CPLX3

Summary

CPLX3 (complexin 3, HGNC:27652) is a protein-coding gene on chromosome 15q24.1, encoding Complexin-3 (Q8WVH0). Complexin that regulates SNARE protein complex-mediated synaptic vesicle fusion.

Predicted to enable SNARE binding activity. Predicted to be involved in modulation of chemical synaptic transmission; regulation of synaptic vesicle fusion to presynaptic active zone membrane; and synaptic vesicle tethering involved in synaptic vesicle exocytosis. Predicted to act upstream of or within regulation of neurotransmitter secretion. Predicted to be located in cytosol; plasma membrane; and synapse. Predicted to be part of SNARE complex. Predicted to be active in terminal bouton.

Source: NCBI Gene 594855 — automated summary from GO annotations (Alliance of Genome Resources).

At a glance

• GWAS associations: 8
• Clinical variants (ClinVar): 26 total
• GTEx eGene: eQTL in 15 tissues, sQTL in 5 (q < 0.05)
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.19 (unconstrained)
• MANE Select transcript: NM_001030005

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:27652
Approved symbol	CPLX3
Name	complexin 3
Location	15q24.1
Locus type	gene with protein product
Status	Approved
Aliases	CPX-III
Ensembl gene	ENSG00000213578
Ensembl biotype	protein_coding
OMIM	609585
Entrez	594855

Gene structure

Transcript identifiers

Ensembl transcripts: 3 — 3 protein_coding

MANE Select: ENST00000395018

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1

ENST00000395018, ENST00001104019, ENST00001137533

RefSeq mRNA: 1 — MANE Select: NM_001030005 NM_001030005

CCDS: CCDS32294

Canonical transcript exons

ENST00000395018 — 3 exons

Exon	Start	End
ENSE00001520338	74826627	74826867
ENSE00002588170	74830130	74831802
ENSE00003519594	74828034	74828121

Expression profiles

Bgee: expression breadth broad, 96 present calls, max score 95.52.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 1.6580 / max 435.7598, expressed in 124 samples.

Highest expression (Bgee): spleen, hemisphere of cerebellum, cerebellar hemisphere, cerebellar cortex, cerebellum.

Genetic regulation across tissues (GTEx eQTL / sQTL)

CPLX3 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 15 tissues and its splicing (sQTL) in 5 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

20 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Esophagus Mucosa	eqtl	1.4e-30	+0.48	15:74823843:C:G
Spleen	sqtl	2.7e-16	-1.53	15:74829297:G:C
Testis	sqtl	5.2e-13	-1.26	15:74829297:G:C
Whole Blood	eqtl	3.6e-09	+0.89	15:74793388:C:A
Colon Transverse	eqtl	1.1e-08	+0.88	15:74820742:A:G
Heart Atrial Appendage	sqtl	3.6e-08	-0.53	15:74813797:C:T
Colon Sigmoid	eqtl	1.5e-05	+0.81	15:74806571:C:G
Nerve Tibial	eqtl	3.4e-04	+0.85	15:74798954:AGGGGTTGGGGAGGGAAGGGGCCTTGGTCCTCCTGAAGGAGCATCAGGAGCAAGCAGGGAGGCCAGAGTGAGGGGCTTG:A
Lung	eqtl	1.2e-03	+0.79	15:74774615:C:G
Cells Cultured fibroblasts	eqtl	1.5e-03	+0.77	15:74804024:G:A
Adrenal Gland	eqtl	7.4e-03	-0.62	15:75654062:C:T
Esophagus Gastroesophageal Junction	eqtl	8.4e-03	-0.81	15:73875982:TGGTGTGC:T
Brain Cerebellum	sqtl	8.7e-03	-0.54	15:74764862:G:T
Skin Sun Exposed Lower leg	eqtl	1.4e-02	-0.68	15:74305852:T:A
Brain Cortex	eqtl	2.4e-02	+1.06	15:75293532:G:C
Minor Salivary Gland	eqtl	3.1e-02	+0.69	15:75647933:C:T
Skin Not Sun Exposed Suprapubic	eqtl	3.4e-02	+0.43	15:74756061:CG:C
Heart Left Ventricle	eqtl	3.8e-02	+0.38	15:74801048:C:T
Brain Cerebellar Hemisphere	sqtl	4.2e-02	-1.03	15:74828353:A:T
Stomach	eqtl	4.9e-02	-0.50	15:74205216:A:C

FANTOM5 promoters

2 alternative TSS:

Promoter ID	TPM avg	Samples expressed
147737	1.6255	124
147736	0.0325	14

Top tissues by expression

showing 100 of 112 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
spleen	UBERON:0002106	95.52	gold quality
right hemisphere of cerebellum	UBERON:0014890	93.38	gold quality
cerebellar hemisphere	UBERON:0002245	92.62	gold quality
cerebellar cortex	UBERON:0002129	92.47	gold quality
cerebellum	UBERON:0002037	92.32	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	91.81	gold quality
prostate gland	UBERON:0002367	89.69	gold quality
right atrium auricular region	UBERON:0006631	88.01	gold quality
apex of heart	UBERON:0002098	85.14	gold quality
prefrontal cortex	UBERON:0000451	82.12	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	79.83	gold quality
frontal cortex	UBERON:0001870	79.83	gold quality
anterior cingulate cortex	UBERON:0009835	79.46	gold quality
temporal lobe	UBERON:0001871	79.12	gold quality
amygdala	UBERON:0001876	78.99	gold quality
right frontal lobe	UBERON:0002810	76.84	gold quality
cerebral cortex	UBERON:0000956	76.12	gold quality
superior frontal gyrus	UBERON:0002661	76.01	gold quality
lower esophagus mucosa	UBERON:0035834	75.46	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	75.41	gold quality
Brodmann (1909) area 9	UBERON:0013540	74.80	gold quality
brain	UBERON:0000955	74.30	gold quality
primary visual cortex	UBERON:0002436	73.13	gold quality
saliva-secreting gland	UBERON:0001044	70.82	gold quality
minor salivary gland	UBERON:0001830	70.79	gold quality
putamen	UBERON:0001874	70.06	gold quality
right testis	UBERON:0004534	69.46	gold quality
pituitary gland	UBERON:0000007	69.12	gold quality
left testis	UBERON:0004533	68.96	gold quality
caudate nucleus	UBERON:0001873	68.56	gold quality
testis	UBERON:0000473	68.03	gold quality
heart	UBERON:0000948	67.99	gold quality
Ammon’s horn	UBERON:0001954	67.75	gold quality
adenohypophysis	UBERON:0002196	67.19	gold quality
right adrenal gland cortex	UBERON:0035827	66.98	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	66.92	gold quality
heart left ventricle	UBERON:0002084	66.66	gold quality
hypothalamus	UBERON:0001898	65.16	gold quality
left adrenal gland cortex	UBERON:0035825	64.86	gold quality
substantia nigra	UBERON:0002038	64.62	gold quality
left adrenal gland	UBERON:0001234	63.94	gold quality
right adrenal gland	UBERON:0001233	63.77	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	61.38	gold quality
adrenal gland	UBERON:0002369	60.84	gold quality
nucleus accumbens	UBERON:0001882	59.15	gold quality
cortical plate	UBERON:0005343	58.22	gold quality
tonsil	UBERON:0002372	58.10	gold quality
fundus of stomach	UBERON:0001160	52.93	gold quality
esophagus mucosa	UBERON:0002469	52.71	gold quality
stromal cell of endometrium	CL:0002255	50.95	silver quality
multicellular organism	UBERON:0000468	50.22	gold quality
body of stomach	UBERON:0001161	49.11	gold quality
mucosa of transverse colon	UBERON:0004991	48.91	gold quality
stomach	UBERON:0000945	47.63	gold quality
blood	UBERON:0000178	45.83	gold quality
skin of abdomen	UBERON:0001416	45.12	gold quality
muscle layer of sigmoid colon	UBERON:0035805	45.04	gold quality
esophagus	UBERON:0001043	44.91	gold quality
granulocyte	CL:0000094	44.88	silver quality
zone of skin	UBERON:0000014	44.34	gold quality
bone marrow cell	CL:0002092	44.19	gold quality
skin of leg	UBERON:0001511	43.82	gold quality
lymph node	UBERON:0000029	43.58	silver quality
transverse colon	UBERON:0001157	43.44	gold quality
colon	UBERON:0001155	43.25	gold quality
duodenum	UBERON:0002114	42.91	gold quality
skeletal muscle tissue	UBERON:0001134	42.66	gold quality
intestine	UBERON:0000160	42.36	gold quality
corpus callosum	UBERON:0002336	42.10	gold quality
right coronary artery	UBERON:0001625	41.53	gold quality
endocervix	UBERON:0000458	41.48	gold quality
bone marrow	UBERON:0002371	41.37	gold quality
small intestine	UBERON:0002108	41.32	gold quality
vagina	UBERON:0000996	40.52	gold quality
uterine cervix	UBERON:0000002	40.35	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	40.31	gold quality
small intestine Peyer’s patch	UBERON:0003454	40.26	gold quality
left uterine tube	UBERON:0001303	40.06	gold quality
ventricular zone	UBERON:0003053	40.02	gold quality
smooth muscle tissue	UBERON:0001135	39.89	silver quality
gastrocnemius	UBERON:0001388	39.32	gold quality
urinary bladder	UBERON:0001255	39.12	silver quality
muscle of leg	UBERON:0001383	38.04	gold quality
colonic epithelium	UBERON:0000397	37.20	gold quality
lower esophagus	UBERON:0013473	36.58	gold quality
right ovary	UBERON:0002118	36.55	gold quality
lower esophagus muscularis layer	UBERON:0035833	36.36	gold quality
mucosa of stomach	UBERON:0001199	36.22	silver quality
tibial artery	UBERON:0007610	36.05	gold quality
popliteal artery	UBERON:0002250	35.98	gold quality
thoracic aorta	UBERON:0001515	35.82	gold quality
right uterine tube	UBERON:0001302	35.60	gold quality
ascending aorta	UBERON:0001496	35.55	gold quality
hindlimb stylopod muscle	UBERON:0004252	35.53	gold quality
sural nerve	UBERON:0015488	35.28	gold quality
adrenal tissue	UBERON:0018303	34.45	gold quality
ovary	UBERON:0000992	34.17	gold quality
descending thoracic aorta	UBERON:0002345	33.91	gold quality
left ovary	UBERON:0002119	33.83	silver quality
islet of Langerhans	UBERON:0000006	33.57	silver quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-MTAB-7316	yes	1673.68
E-MTAB-11121	yes	1319.28
E-GEOD-137537	yes	21.31
E-ANND-3	no	0.08

HPA expression

RNA tissue specificity: Group enriched

showing 60 of 61 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM
Retina	tissue	91.5
Prostate	tissue	85.7
Spleen	tissue	53.0
Frontal cortex	tissue	18.7
Salivary gland	tissue	16.6
Heart muscle	tissue	9.7
Caudate putamen	tissue	7.1
Thalamus	tissue	5.6
Pituitary gland	tissue	5.2
Olfactory bulb	tissue	5.2
Cerebral cortex	tissue	5.1
Motor cortex	tissue	5.1
Superior colliculi	tissue	4.9
Postcentral gyrus	tissue	4.8
Prefrontal cortex	tissue	4.2
Midbrain	tissue	3.7
Retrosplenial and cingulate cortex	tissue	3.5
Adrenal gland	tissue	3.4
Hippocampal formation	tissue	3.4
Entorhinal cortex	tissue	3.4
Hippocampus	tissue	3.3
Temporal cortex	tissue	3.2
Testis	tissue	3.1
Nucleus accumbens	tissue	2.9
Insular cortex	tissue	2.9
Somatosensory cortex	tissue	2.8
Occipital cortex	tissue	2.7
Pons	tissue	2.6
Hypothalamus	tissue	2.5
Locus coeruleus	tissue	2.4
Retrosplenial cortex	tissue	2.4
Amygdala	tissue	1.6
Choroid plexus	tissue	1.6
Periaqueductal gray	tissue	1.3
Corpus callosum	tissue	1.1
Septum	tissue	0.8
Ventral forebrain	tissue	0.5
Basal ganglia	tissue	0.4
Substantia nigra	tissue	0.4
Vagina	tissue	0.3
Medulla oblongata	tissue	0.3
Small intestine	tissue	0.3
Spinal cord	tissue	0.3
Cervix	tissue	0.2
Skin 1	tissue	0.2
Lymph node	tissue	0.2
Esophagus	tissue	0.2
Putamen	tissue	0.2
Cerebellum	tissue	0.2
Tonsil	tissue	0.2
Appendix	tissue	0.2
Breast	tissue	0.1
Stomach 1	tissue	0.1
Adipose tissue	tissue	0.1
Rectum	tissue	0.1
Parathyroid gland	tissue	0.1
Colon	tissue	0.1
Epididymis	tissue	0.1
Duodenum	tissue	0.1
Thymus	tissue	0.1

Brain sub-regions (HPA Brain Atlas): detected in 189; highest nTPM — Posterior thalamic nucleus (38.9), Pulvinar (38.1), Flocculonodular lobe (34.8), Entorhinal gyrus (31.9), Vermis (30.5).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting CPLX3 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 90 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-5193	100.00	67.26	1744
HSA-MIR-3120-5P	100.00	65.56	965
HSA-MIR-126-5P	100.00	72.71	3180
HSA-MIR-12118	100.00	65.88	1270
HSA-MIR-6870-5P	99.99	68.55	2115
HSA-MIR-3173-3P	99.98	66.49	1217
HSA-MIR-6891-5P	99.98	66.53	1372
HSA-MIR-6888-3P	99.97	65.95	1170
HSA-MIR-4723-5P	99.97	68.70	2034
HSA-MIR-5698	99.97	68.49	2029
HSA-MIR-7111-5P	99.97	68.48	2062
HSA-MIR-4487	99.96	64.58	1252
HSA-MIR-128-3P	99.95	71.17	2484
HSA-MIR-216A-3P	99.95	71.19	2505
HSA-MIR-185-3P	99.95	67.01	1743
HSA-MIR-3681-3P	99.88	70.46	2254
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-4779	99.86	66.50	1583
HSA-MIR-579-3P	99.86	71.66	3628
HSA-MIR-664B-3P	99.84	71.65	3590
HSA-MIR-5010-3P	99.83	70.60	2357
HSA-MIR-6739-5P	99.80	67.87	2806
HSA-MIR-1273H-5P	99.77	66.32	2471
HSA-MIR-6733-5P	99.74	67.94	2759
HSA-MIR-494-3P	99.70	71.45	2795
HSA-MIR-30B-3P	99.70	65.76	2325
HSA-MIR-3689A-3P	99.70	65.73	2306

Functional genomics

gnomAD constraint: pLI 0.000612, LOEUF 1.19, missense Z 0.897 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000395018 — one region, missense o/e 0.85.

Literature-anchored findings (GeneRIF, showing 1)

• CPX acts sequentially on assembling SNAREpins, first facilitating zippering by nearly doubling the distance at which v- and t-SNAREs can engage and then clamping them into a half-zippered fusion-incompetent state. (PMID:21785413)

Cross-species orthologs

8 orthologs

Organism	Symbol	Gene ID
danio_rerio	cplx3a	ENSDARG00000062508
danio_rerio	cplx3b	ENSDARG00000089486
		ENSDARG00000099196
mus_musculus	Cplx3	ENSMUSG00000039714
rattus_norvegicus	Cplx3	ENSRNOG00000019317
drosophila_melanogaster	cpx	FBGN0041605
caenorhabditis_elegans		WBGENE00010520
caenorhabditis_elegans	cpx-1	WBGENE00022271

Paralogs (3): CPLX2 (ENSG00000145920), CPLX4 (ENSG00000166569), CPLX1 (ENSG00000168993)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:2384571) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 2 distinct phenotype terms.

Mouse phenotype (MP)	Records
abnormal cone electrophysiology	1
abnormal eye electrophysiology	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Bos taurus	Q0IIE0	96.8%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
CSK	protein-coding	1445
CYP1A1	protein-coding	1543
CYP1A2	protein-coding	1544
LMAN1L	protein-coding	79748
MIR6882	ncRNA	102465531
ULK3	protein-coding	25989
MPI	protein-coding	4351
FAM219B	protein-coding	57184
COX5A	protein-coding	9377
SCAMP2	protein-coding	10066
MIR4513	ncRNA	100616183

Protein

Protein identifiers

Complexin-3 — Q8WVH0 (reviewed: Q8WVH0)

Alternative names: Complexin III

All UniProt accessions (2): Q8WVH0, A0A384N6F4

UniProt curated annotations — full annotation on UniProt →

Function. Complexin that regulates SNARE protein complex-mediated synaptic vesicle fusion. Required for the maintenance of synaptic ultrastructure in the adult retina. Positively regulates synaptic transmission through synaptic vesicle availability and exocytosis of neurotransmitters at photoreceptor ribbon synapses in the retina. Suppresses tonic photoreceptor activity and baseline ’noise’ by suppression of Ca(2+) vesicle tonic release and the facilitation of evoked synchronous and asynchronous Ca(2+) vesicle release.

Subunit / interactions. Binds to the SNARE core complex containing SNAP25, VAMP2 and STX1A.

Subcellular location. Synapse. Cell membrane.

Post-translational modifications. Farnesylation mediates presynaptic targeting.

Similarity. Belongs to the complexin/synaphin family.

RefSeq proteins (1): NP_001025176* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR008849	Synaphin	Family

Pfam: PF05835

UniProt features (10 total): region of interest 2, compositionally biased region 2, chain 1, propeptide 1, coiled-coil region 1, modified residue 1, lipid moiety-binding region 1, sequence conflict 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q8WVH0-F1	75.95	0.23

Human Protein Atlas

Protein class: Predicted intracellular proteins, UniProt - Evidence at transcript level

Protein evidence: Evidence at protein level

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (2)

Type	Positions
Cysteine methyl ester	155
S-farnesyl cysteine	155

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 0; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

MSigDB gene sets: 115 (showing top): GSE45365_NK_CELL_VS_CD8A_DC_DN, GOBP_REGULATION_OF_VESICLE_FUSION, GOBP_VESICLE_LOCALIZATION, GOBP_VESICLE_ORGANIZATION, GOBP_INSULIN_SECRETION, GOBP_MEMBRANE_FUSION, GOBP_REGULATION_OF_HORMONE_LEVELS, GOBP_VESICLE_TARGETING, GOBP_NEUROTRANSMITTER_TRANSPORT, GOBP_HORMONE_TRANSPORT, GOBP_VESICLE_MEDIATED_TRANSPORT, GOBP_CELL_CELL_SIGNALING, GOBP_MEMBRANE_DOCKING, GOBP_REGULATION_OF_VESICLE_MEDIATED_TRANSPORT, GOBP_EXOCYTOSIS

GO Biological Process (7): visual perception (GO:0007601), synaptic vesicle exocytosis (GO:0016079), insulin secretion (GO:0030073), regulation of synaptic vesicle fusion to presynaptic active zone membrane (GO:0031630), modulation of chemical synaptic transmission (GO:0050804), neurotransmitter transport (GO:0006836), exocytosis (GO:0006887)

GO Molecular Function (3): SNARE binding (GO:0000149), neurotransmitter transmembrane transporter activity (GO:0005326), syntaxin binding (GO:0019905)

GO Cellular Component (9): cytosol (GO:0005829), synaptic vesicle membrane (GO:0030672), SNARE complex (GO:0031201), terminal bouton (GO:0043195), presynaptic active zone membrane (GO:0048787), photoreceptor ribbon synapse (GO:0098684), plasma membrane (GO:0005886), membrane (GO:0016020), synapse (GO:0045202)

GO top-level categories

36 GO namespaces:

Category	Terms
presynapse	2
cytoplasm	2
cellular anatomical structure	2
sensory perception of light stimulus	1
neurotransmitter secretion	1
regulated exocytosis	1
establishment of localization in cell	1
vesicle-mediated transport in synapse	1
synaptic vesicle cycle	1
signal release from synapse	1
protein secretion	1
peptide hormone secretion	1
regulation of vesicle fusion	1
synaptic vesicle fusion to presynaptic active zone membrane	1
regulation of synaptic vesicle membrane organization	1
chemical synaptic transmission	1
regulation of trans-synaptic signaling	1
transport	1
vesicle-mediated transport	1
secretion by cell	1
vesicle fusion to plasma membrane	1
protein binding	1
neurotransmitter transport	1
transmembrane transporter activity	1
SNARE binding	1
synaptic vesicle	1
exocytic vesicle membrane	1
membrane protein complex	1
axon terminus	1
presynaptic membrane	1
presynaptic active zone	1
synaptic membrane	1
ribbon synapse	1
membrane	1
cell periphery	1
cell junction	1

Protein interactions and networks

STRING

showing 15 of 806 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CPLX3	VAMP1	P23763	859
CPLX3	SNAP25	P13795	821
CPLX3	STX1A	Q16623	796
CPLX3	STX3	Q13277	706
CPLX3	CPLX1	O14810	651
CPLX3	NXPH4	O95158	649
CPLX3	MOXD1	Q6UVY6	646
CPLX3	LPAR1	P78351	504
CPLX3	NXPH3	O95157	498
CPLX3	LAMP5	Q9UJQ1	459
CPLX3	NR4A2	P43354	437
CPLX3	GSG1L	Q6UXU4	429
CPLX3	CCN2	P29279	423
CPLX3	NTSR1	P30989	419
CPLX3	RCAN2	Q14206	416

IntAct

Human interaction partners of CPLX3 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

3 partners by confidence:

Partner	Interaction type	MIscore	Records
CIAO1	association	0.530	2
CUTA	physical association	0.400	1
ATE1	association	0.350	1

BioGRID (40 interactions; top human partners by supporting records): ACPP (Affinity Capture-MS; 2 records), ARL8B (Affinity Capture-MS; 2 records), CIAO1 (Affinity Capture-MS; 2 records), DSG4 (Affinity Capture-MS; 2 records), DUSP14 (Affinity Capture-MS; 2 records), FHL2 (Affinity Capture-MS; 2 records), HEPHL1 (Affinity Capture-MS; 2 records), LRRC15 (Affinity Capture-MS; 2 records), LYG2 (Affinity Capture-MS; 2 records), PKP3 (Affinity Capture-MS; 2 records), SERPINB5 (Affinity Capture-MS; 2 records), SIRT5 (Affinity Capture-MS; 2 records), TRIM29 (Affinity Capture-MS; 2 records), VSIG8 (Affinity Capture-MS; 2 records), ATE1 (Affinity Capture-MS)

Disease & clinical

Genetic variants

Variant evidence for CPLX3: 26 ClinVar records (0 pathogenic / likely pathogenic); 8 GWAS associations.

ClinVar

26 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	26
Likely benign	0
Benign	0

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 22 predictions of 539):

Position(s)	Effect	Δscore	Sites
15:74826868–74826869	donor_loss	1.0000	3
15:74828122–74828123	donor_loss	1.0000	5
15:74826868–74826869	donor_loss	0.9900	2
15:74830128–74830129	acceptor_loss	0.9900	6
15:74828406	acceptor_gain	0.9600
15:74830332	donor_gain	0.9600
15:74826869	donor_loss	0.9500
15:74829742	acceptor_gain	0.9400
15:74826872	donor_loss	0.9200
15:74827973	acceptor_gain	0.9200

AlphaMissense

276 missense substitutions predicted likely pathogenic (of 1,034 scored), across 81 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
D88	8	0.957	0.985
M108	7	0.848	0.971
F3	7	0.835	0.947
F62	7	0.825	0.928
F76	7	0.793	0.987
C155	7	0.781	0.907
K79	6	0.970	0.991
Y80	6	0.934	0.987
P102	6	0.900	0.948
M39	6	0.811	0.918
K66	6	0.799	0.882
H75	6	0.783	0.965
M8	6	0.756	0.946
M158	6	0.754	0.834
R73	5	0.943	0.989
R69	5	0.919	0.992
Y47	5	0.917	0.962
K6	5	0.912	0.924
A70	5	0.900	0.992
R58	5	0.833	0.990

HPA cancer prognostics

RNA cancer specificity: Cancer enriched (Prostate Adenocarcinoma)

Disease associations

OMIM: gene MIM:609585 | disease phenotypes:

GWAS associations

8 associations:

Study	Trait	p-value
GCST007094_158	Diastolic blood pressure	3e-29
GCST000394_3	Diastolic blood pressure	1e-23
GCST007099_258	Systolic blood pressure	1e-16
GCST010083_205	Hemoglobin levels	1e-13
GCST001215_2	Coffee consumption	7e-9
GCST001032_3	Caffeine consumption	6e-7
GCST007098_102	Diastolic blood pressure	4e-6
GCST007098_103	Diastolic blood pressure	5e-6

EFO canonical traits (from GWAS)

4 canonical traits:

EFO ID	Trait name
EFO:0006336	diastolic blood pressure
EFO:0004330	coffee consumption
EFO:0006335	systolic blood pressure
EFO:0004509	hemoglobin measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

15 total (human), top 15 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Resveratrol	affects cotreatment, decreases expression	2
abrine	increases expression	1
theaflavin-3,3’-digallate	affects expression	1
Atrazine	increases expression	1
Benzo(a)pyrene	increases methylation	1
Copper	affects cotreatment, decreases expression	1
Enzyme Inhibitors	decreases activity, increases O-linked glycosylation	1
Estradiol	increases expression	1
Ethinyl Estradiol	decreases expression	1
Plant Extracts	affects cotreatment, decreases expression	1
Thalidomide	decreases expression	1
Tretinoin	decreases expression	1
Valproic Acid	increases methylation	1
1-Methyl-4-phenylpyridinium	increases expression	1
Lactic Acid	decreases expression	1

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.