)

Variant ID	HGVS	Classification
1074667	NC_000016.9:g.(?_30196531)_30199897del	Pathogenic
1381990	NM_007074.4(CORO1A):c.855_856del (p.Cys285fs)	Pathogenic
157509	NM_007074.4(CORO1A):c.1078del (p.Gln360fs)	Pathogenic
2104536	NM_007074.4(CORO1A):c.517G>T (p.Glu173Ter)	Pathogenic
3658357	NM_007074.4(CORO1A):c.3G>A (p.Met1Ile)	Pathogenic
40886	NM_007074.4(CORO1A):c.248_249del (p.Pro83fs)	Pathogenic
4291916	NM_007074.4(CORO1A):c.1060C>T (p.Arg354Ter)	Pathogenic
64645	NM_007074.4(CORO1A):c.400G>A (p.Val134Met)	Pathogenic
663029	NM_007074.4(CORO1A):c.674_677del (p.Arg225fs)	Pathogenic
1067675	NM_007074.4(CORO1A):c.1007+1G>A	Likely pathogenic
1480695	NM_007074.4(CORO1A):c.1065+2T>C	Likely pathogenic
1679822	NM_007074.4(CORO1A):c.189_190dup (p.Leu64fs)	Likely pathogenic
1696291	NM_007074.4(CORO1A):c.1278_1279insCC (p.Ser427fs)	Likely pathogenic
2058817	NM_007074.4(CORO1A):c.35G>T (p.Arg12Leu)	Likely pathogenic
2809851	NM_007074.4(CORO1A):c.756_756+1del	Likely pathogenic
3580046	NM_007074.4(CORO1A):c.696dup (p.Lys233fs)	Likely pathogenic
3771922	NM_007074.4(CORO1A):c.949C>T (p.Arg317Trp)	Likely pathogenic
4278190	NM_007074.4(CORO1A):c.382del (p.Glu128fs)	Likely pathogenic

SpliceAI

1761 predictions. Top by Δscore:

Variant	Effect	Δscore
16:30185200:T:TA	acceptor_gain	1.0000
16:30185205:CCA:C	acceptor_loss	1.0000
16:30185206:CA:C	acceptor_loss	1.0000
16:30185207:A:AC	acceptor_loss	1.0000
16:30185207:A:AG	acceptor_gain	1.0000
16:30185207:AGAAT:A	acceptor_gain	1.0000
16:30185208:G:GG	acceptor_gain	1.0000
16:30185208:GA:G	acceptor_gain	1.0000
16:30185208:GAA:G	acceptor_gain	1.0000
16:30185208:GAAT:G	acceptor_gain	1.0000
16:30185208:GAATG:G	acceptor_gain	1.0000
16:30186593:TTTA:T	acceptor_loss	1.0000
16:30186594:TTAG:T	acceptor_loss	1.0000
16:30186595:TAG:T	acceptor_loss	1.0000
16:30186596:A:AG	acceptor_gain	1.0000
16:30186596:AGACT:A	acceptor_gain	1.0000
16:30186597:G:GG	acceptor_gain	1.0000
16:30186597:GA:G	acceptor_gain	1.0000
16:30186597:GACT:G	acceptor_gain	1.0000
16:30186597:GACTG:G	acceptor_gain	1.0000
16:30186716:TCATG:T	donor_gain	1.0000
16:30186717:CATG:C	donor_gain	1.0000
16:30186719:TG:T	donor_gain	1.0000
16:30186719:TGGTG:T	donor_loss	1.0000
16:30186720:GG:G	donor_gain	1.0000
16:30186721:G:GA	donor_loss	1.0000
16:30186721:G:GG	donor_gain	1.0000
16:30186811:TGCA:T	acceptor_loss	1.0000
16:30186812:GCAG:G	acceptor_loss	1.0000
16:30186813:CA:C	acceptor_loss	1.0000

AlphaMissense

3000 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
16:30185246:C:G	H13D	1.000
16:30186694:A:C	S99R	1.000
16:30186696:T:A	S99R	1.000
16:30186696:T:G	S99R	1.000
16:30187460:T:C	F239L	1.000
16:30187462:C:A	F239L	1.000
16:30187462:C:G	F239L	1.000
16:30188249:G:C	K355N	1.000
16:30188249:G:T	K355N	1.000
16:30185240:T:C	F11L	0.999
16:30185241:T:C	F11S	0.999
16:30185242:C:A	F11L	0.999
16:30185242:C:G	F11L	0.999
16:30185243:C:A	R12S	0.999
16:30185248:C:A	H13Q	0.999
16:30185248:C:G	H13Q	0.999
16:30185250:T:A	V14E	0.999
16:30185252:T:C	F15L	0.999
16:30185254:T:A	F15L	0.999
16:30185254:T:G	F15L	0.999
16:30185256:G:A	G16E	0.999
16:30185338:C:A	N43K	0.999
16:30185338:C:G	N43K	0.999
16:30185352:C:A	A48D	0.999
16:30186629:T:A	V77D	0.999
16:30186664:T:A	W89R	0.999
16:30186664:T:C	W89R	0.999
16:30186689:T:A	I97N	0.999
16:30186692:C:A	A98D	0.999
16:30186700:T:C	S101P	0.999

dbSNP variants (sampled 300 via entrez): RS1000303536 (16:30185712 A>G), RS1000675240 (16:30185227 C>A), RS1001463429 (16:30186046 C>G), RS1001642782 (16:30186223 AC>A,ACC), RS1001716358 (16:30185950 A>G), RS1001806746 (16:30186455 C>A,T), RS1002648704 (16:30187730 C>G,T), RS1002872326 (16:30184206 C>T), RS1003192913 (16:30183023 C>G,T), RS1003538544 (16:30187695 T>A), RS1003675760 (16:30182720 C>A,T), RS1004644890 (16:30183185 CCGCGCCCCCCGCGCCCCT>C,CCGCGCCCCCCGCGCCCCTCGCGCCCCCCGCGCCCCT,CCGCGCCCCCCGCGCCCCTCGCGCCCCCCGCGCCCCTCGCGCCCCCCGCGCCCCT), RS1004988102 (16:30183287 C>T), RS1005060649 (16:30183170 G>C), RS1005996599 (16:30184754 C>T)

Disease associations

OMIM: gene MIM:605000 | disease phenotypes: MIM:615401

GenCC curated gene-disease

Disease	Classification	Inheritance
severe combined immunodeficiency due to CORO1A deficiency	Definitive	Autosomal recessive
epidermodysplasia verruciformis	Moderate	Autosomal recessive
autism spectrum disorder	Limited	Autosomal dominant

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
severe combined immunodeficiency due to CORO1A deficiency	Definitive	AR

Mondo (5): severe combined immunodeficiency due to CORO1A deficiency (MONDO:0014168), autism spectrum disorder (MONDO:0005258), sinoatrial node disorder (MONDO:0000469), severe combined immunodeficiency (MONDO:0015974), epidermodysplasia verruciformis (MONDO:0009176)

Orphanet (3): Severe combined immunodeficiency due to CORO1A deficiency (Orphanet:228003), Severe combined immunodeficiency (Orphanet:183660), NON RARE IN EUROPE: Autism (Orphanet:106)

HPO phenotypes

14 total (15 of 14 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000403	Recurrent otitis media
HP:0001263	Global developmental delay
HP:0001888	Decreased total lymphocyte count
HP:0002020	Gastroesophageal reflux
HP:0002721	Immunodeficiency
HP:0002783	Recurrent lower respiratory tract infections
HP:0002788	Recurrent upper respiratory tract infections
HP:0003593	Infantile onset
HP:0007018	Attention deficit hyperactivity disorder
HP:0009098	Chronic oral candidiasis
HP:0410295	Complete or near-complete absence of specific antibody response to tetanus vaccine
HP:0410300	Complete or near-complete absence of specific antibody response to unconjugated pneumococcus vaccine
HP:4000166	Post-vaccination varicella zoster virus infection
HP:0004430	Severe combined immunodeficiency

GWAS associations

4 associations (top):

Study	Trait	p-value
GCST003995_34	Tonsillectomy	4.000000e-08
GCST005014_42	Tonsillectomy	4.000000e-08
GCST007062_5	Hodgkin’s lymphoma	4.000000e-08
GCST010703_269	Brain morphology (MOSTest)	4.000000e-13

EFO canonical traits (2, from GWAS)

EFO ID	Trait name
EFO:0007924	tonsillectomy risk measurement
EFO:0004346	neuroimaging measurement

MeSH disease descriptors (2)

Descriptor	Name	Tree numbers
D004819	Epidermodysplasia Verruciformis	C01.925.256.650.810.345; C01.925.825.810.260; C01.925.928.914.345; C17.800.838.790.810.260
D016511	Severe Combined Immunodeficiency	C16.320.798.750; C16.614.815; C18.452.284.800; C20.673.795.750

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5169128 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

2 potent at pChembl≥5 of 4 total, top 2 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.29	Kd	50.69	nM	CHEMBL5653589
7.29	ED50	50.69	nM	CHEMBL5653589

PubChem BioAssay actives

1 with measured affinity, of 15 total; 1 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2148125: Binding affinity to human CORO1A incubated for 45 mins by Kinobead based pull down assay	kd	0.0507	uM

CTD chemical–gene interactions

59 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects cotreatment, increases expression, affects expression, increases methylation	8
Tretinoin	affects cotreatment, decreases expression, increases expression	5
sodium arsenite	increases expression	3
Cadmium Chloride	increases abundance, increases expression, decreases expression	3
bisphenol A	increases expression, affects cotreatment, affects expression, increases abundance	2
chromium hexavalent ion	decreases expression, increases abundance, increases expression	2
Silicon Dioxide	increases expression	2
GSK-J4	decreases expression	1
ginger extract	affects cotreatment, affects expression, increases abundance	1
triphenyl phosphate	affects expression	1
methylselenic acid	increases expression	1
tris(2-butoxyethyl) phosphate	affects expression	1
dimethylselenide	decreases expression, increases oxidation	1
beta-lapachone	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
butyraldehyde	increases expression	1
tetrabromobisphenol A	decreases expression	1
zinc chromate	increases abundance, decreases expression	1
rutecarpine	decreases expression	1
pentanal	increases expression	1
tamibarotene	increases expression	1
di-n-butylphosphoric acid	affects expression	1
CD 437	increases expression	1
deguelin	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	decreases expression	1
pyrachlostrobin	decreases expression	1
dorsomorphin	affects cotreatment, increases expression	1
pentabrominated diphenyl ether 100	decreases expression	1
(+)-JQ1 compound	increases expression	1

ChEMBL screening assays

12 unique, capped per target: 12 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5145238	Binding	Binding affinity to coronin-1A in human MDA-MB-453 cells measured after 6 hrs by pull-down assay	PES derivative PESA is a potent tool to globally profile cellular targets of PES. — Bioorg Med Chem Lett

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00391261	PHASE4	COMPLETED	An Open-label Trial of Metformin for Weight Control of Pediatric Patients on Antipsychotic Medications.
NCT01028820	PHASE4	COMPLETED	FMRI Brain Activation of Aripiprazole Treatment in Autism Spectrum Disorders
NCT01333865	PHASE4	COMPLETED	A Study of Memantine Hydrochloride (Namenda®) for Cognitive and Behavioral Impairment in Adults With Autism Spectrum Disorders
NCT01337700	PHASE4	COMPLETED	Milnacipran in Autism and the Functional Locus Coeruleus and Noradrenergic Model of Autism
NCT01695200	PHASE4	COMPLETED	Omega-3 Fatty Acids in Autism Spectrum Disorders
NCT02096952	PHASE4	COMPLETED	Methylphenidate ER Liquid Formulation in Adults With ASD and ADHD
NCT02235467	PHASE4	COMPLETED	Multisite Study: Parental Training Using Video Modelling to Develop Social Skills in Children With Autism
NCT02940574	PHASE4	COMPLETED	Neural and Behavioral Effects of Oxytocin in Autism Spectrum Disorders
NCT03333629	PHASE4	COMPLETED	Promoting Positive Outcomes for Individuals With ASD: Linking Early Detection, Treatment, and Long-term Outcomes
NCT03337646	PHASE4	COMPLETED	Evaluation of the Effect and Safety of Lisdexamfetamine in Children Aged 6-12 With ADHD and Autism
NCT03538431	PHASE4	COMPLETED	Improving Driving in Young People With Autism Spectrum Disorders
NCT03757585	PHASE4	COMPLETED	Natural Treatments for the Management of Emotional Dysregulation in Youth With Non-verbal Learning Disability (NVLD) and/or Autism Spectrum Disorders (ASD)
NCT04903353	PHASE4	COMPLETED	Pragmatic Trial Comparing Weight Gain in Children With Autism Taking Risperidone Versus Aripiprazole
NCT05063656	PHASE4	COMPLETED	Biomarker-Driven Pharmacological Treatment of Adolescents With Autism Spectrum Disorder With Gabapentin
NCT05146245	PHASE4	UNKNOWN	Safety and Pharmacokinetics of Antipsychotics in Children 2: Studying TDM in an RCT
NCT05916339	PHASE4	RECRUITING	AWARE: Management of ADHD in Autism Spectrum Disorder
NCT05954052	PHASE4	TERMINATED	A Study of Glutathione in Children With Autism Spectrum Disorder
NCT06853665	PHASE4	RECRUITING	The TEAM Study - Treatment Efficacy for Autism/Attention Using Mixed Amphetamine
NCT07054697	PHASE4	COMPLETED	Pilot-RCT With Individualized Homeopathic Treatment in the Children With Autism Spectrum Disorder
NCT07161804	PHASE4	COMPLETED	Pilot RCT Using Homeopathic Medicines in ASD
NCT07439042	PHASE4	NOT_YET_RECRUITING	Buspirone for Anxiety in Autistic Youth
NCT01302964	PHASE3	COMPLETED	Mirtazapine Treatment of Anxiety in Children and Adolescents With Pervasive Developmental Disorders
NCT01706523	PHASE3	TERMINATED	Open Label Extension Study of STX209 (Arbaclofen) in Autism Spectrum Disorders
NCT01825798	PHASE3	COMPLETED	Treatment of Overweight Induced by Antipsychotic Medication in Young People With Autism Spectrum Disorders (ASD)
NCT01972074	PHASE3	COMPLETED	Behavioral and Neural Response to Memantine in Adolescents With Autism Spectrum Disorder
NCT02985749	PHASE3	COMPLETED	A Study of Oxytocin for the Treatment of Social Impairment in Individuals With High Functioning Autism Spectrum Disorder
NCT03197922	PHASE3	COMPLETED	Treatment of Encopresis in Children With Autism Spectrum Disorders
NCT03504917	PHASE3	TERMINATED	A Study of Balovaptan in Adults With Autism Spectrum Disorder With a 2-Year Open-Label Extension
NCT03553875	PHASE3	TERMINATED	Memantine for the Treatment of Social Deficits in Youth With Disorders of Impaired Social Interactions
NCT03640156	PHASE3	COMPLETED	Modulating Socially Adaptive Mirror System Functioning in Autism by Oxytocin
NCT03715153	PHASE3	TERMINATED	Efficacy and Safety of Bumetanide Oral Liquid Formulation in Children Aged From 2 to Less Than 7 Years Old With Autism Spectrum Disorder.
NCT03715166	PHASE3	TERMINATED	Efficacy and Safety of Bumetanide Oral Liquid Formulation in Children and Adolescents Aged From 7 to Less Than 18 Years Old With Autism Spectrum Disorder
NCT04233502	PHASE3	WITHDRAWN	Efficacy and Safety of Slenyto for Insomnia in Children With ASD
NCT04578756	PHASE3	COMPLETED	Open-Label, Flexible-dose Study to Evaluate the Long-Term Safety and Tolerability of Cariprazine in the Treatment of Pediatric Participants With Schizophrenia, Bipolar I Disorder, or Autism Spectrum Disorder
NCT04623398	PHASE3	COMPLETED	Effect of Lithium in Patients With Autism Spectrum Disorder and Phelan-McDermid Syndrome (SHANK3 Haploinsufficiency)
NCT04725383	PHASE3	TERMINATED	Amitriptyline for Repetitive Behaviors in Autism Spectrum Disorders
NCT05212493	PHASE3	COMPLETED	The Effects of Medical Cannabis in Children With Autistic Spectrum Disorder
NCT05361707	PHASE3	UNKNOWN	Evaluating the Effects of Tasimelteon in Individuals With Autism Spectrum Disorder (ASD) and Sleep Disturbances
NCT05439616	PHASE3	COMPLETED	Study of Cariprazine Oral Capsules or Solution to Assess Adverse Events and Change in Irritability Due to Autism Spectrum Disorder (ASD) in Participants Aged 5-17 Years With ASD
NCT06229210	PHASE3	RECRUITING	Safety and Tolerability Trial of Lumateperone in Pediatric Patients With Schizophrenia, Bipolar Disorder or Autism Spectrum Disorder