CPEB1

Summary

CPEB1 (cytoplasmic polyadenylation element binding protein 1, HGNC:21744) is a protein-coding gene on chromosome 15q25.2, encoding Cytoplasmic polyadenylation element-binding protein 1 (Q9BZB8). Sequence-specific RNA-binding protein that regulates mRNA cytoplasmic polyadenylation and translation initiation during oocyte maturation, early development and at postsynapse sites of neurons.

This gene encodes a member of the cytoplasmic polyadenylation element binding protein family. This highly conserved protein binds to a specific RNA sequence, called the cytoplasmic polyadenylation element, found in the 3’ untranslated region of some mRNAs. The encoded protein functions in both the cytoplasm and the nucleus. It is involved in the regulation of mRNA translation, as well as processing of the 3’ untranslated region, and may play a role in cell proliferation and tumorigenesis. Alternative splicing results in multiple transcript variants.

Source: NCBI Gene 64506 — RefSeq curated summary.

At a glance

• GWAS associations: 9
• Clinical variants (ClinVar): 71 total
• Regional missense constraint (gnomAD): 2 of 6 regions constrained (≈5% of expected missense variation)
• GTEx eGene: eQTL in 30 tissues, sQTL in 5 (q < 0.05)
• Constraint (gnomAD): pLI 1.00 (loss-of-function intolerant), LOEUF 0.18 (highly constrained)
• MANE Select transcript: NM_001365242
• Notable: 71 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:21744
Approved symbol	CPEB1
Name	cytoplasmic polyadenylation element binding protein 1
Location	15q25.2
Locus type	gene with protein product
Status	Approved
Aliases	FLJ13203, CPEB
Ensembl gene	ENSG00000214575
Ensembl biotype	protein_coding
OMIM	607342
Entrez	64506

Gene structure

Transcript identifiers

Ensembl transcripts: 25 — 20 protein_coding, 2 protein_coding_CDS_not_defined, 2 retained_intron, 1 nonsense_mediated_decay

MANE Select: ENST00000684509

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 4, TSL 2: 6, TSL 3: 2, TSL 4: 3, TSL 5: 3

ENST00000684509, ENST00000563519, ENST00000566716, ENST00000567678, ENST00000568994, ENST00000569257, ENST00000570205, ENST00000611031, ENST00000611163, ENST00000614918, ENST00000614977, ENST00000615198, ENST00000616959, ENST00000617462, ENST00000617522, ENST00000617958, ENST00000618449, ENST00000618698, ENST00000620182, ENST00000902789, ENST00000902790, ENST00000902791, ENST00000902792, ENST00001009771, ENST00001009772

RefSeq mRNA: 35 — MANE Select: NM_001365242 NM_001079533, NM_001079534, NM_001079535, NM_001288819, NM_001288820, NM_001365240, NM_001365241, NM_001365242, NM_001365243, NM_001365244, NM_001365245, NM_001365246, NM_001365247, NM_001365248, NM_001365249, NM_001365250, NM_001387061, NM_001387062, NM_001387063, NM_001387064, NM_001387065, NM_001387066, NM_001387067, NM_001387068, NM_001387069, NM_001387070, NM_001387071, NM_001387072, NM_001387073, NM_001387074, NM_001387075, NM_001387076, NM_001387077, NM_001387078, NM_030594

CCDS: CCDS42072, CCDS45329, CCDS45330, CCDS92050

Canonical transcript exons

ENST00000632305 — 0 exons

Expression profiles

Bgee: expression breadth ubiquitous, 132 present calls, max score 94.40.

FANTOM5 (CAGE): breadth broad, TPM avg 3.3180 / max 60.0314, expressed in 868 samples.

Highest expression (Bgee): male germ line stem cell (sensu Vertebrata) in testis, C1 segment of cervical spinal cord, pituitary gland, adenohypophysis, Brodmann (1909) area 9.

Genetic regulation across tissues (GTEx eQTL / sQTL)

CPEB1 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 30 tissues and its splicing (sQTL) in 5 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 35 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Thyroid	eqtl	2.0e-16	+0.31	15:82720688:A:G
Esophagus Muscularis	eqtl	1.0e-15	+0.26	15:82737476:T:C
Esophagus Gastroesophageal Junction	eqtl	1.2e-13	-0.26	15:82396424:C:G
Nerve Tibial	eqtl	1.2e-12	+0.19	15:82720688:A:G
Muscle Skeletal	eqtl	3.7e-12	+0.36	15:82734974:C:T
Brain Cerebellum	sqtl	3.2e-11	+0.86	15:82697158:C:T
Artery Tibial	eqtl	1.1e-10	-0.18	15:82438114:A:AGTTTTT
Colon Transverse	eqtl	1.2e-10	+0.17	15:82720688:A:G
Artery Aorta	eqtl	2.8e-08	-0.24	15:82417894:T:G
Adipose Subcutaneous	eqtl	1.3e-07	-0.14	15:82627794:A:T
Esophagus Mucosa	eqtl	2.5e-07	+0.17	15:82716625:A:G
Colon Sigmoid	eqtl	1.2e-06	+0.23	15:82133829:G:C
Adipose Visceral Omentum	eqtl	2.4e-06	+0.19	15:82702814:A:G
Cells Cultured fibroblasts	eqtl	2.2e-04	+0.12	15:82690920:T:TGCTGGGATTACAGGCATGAGCCAC
Breast Mammary Tissue	eqtl	2.3e-04	+0.16	15:82674020:A:G
Brain Frontal Cortex BA9	eqtl	5.7e-04	-0.19	15:82621387:C:T
Brain Cortex	sqtl	6.8e-04	-0.58	15:82630710:C:T
Brain Frontal Cortex BA9	sqtl	2.7e-03	-0.59	15:82571543:A:C
Testis	eqtl	3.9e-03	-0.09	15:82195898:A:T
Brain Hippocampus	eqtl	5.4e-03	-0.18	15:82214561:G:T

FANTOM5 promoters

showing 10 of 11 alternative TSS:

Promoter ID	TPM avg	Samples expressed
151251	0.9726	466
151248	0.8639	370
151255	0.5796	202
151249	0.2288	131
151256	0.2091	98
151250	0.1671	90
151258	0.1047	46
151259	0.0820	41
151257	0.0609	28
151253	0.0316	17

Top tissues by expression

showing 100 of 134 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	94.40	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	93.08	gold quality
pituitary gland	UBERON:0000007	90.87	gold quality
adenohypophysis	UBERON:0002196	90.82	gold quality
Brodmann (1909) area 9	UBERON:0013540	90.24	gold quality
testis	UBERON:0000473	90.16	gold quality
right testis	UBERON:0004534	89.98	gold quality
corpus callosum	UBERON:0002336	89.94	gold quality
superior frontal gyrus	UBERON:0002661	89.57	gold quality
left testis	UBERON:0004533	89.30	gold quality
substantia nigra	UBERON:0002038	89.22	gold quality
hypothalamus	UBERON:0001898	89.17	gold quality
prefrontal cortex	UBERON:0000451	88.85	gold quality
frontal cortex	UBERON:0001870	88.67	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	88.37	gold quality
right frontal lobe	UBERON:0002810	88.30	gold quality
right hemisphere of cerebellum	UBERON:0014890	88.30	gold quality
primary visual cortex	UBERON:0002436	88.26	gold quality
cerebellar hemisphere	UBERON:0002245	87.95	gold quality
cerebellar cortex	UBERON:0002129	87.90	gold quality
cerebellum	UBERON:0002037	87.86	gold quality
cerebral cortex	UBERON:0000956	87.62	gold quality
Ammon’s horn	UBERON:0001954	87.62	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	86.87	gold quality
anterior cingulate cortex	UBERON:0009835	86.65	gold quality
brain	UBERON:0000955	86.64	gold quality
temporal lobe	UBERON:0001871	83.88	gold quality
amygdala	UBERON:0001876	83.82	gold quality
nucleus accumbens	UBERON:0001882	83.29	gold quality
putamen	UBERON:0001874	83.05	gold quality
caudate nucleus	UBERON:0001873	82.63	gold quality
tibial nerve	UBERON:0001323	82.14	gold quality
mucosa of stomach	UBERON:0001199	81.84	gold quality
right uterine tube	UBERON:0001302	81.52	gold quality
endocervix	UBERON:0000458	80.75	gold quality
right ovary	UBERON:0002118	79.26	gold quality
urinary bladder	UBERON:0001255	78.89	gold quality
ovary	UBERON:0000992	78.82	gold quality
left ovary	UBERON:0002119	78.75	gold quality
uterine cervix	UBERON:0000002	77.98	gold quality
muscle layer of sigmoid colon	UBERON:0035805	77.97	gold quality
ectocervix	UBERON:0012249	77.92	gold quality
fallopian tube	UBERON:0003889	77.90	gold quality
islet of Langerhans	UBERON:0000006	77.08	gold quality
calcaneal tendon	UBERON:0003701	76.78	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	76.52	gold quality
stromal cell of endometrium	CL:0002255	76.30	gold quality
body of uterus	UBERON:0009853	76.07	gold quality
smooth muscle tissue	UBERON:0001135	75.81	gold quality
vagina	UBERON:0000996	75.70	gold quality
right adrenal gland	UBERON:0001233	75.46	gold quality
gall bladder	UBERON:0002110	75.37	gold quality
right adrenal gland cortex	UBERON:0035827	75.37	gold quality
lower esophagus muscularis layer	UBERON:0035833	74.64	gold quality
lower esophagus	UBERON:0013473	74.59	gold quality
left adrenal gland	UBERON:0001234	74.04	gold quality
popliteal artery	UBERON:0002250	73.88	gold quality
tibial artery	UBERON:0007610	73.85	gold quality
left adrenal gland cortex	UBERON:0035825	73.69	gold quality
sural nerve	UBERON:0015488	73.53	gold quality
fundus of stomach	UBERON:0001160	73.39	gold quality
right coronary artery	UBERON:0001625	73.27	gold quality
left uterine tube	UBERON:0001303	73.08	gold quality
adrenal gland	UBERON:0002369	73.06	gold quality
hindlimb stylopod muscle	UBERON:0004252	72.67	gold quality
descending thoracic aorta	UBERON:0002345	72.66	gold quality
myometrium	UBERON:0001296	72.62	gold quality
ascending aorta	UBERON:0001496	72.54	gold quality
thoracic aorta	UBERON:0001515	72.54	gold quality
multicellular organism	UBERON:0000468	72.17	gold quality
colon	UBERON:0001155	71.94	gold quality
endometrium	UBERON:0001295	71.32	gold quality
rectum	UBERON:0001052	70.90	gold quality
muscle tissue	UBERON:0002385	70.47	gold quality
left coronary artery	UBERON:0001626	70.37	gold quality
gastrocnemius	UBERON:0001388	70.28	gold quality
intestine	UBERON:0000160	70.15	gold quality
omental fat pad	UBERON:0010414	70.10	gold quality
right atrium auricular region	UBERON:0006631	70.06	gold quality
adipose tissue	UBERON:0001013	70.05	gold quality
subcutaneous adipose tissue	UBERON:0002190	70.02	gold quality
muscle of leg	UBERON:0001383	69.97	gold quality
thoracic mammary gland	UBERON:0005200	69.15	gold quality
skeletal muscle tissue	UBERON:0001134	69.07	gold quality
esophagus	UBERON:0001043	68.79	gold quality
transverse colon	UBERON:0001157	68.46	gold quality
pancreas	UBERON:0001264	67.85	gold quality
skin of leg	UBERON:0001511	66.81	gold quality
prostate gland	UBERON:0002367	66.74	gold quality
small intestine	UBERON:0002108	66.56	gold quality
thyroid gland	UBERON:0002046	66.48	gold quality
body of stomach	UBERON:0001161	66.46	gold quality
small intestine Peyer’s patch	UBERON:0003454	66.32	gold quality
apex of heart	UBERON:0002098	66.31	gold quality
stomach	UBERON:0000945	66.23	gold quality
vermiform appendix	UBERON:0001154	66.14	gold quality
zone of skin	UBERON:0000014	65.93	gold quality
left lobe of thyroid gland	UBERON:0001120	65.79	gold quality
cortex of kidney	UBERON:0001225	65.74	gold quality
right lobe of thyroid gland	UBERON:0001119	65.64	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 0.

Experiment	Marker?	Max mean expression
E-ANND-3	no	2.03
E-MTAB-6379	no	0.40

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 76 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM
Locus coeruleus	tissue	68.4
Postcentral gyrus	tissue	42.3
Spinal cord	tissue	40.9
Hippocampus	tissue	37.9
Hippocampal formation	tissue	30.7
Testis	tissue	30.4
Medulla oblongata	tissue	30.3
Pons	tissue	28.8
Nucleus accumbens	tissue	28.6
Substantia nigra	tissue	27.3
Choroid plexus	tissue	26.4
Midbrain	tissue	24.4
Hypothalamus	tissue	23.0
Prefrontal cortex	tissue	22.9
Cerebral cortex	tissue	22.9
Motor cortex	tissue	22.8
Corpus callosum	tissue	22.8
Thalamus	tissue	22.7
Somatosensory cortex	tissue	22.7
Frontal cortex	tissue	22.5
Retrosplenial and cingulate cortex	tissue	21.9
Insular cortex	tissue	20.7
Occipital cortex	tissue	20.6
Superior colliculi	tissue	20.4
Retrosplenial cortex	tissue	20.1
Temporal cortex	tissue	20.1
Periaqueductal gray	tissue	19.9
Pituitary gland	tissue	19.4
Entorhinal cortex	tissue	18.7
Olfactory bulb	tissue	18.2
Amygdala	tissue	17.2
Septum	tissue	16.6
Ventral forebrain	tissue	16.0
Cerebellum	tissue	14.7
Putamen	tissue	11.5
Basal ganglia	tissue	10.8
Caudate putamen	tissue	10.6
Tongue	tissue	9.8
Ovary	tissue	8.8
Fallopian tube	tissue	7.8
Epididymis	tissue	7.4
Vagina	tissue	5.5
Retina	tissue	4.9
Adrenal gland	tissue	4.7
Cervix	tissue	4.2
Gallbladder	tissue	3.7
Endometrium 1	tissue	3.6
Seminal vesicle	tissue	3.5
Urinary bladder	tissue	3.4
Esophagus	tissue	3.3
Smooth muscle	tissue	3.2
Heart muscle	tissue	2.7
Skeletal muscle	tissue	2.4
Rectum	tissue	2.3
Thyroid gland	tissue	2.2
Prostate	tissue	2.2
Colon	tissue	1.9
Breast	tissue	1.6
Adipose tissue	tissue	1.6
Pancreas	tissue	1.6

Brain sub-regions (HPA Brain Atlas): detected in 189; highest nTPM — Parieto-temporal junction (white matter) (83.6), Dorsal funiculus (white matter) (74.9), Corpus callosum, splenium (white matter) (69.1), Temporal white matter (66.0), Cerebellar white matter (65.7).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): EED, EZH2

miRNA regulators (miRDB)

Targeting CPEB1 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 164 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-12118	100.00	65.88	1270
HSA-MIR-3646	100.00	73.56	5283
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-6759-5P	99.99	66.54	785
HSA-MIR-548AW	99.99	72.57	3559
HSA-LET-7A-5P	99.98	72.29	1790
HSA-LET-7B-5P	99.98	72.31	1790
HSA-LET-7C-5P	99.98	72.29	1790
HSA-LET-7E-5P	99.98	72.29	1790
HSA-LET-7F-5P	99.98	72.56	1784
HSA-LET-7G-5P	99.98	72.37	1784
HSA-LET-7I-5P	99.98	72.37	1788
HSA-MIR-98-5P	99.98	72.33	1787
HSA-MIR-12136	99.98	72.81	5713
HSA-MIR-6891-5P	99.98	66.53	1372
HSA-MIR-3173-3P	99.98	66.49	1217
HSA-MIR-607	99.97	73.62	5593
HSA-MIR-6793-5P	99.97	65.95	758
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-LET-7D-5P	99.96	71.76	1632
HSA-MIR-4458	99.96	71.64	1650
HSA-MIR-302E	99.96	70.74	2669
HSA-MIR-570-3P	99.96	72.41	4910
HSA-MIR-1468-3P	99.96	72.74	3797
HSA-MIR-96-5P	99.95	72.80	2140
HSA-MIR-548J-3P	99.94	72.61	4881
HSA-MIR-548AE-3P	99.93	72.66	4867

Functional genomics

gnomAD constraint: pLI 1, LOEUF 0.177, missense Z 2.68 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000684509 splits into 6 regions with different missense tolerance; 2 are missense-constrained (≈5% of the expected missense variation). Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
15:82,544,595–82,549,539	98 / 157.6	0.62	no
15:82,549,540–82,549,579	0 / 17.4	0.00	yes (p 3.0e-05)
15:82,549,580–82,553,947	99 / 161.3	0.61	no
15:82,553,948–82,557,778	128 / 129.1	0.99	no
15:82,557,779–82,557,824	3 / 18.2	0.16	yes (p 3.6e-04)
15:82,557,825–82,628,459	223 / 228.6	0.98	no

Literature-anchored findings (GeneRIF, showing 35)

• CPEB1 has a role in compartmentalization of mRNA metabolism in the cytoplasm, between dcp1 bodies and stress granules (PMID:15731006)
• Results show that CPEB1 is continuously shuttling between nucleus and cytoplasm, and its export is controlled by two redundant motifs dependent on the nuclear export receptor Crm1. (PMID:18923137)
• CPEB controls senescence and bioenergetics in human cells at least in part by modulating p53 mRNA polyadenylation-induced translation (PMID:19141477)
• U6snRNA, GAPDH mRNA and CPEB1 mRNA levels may be useful as tumor markers for genital cancers. (PMID:19161537)
• The authors show that the human CPEB1 can repress the activity of the reporter construct containing the HPV-16 early sequences. This repression can be counteracted by a human cytoplasmic poly(A) polymerase, hGLD-2 fused to CPEB1. (PMID:20144904)
• The loss of function CPEB1 protein would enhance tumorigenesis by promoting the survival of rapidly dividing and hypermetabolic tumor cells as levels of available nutrients decline. (PMID:20339377)
• Gld4, a second non-canonical poly(A) polymerase, was found to regulate p53 mRNA polyadenylation/translation in a CPEB-dependent manner (PMID:21478871)
• The first evidence of CPEB1 involvement in GC is presented, along with the molecular mechanism underlying the regulation of its expression and its potential role in invasion and angiogenesis. (PMID:22052064)
• depleted of CPEB demonstrated that this protein directly regulates the translation of PTEN and Stat3 mRNAs. Our results show that CPEB regulated translation is a key process involved in insulin signaling (PMID:22253608)
• CPEB-mediated zonal occludens-1 mRNA localization is essential for tight-junction assembly and mammary epithelial cell polarity (PMID:22334078)
• poly(A) polymerase Gld2, deadenylase PARN, and translation inhibitory factor neuroguidin (Ngd) are components of a dendritic CPEB-associated polyadenylation apparatus (PMID:22727665)
• CPEB accelerates deadenylation and decay of the c-myc mRNA by recruiting the Tob-Caf1 complex. (PMID:23178487)
• results reveal a novel function of CPEB1 in mediating alternative 3’-UTR processing, which is coordinated with regulation of mRNA translation, through its dual nuclear and cytoplasmic functions (PMID:23434754)
• The structural similarity to other ZZ domains suggests that the CPEB1-ZZ domain recruits sumoylated proteins during assembly of the ribonucleoprotein complex prior to mRNA export from the nucleus. (PMID:23500490)
• Downregulation of CPEB1 induces senescence of glioma cells in a p53-dependent manner. (PMID:23788032)
• FMRP and CPEB1, an activator of translation, are present in neuronal dendrites, are predicted to bind many of the same mRNAs and may mediate a translational homeostasis that, when imbalanced, results in fragile X syndrome. (PMID:24141422)
• Results suggest that CPEB1-mediated translational control is essential for the differentiation of GSCs. (PMID:25216517)
• CPEB1, 2, and 4, are essential to successful mitotic cell division. (PMID:26398195)
• CPEB1 regulation of MMP9 mRNA expression mediates metastasis of breast cancer cells (PMID:26411364)
• Structural Analysis of the Pin1-CPEB1 interaction and its potential role in CPEB1 degradation has been described. (PMID:26456073)
• Identify a mechanism of VEGF overexpression in liver and mesentery that promotes pathologic, but not physiologic, angiogenesis, via sequential and nonredundant functions of CPEB1 and CPEB4. (PMID:26627607)
• Expression levels of CPEB4 and CPEB1 genes are correlated with overall survival in patients with glioma. (PMID:27000226)
• WEE1 is regulated at the translational level by CPEB1 and miR-15b in a coordinated and cell-cycle-dependent manner. (PMID:27027998)
• This mechanical catalysis makes possible a positive feedback loop that would help localize the formation of CPEB fibers to active synapse areas and mark those synapses for forming a long-term memory after the prion form is established. The functional role of the CPEB helical oligomers in this mechanism carries with it implications for targeting such species in neurodegenerative diseases. (PMID:27091989)
• Upon binding to p27(Kip1) 3’UTR, CPEB1 promotes elongation of poly-A tail and the subsequent translation of p27(Kip1) mRNA. This leads to higher levels of p27(Kip1) in the cell, in turn significantly inhibiting cell proliferation, and confers to CPEB1 a potential value as a tumor suppressor in Glioblastoma. (PMID:27142352)
• The host RNA-binding protein CPEB1 was highly induced after cytomegalovirus infection and ectopic expression of CPEB1 in non-infected cells recapitulated infection-related post-transcriptional changes. CPEB1 was also required for poly(A)-tail lengthening of viral RNAs important for productive infection. (PMID:27775709)
• These findings indicated that the overexpression of miR4543p inhibited cell proliferation, migration and invasion by downregulating CPEB1. (PMID:30106109)
• study identifies CPEB1 as a potential regulator of disease progression of Posttraumatic Ankle Osteoarthritis (PMID:30411210)
• Study revealed that CPEB1 depletion might play an anti-inflammatory and antiapoptotic role in Ox-LDL-induced apoptosis and inflammation though SIRT1/LOX-1 signalling pathway. (PMID:31521690)
• CPEB1 and CPEB4 are involved in the regulation of the TAK1 and Smad signalings in human macrophages and dermal fibroblasts (PMID:32113875)
• CPEB1 deletion is not a common explanation for premature ovarian insufficiency in a Chinese cohort. (PMID:32354341)
• Estrogen promotes increased breast cancer cell proliferation and migration through downregulation of CPEB1 expression. (PMID:33162033)
• DNA hypermethylation contributes to colorectal cancer metastasis by regulating the binding of CEBPB and TFCP2 to the CPEB1 promoter. (PMID:33892791)
• CPEB alteration and aberrant transcriptome-polyadenylation lead to a treatable SLC19A3 deficiency in Huntington’s disease. (PMID:34586830)
• CPEB1 Controls NRF2 Proteostasis and Ferroptosis Susceptibility in Pancreatic Cancer. (PMID:38904009)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	cpeb1b	ENSDARG00000008454
danio_rerio	cpeb1a	ENSDARG00000045932
mus_musculus	Cpeb1	ENSMUSG00000025586
rattus_norvegicus	Cpeb1	ENSRNOG00000019161
drosophila_melanogaster	orb	FBGN0004882
caenorhabditis_elegans	cpb-3	WBGENE00000772

Paralogs (3): CPEB3 (ENSG00000107864), CPEB4 (ENSG00000113742), CPEB2 (ENSG00000137449)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:108442) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 13 distinct phenotype terms.

Mouse phenotype (MP)	Records
reduced male fertility	1
female infertility	1
abnormal gametogenesis	1
abnormal reproductive system morphology	1
abnormal fertility/fecundity	1
abnormal long-term potentiation	1
oligozoospermia	1
absent ovary	1
abnormal ovary development	1
decreased testis weight	1
abnormal female meiosis	1
arrest of male meiosis	1
increased male germ cell apoptosis	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Pongo abelii	Q5R733	98.4%	Diamond
Xenopus laevis	Q52KN7	96.8%	Diamond
Carassius auratus	Q9DED5	95.3%	Diamond
Xenopus tropicalis	Q28CH2	86.0%	Diamond
Caenorhabditis remanei	Q6E3C9	70.6%	Diamond
Caenorhabditis briggsae	Q6E3D5	70.6%	Diamond
Aplysia californica	Q967R6	66.8%	Diamond
Caenorhabditis japonica	Q6E3F0	65.4%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
CPEB1-AS1	ncRNA	283692
RPS17	protein-coding	6218
AP3B2	protein-coding	8120
SNHG21	ncRNA	100505616
FSD2	protein-coding	123722
SCARNA15	ncRNA	677778

Protein

Protein identifiers

Cytoplasmic polyadenylation element-binding protein 1 — Q9BZB8 (reviewed: Q9BZB8)

All UniProt accessions (9): Q9BZB8, A0A024R214, A0A087WUQ9, A0A087WVR7, A0A087WXG7, A0A087X171, H3BNX1, H3BPD6, H3BTE4

UniProt curated annotations — full annotation on UniProt →

Function. Sequence-specific RNA-binding protein that regulates mRNA cytoplasmic polyadenylation and translation initiation during oocyte maturation, early development and at postsynapse sites of neurons. Binds to the cytoplasmic polyadenylation element (CPE), an uridine-rich sequence element (consensus sequence 5’-UUUUUAU-3’) within the mRNA 3’-UTR. RNA binding results in a clear conformational change analogous to the Venus fly trap mechanism. In absence of phosphorylation and in association with TACC3 is also involved as a repressor of translation of CPE-containing mRNA; a repression that is relieved by phosphorylation or degradation. Involved in the transport of CPE-containing mRNA to dendrites; those mRNAs may be transported to dendrites in a translationally dormant form and translationally activated at synapses. Its interaction with APLP1 promotes local CPE-containing mRNA polyadenylation and translation activation. Induces the assembly of stress granules in the absence of stress. Required for cell cycle progression, specifically for prophase entry.

Subunit / interactions. Interacts with kinesin, dynein, APLP1, APLP2, TENT2/GLD2 and APP. Both phosphorylated and non phosphorylated forms interact with APLP1. Interacts with TENT4B; the interaction is required for TENT4B-mediated translational control.

Subcellular location. Cytoplasm. Nucleus. P-body. Cytoplasmic granule. Synapse. Membrane. Postsynaptic density. Cell projection. Dendrite.

Tissue specificity. Isoform 1 is expressed in immature oocytes, ovary, brain and heart. Isoform 2 is expressed in brain and heart. Isoform 3 and isoform 4 are expressed in brain. Expressed in breast tumors and several tumor cell lines.

Post-translational modifications. Phosphorylated on serine/threonine residues by AURKA within positions 166 and 197. Phosphorylation and dephosphorylation on Thr-172 regulates cytoplasmic polyadenylation and translation of CPE-containing mRNAs. Phosphorylation on Thr-172 by AURKA and CAMK2A activates CPEB1. Phosphorylation on Thr-172 may be promoted by APLP1. Phosphorylation increases binding to RNA.

Domain organisation. The 2 RRM domains and the C-terminal region mediate interaction with CPE-containing RNA. The interdomain linker (411-429) acts as a hinge to fix the relative orientation of the 2 RRMs. The ZZ domain (509-566) coordinates 2 Zn ions and is probably implicated in mediating interactions with other proteins in addition to increasing the affinity of the RRMs for the CPEs. A continuous hydrophobic interface is formed between the 2 RRMs.

Similarity. Belongs to the RRM CPEB family.

Isoforms (4)

UniProt ID	Names	Canonical?
Q9BZB8-1	1, hCPEB long, hCPEBg	yes
Q9BZB8-2	2, hCPEB short, hCPEBs
Q9BZB8-3	3
Q9BZB8-4	4

RefSeq proteins (35): NP_001073001, NP_001073002, NP_001073003, NP_001275748, NP_001275749, NP_001352169, NP_001352170, NP_001352171, NP_001352172, NP_001352173, NP_001352174, NP_001352175, NP_001352176, NP_001352177, NP_001352178, NP_001352179, NP_001373990, NP_001373991, NP_001373992, NP_001373993, NP_001373994, NP_001373995, NP_001373996, NP_001373997, NP_001373998, NP_001373999, NP_001374000, NP_001374001, NP_001374002, NP_001374003, NP_001374004, NP_001374005, NP_001374006, NP_001374007, NP_085097 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000504	RRM_dom	Domain
IPR012677	Nucleotide-bd_a/b_plait_sf	Homologous_superfamily
IPR032292	CEBP1_N	Domain
IPR032296	CEBP_ZZ	Domain
IPR034819	CPEB	Family
IPR034977	CPEB1_RRM1	Domain
IPR035979	RBD_domain_sf	Homologous_superfamily
IPR038446	CEBP_ZZ_sf	Homologous_superfamily

Pfam: PF16366, PF16367, PF16368

UniProt features (60 total): strand 20, helix 9, binding site 8, mutagenesis site 4, turn 4, splice variant 3, domain 2, modified residue 2, sequence variant 2, region of interest 2, chain 1, site 1, sequence conflict 1, compositionally biased region 1

Structure

Experimental structures (PDB)

5 structures by resolution:

PDB	Title	Method	Resolution (Å)
2M13	The ZZ domain of cytoplasmic polyadenylation element binding protein 1 (CPEB1)	SOLUTION NMR
2MKE	Solution structure of CPEB1 ZZ domain in the free state	SOLUTION NMR
2MKH	Solution structure of tandem RRM domains of cytoplasmic polyadenylation element binding …	SOLUTION NMR
2MKK	Structural model of tandem RRM domains of cytoplasmic polyadenylation element binding …	SOLUTION NMR
2N1O	PIN1 WW domain in complex with a phosphorylated CPEB1 derived peptide	SOLUTION NMR

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9BZB8-F1	66.05	0.38

Human Protein Atlas

Protein class: Predicted intracellular proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): cytosol; nucleoplasm

Antibody reliability (HPA): IF supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1)

Position	Role
411	important for the positioning of rrm1 relative to rrm2

Ligand- & substrate-binding residues (8)

Position	Role
537	Zn(2+)
540	Zn(2+)
545	Zn(2+)
553	Zn(2+)
515	Zn(2+)
518	Zn(2+)
527	Zn(2+)
532	Zn(2+)

Post-translational modifications (2)

Type	Positions
Phosphoserine	43
Phosphothreonine	172

Mutagenesis-validated functional residues (4)

Position	Phenotype
172	does not affect its localization.
314	abolishes stress granule assembly and correct localization in dcp1 bodies.
545	abolishes stress granule assembly and correct localization in dcp1 bodies.

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 0; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

MSigDB gene sets: 248 (showing top): GOBP_CYTOPLASMIC_TRANSLATION, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, GOBP_RESPONSE_TO_ACID_CHEMICAL, GAUSSMANN_MLL_AF4_FUSION_TARGETS_G_DN, KEGG_DORSO_VENTRAL_AXIS_FORMATION, GOBP_CELLULAR_RESPONSE_TO_ACID_CHEMICAL, GOBP_CELLULAR_RESPONSE_TO_OXYGEN_CONTAINING_COMPOUND, MOLENAAR_TARGETS_OF_CCND1_AND_CDK4_UP, GOBP_CELLULAR_RESPONSE_TO_INSULIN_STIMULUS, GOBP_NEGATIVE_REGULATION_OF_TRANSLATION, GOBP_TRANSLATION, GTGCCTT_MIR506, GOBP_POST_TRANSCRIPTIONAL_REGULATION_OF_GENE_EXPRESSION, AGCGCTT_MIR518F_MIR518E_MIR518A, GOMF_TRANSLATION_REGULATOR_ACTIVITY

GO Biological Process (9): mRNA processing (GO:0006397), regulation of mRNA 3’-end processing (GO:0031440), cellular response to insulin stimulus (GO:0032869), cellular response to amino acid stimulus (GO:0071230), cellular response to hypoxia (GO:0071456), negative regulation of cytoplasmic translation (GO:2000766), translation (GO:0006412), regulation of translation (GO:0006417), negative regulation of translation (GO:0017148)

GO Molecular Function (10): mRNA regulatory element binding translation repressor activity (GO:0000900), mRNA 3’-UTR binding (GO:0003730), translation factor activity, RNA binding (GO:0008135), mRNA 3’-UTR AU-rich region binding (GO:0035925), ribosome binding (GO:0043022), metal ion binding (GO:0046872), nucleic acid binding (GO:0003676), RNA binding (GO:0003723), protein binding (GO:0005515), translation regulator activity (GO:0045182)

GO Cellular Component (12): P-body (GO:0000932), nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), cytosol (GO:0005829), postsynaptic density (GO:0014069), membrane (GO:0016020), dendrite (GO:0030425), neuron projection (GO:0043005), synapse (GO:0045202), ribonucleoprotein complex (GO:1990904), cytoplasmic ribonucleoprotein granule (GO:0036464)

GO top-level categories

51 GO namespaces:

Category	Terms
cellular anatomical structure	4
translation	3
regulation of translation	2
mRNA binding	2
binding	2
cytoplasm	2
RNA processing	1
mRNA metabolic process	1
mRNA 3’-end processing	1
regulation of mRNA processing	1
response to insulin	1
cellular response to peptide hormone stimulus	1
response to amino acid	1
cellular response to acid chemical	1
response to hypoxia	1
cellular response to stress	1
cellular response to decreased oxygen levels	1
cytoplasmic translation	1
negative regulation of translation	1
regulation of cytoplasmic translation	1
peptidyltransferase activity	1
translational initiation	1
translational elongation	1
translational termination	1
macromolecule biosynthetic process	1
protein metabolic process	1
protein biosynthetic process	1
post-transcriptional regulation of gene expression	1
regulation of protein metabolic process	1
negative regulation of gene expression	1
negative regulation of protein metabolic process	1
translation repressor activity	1
RNA binding	1
translation factor activity	1
mRNA 3’-UTR binding	1
ribonucleoprotein complex binding	1
cation binding	1
nucleic acid binding	1
molecular_function	1
cytoplasmic ribonucleoprotein granule	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
intracellular anatomical structure	1
asymmetric synapse	1
postsynaptic specialization	1
neuron projection	1
dendritic tree	1
plasma membrane bounded cell projection	1
cell junction	1
protein-containing complex	1
ribonucleoprotein granule	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 7 of 31 annotations. The rest are phylogenetic / computational / electronic (IEA).

7 experimentally-supported GO terms:

GO term	NS	Evidence
cellular response to hypoxia	BP	direct assay
cellular response to insulin stimulus	BP	direct assay
negative regulation of cytoplasmic translation	BP	mutant phenotype
regulation of mRNA 3’-end processing	BP	direct assay
cytoplasm	CC	direct assay
cytosol	CC	direct assay
nucleoplasm	CC	direct assay

Protein interactions and networks

STRING

showing 15 of 1,354 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CPEB1	NGDN	Q8NEJ9	923
CPEB1	TENT2	Q6PIY7	805
CPEB1	EIF4E	P06730	772
CPEB1	AURKC	Q9UQB9	768
CPEB1	MSI1	O43347	742
CPEB1	MOS	P00540	719
CPEB1	PAPOLA	P51003	712
CPEB1	PAPOLB	Q9NRJ5	712
CPEB1	PAPOLG	Q9BWT3	710
CPEB1	SYMPK	Q92797	702
CPEB1	DDX6	P26196	666
CPEB1	PARN	O95453	631
CPEB1	FMR1	Q06787	620
CPEB1	EIF4ENIF1	Q9NRA8	613
CPEB1	EIF4G1	Q04637	559

IntAct

Human interaction partners of CPEB1 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

6 partners by confidence:

Partner	Interaction type	MIscore	Records
CPEB4	physical association	0.400	1
USP20	physical association	0.400	1
SLC16A7	physical association	0.370	1
APBA3	association	0.350	1
CREB1	association	0.350	1
CNOT1	proximity	0.270	1

BioGRID (180 interactions; top human partners by supporting records): SYMPK (Affinity Capture-MS; 4 records), AURKA (Affinity Capture-Western; 3 records), EIF4E (Reconstituted Complex; 3 records), APBA3 (Affinity Capture-MS; 2 records), APP (Reconstituted Complex; 2 records), CSTF2 (Affinity Capture-MS; 2 records), CSTF2T (Affinity Capture-MS; 2 records), GAN (Affinity Capture-MS; 2 records), GBP5 (Affinity Capture-MS; 2 records), HSPA4 (Proximity Label-MS; 2 records), IGF2BP1 (Proximity Label-MS; 2 records), IGF2BP2 (Proximity Label-MS; 2 records), IGF2BP3 (Proximity Label-MS; 2 records), METAP1D (Affinity Capture-MS; 2 records), MOV10 (Proximity Label-MS; 2 records)

SIGNOR signaling

1 signaling interactions:

A	Effect	B	Mechanism
CDK1	“up-regulates activity”	CPEB1	phosphorylation

Disease & clinical

Genetic variants

Variant evidence for CPEB1: 71 ClinVar records (0 pathogenic / likely pathogenic); 9 GWAS associations.

ClinVar

71 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	58
Likely benign	1
Benign	1

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 22 predictions of 1,895):

Position(s)	Effect	Δscore	Sites
15:82547141–82547142	donor_loss	1.0000	4
15:82547238–82547239	acceptor_loss	1.0000	3
15:82549458–82549459	donor_loss	1.0000	4
15:82549480	donor_gain	1.0000
15:82552478–82552479	donor_loss	1.0000	5
15:82552624	acceptor_gain	1.0000
15:82553997	acceptor_gain	1.0000
15:82554001	acceptor_gain	1.0000
15:82554006	acceptor_gain	1.0000
15:82610227	donor_gain	1.0000

HPA cancer prognostics

RNA cancer specificity: Cancer enriched (Testicular Germ Cell Tumor)

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

1 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	unfavorable	6.65e-06

Disease associations

OMIM: gene MIM:607342 | disease phenotypes:

GWAS associations

9 associations:

Study	Trait	p-value
GCST011494_11	Daytime nap	2e-13
GCST008595_96	Cognitive ability, years of educational attainment or schizophrenia (pleiotropy)	4e-10
GCST90000047_238	Age at first sexual intercourse	4e-10
GCST006269_315	General cognitive ability	3e-9
GCST007201_70	Schizophrenia	9e-9
GCST004946_174	Schizophrenia	3e-8
GCST007201_389	Schizophrenia	5e-8
GCST003979_7	Excessive daytime sleepiness	2e-7
GCST007277_21	Tourette syndrome	7e-6

EFO canonical traits (from GWAS)

5 canonical traits:

EFO ID	Trait name
EFO:0007875	excessive daytime sleepiness measurement
EFO:0004337	intelligence
EFO:0004784	self reported educational attainment
EFO:0007828	daytime rest measurement
EFO:0009749	age at first sexual intercourse measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

26 total (human), top 26 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	decreases methylation, increases expression	4
sodium arsenite	increases expression, increases abundance	2
entinostat	increases expression, affects cotreatment	2
Decitabine	affects expression	2
Cisplatin	affects expression, decreases expression	2
Valproic Acid	increases expression, increases methylation	2
methylmercuric chloride	increases expression	1
trichostatin A	increases expression	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
abrine	increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
Temozolomide	decreases expression	1
Sunitinib	increases expression	1
Arsenic Trioxide	increases expression	1
Air Pollutants	decreases expression, increases abundance	1
Arsenic	increases abundance, increases expression	1
Atrazine	increases expression	1
Benzo(a)pyrene	affects methylation, increases methylation	1
Rotenone	increases expression	1
Thiram	increases expression	1
Antirheumatic Agents	increases expression	1
Okadaic Acid	increases expression	1
Copper Sulfate	increases expression	1
Acrylamide	increases expression	1
Particulate Matter	decreases expression, increases abundance	1

Cellosaurus cell lines

1 cell lines: 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_F1PQ	HyCyte HeLa KO-hCPEB1	Cancer cell line	Female

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

1 trials:

NCT	Phase	Status	Title
NCT07164248	Not specified	COMPLETED	Evaluation of Bone Mineral Density Indications and Outcomes in Female Adolescents: Implications for Early Detection of Osteopenia/Osteoporosis and Gynecologic Practice