CPNE5

Summary

CPNE5 (copine 5, HGNC:2318) is a protein-coding gene on chromosome 6p21.2, encoding Copine-5 (Q9HCH3). Probable calcium-dependent phospholipid-binding protein that may play a role in calcium-mediated intracellular processes.

Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encode a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. More variants may exist, but their full-length natures could not be determined.

Source: NCBI Gene 57699 — RefSeq curated summary.

At a glance

• GWAS associations: 6
• Clinical variants (ClinVar): 79 total
• MANE Select transcript: NM_020939

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2318
Approved symbol	CPNE5
Name	copine 5
Location	6p21.2
Locus type	gene with protein product
Status	Approved
Aliases	CPN5, COPN5, KIAA1599
Ensembl gene	ENSG00000124772
Ensembl biotype	protein_coding
OMIM	604209
Entrez	57699

Gene structure

Transcript identifiers

Ensembl transcripts: 8 — 4 protein_coding, 3 protein_coding_CDS_not_defined, 1 retained_intron

ENST00000244751, ENST00000393189, ENST00000459703, ENST00000493411, ENST00000633136, ENST00000633280, ENST00000633929, ENST00000634222

RefSeq mRNA: 13 — MANE Select: NM_020939 NM_001314018, NM_001314019, NM_001314020, NM_001376888, NM_001376889, NM_001376890, NM_001376891, NM_001376892, NM_001376893, NM_001376894, NM_001376895, NM_001410887, NM_020939

CCDS: CCDS4825, CCDS83078, CCDS93904

Canonical transcript exons

ENST00000244751 — 21 exons

Exon	Start	End
ENSE00000849712	36823058	36823098
ENSE00000849713	36822114	36822160
ENSE00000849715	36798455	36798494
ENSE00000849716	36798165	36798241
ENSE00000849717	36794590	36794649
ENSE00000849718	36792033	36792096
ENSE00000849720	36774961	36775065
ENSE00000849721	36765335	36765376
ENSE00000849722	36762917	36762992
ENSE00001673436	36799967	36800070
ENSE00001804359	36778854	36778957
ENSE00003508939	36745048	36745150
ENSE00003528166	36746396	36746577
ENSE00003633906	36748221	36748267
ENSE00003642509	36753034	36753095
ENSE00003643223	36756245	36756298
ENSE00003646933	36743689	36743762
ENSE00003647169	36745388	36745515
ENSE00003663491	36744268	36744325
ENSE00003781014	36839283	36839444
ENSE00003847862	36740775	36742486

Expression profiles

Bgee: expression breadth ubiquitous, 218 present calls, max score 98.08.

FANTOM5 (CAGE): breadth broad, TPM avg 6.0643 / max 285.7240, expressed in 564 samples.

FANTOM5 promoters (16 alternative TSS)

Promoter ID	TPM avg	Samples expressed
73367	1.9868	116
73383	1.8134	286
73378	0.4649	121
73370	0.3448	66
73365	0.2387	66
73379	0.1977	74
73372	0.1503	64
73382	0.1496	65
73384	0.1403	69
73380	0.1308	69

Top tissues by expression

254 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
cardiac muscle of right atrium	UBERON:0003379	98.08	gold quality
right atrium auricular region	UBERON:0006631	97.16	gold quality
cardiac atrium	UBERON:0002081	96.99	gold quality
nucleus accumbens	UBERON:0001882	96.77	gold quality
caudate nucleus	UBERON:0001873	94.97	gold quality
putamen	UBERON:0001874	94.78	gold quality
apex of heart	UBERON:0002098	94.34	gold quality
prefrontal cortex	UBERON:0000451	93.80	gold quality
right uterine tube	UBERON:0001302	93.68	gold quality
right frontal lobe	UBERON:0002810	93.30	gold quality
frontal cortex	UBERON:0001870	92.53	gold quality
Brodmann (1909) area 9	UBERON:0013540	92.53	gold quality
anterior cingulate cortex	UBERON:0009835	92.50	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	92.03	gold quality
neocortex	UBERON:0001950	91.78	gold quality
heart left ventricle	UBERON:0002084	90.37	gold quality
superior frontal gyrus	UBERON:0002661	90.33	gold quality
lymph node	UBERON:0000029	90.06	gold quality
cardiac ventricle	UBERON:0002082	89.96	gold quality
amygdala	UBERON:0001876	89.93	gold quality
right testis	UBERON:0004534	89.41	gold quality
left uterine tube	UBERON:0001303	89.16	gold quality
cerebral cortex	UBERON:0000956	89.09	gold quality
left ventricle myocardium	UBERON:0006566	88.96	gold quality
forebrain	UBERON:0001890	88.65	gold quality
bone marrow cell	CL:0002092	88.57	gold quality
heart	UBERON:0000948	88.50	gold quality
temporal lobe	UBERON:0001871	88.46	gold quality
postcentral gyrus	UBERON:0002581	88.46	gold quality
left testis	UBERON:0004533	88.32	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-MTAB-6678	no	2.42
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

74 targeting CPNE5, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-188-3P	100.00	68.76	1240
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-6740-5P	100.00	65.64	932
HSA-MIR-10401-5P	99.99	65.79	948
HSA-MIR-4650-5P	99.98	64.69	999
HSA-MIR-3692-3P	99.98	70.27	2139
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-2110	99.96	66.68	1930
HSA-MIR-3682-5P	99.93	67.97	1163
HSA-MIR-6721-5P	99.93	68.92	2981
HSA-MIR-10527-5P	99.91	72.28	3754
HSA-MIR-124-3P	99.89	73.74	3043
HSA-MIR-506-3P	99.89	73.55	3057
HSA-MIR-4271	99.88	68.32	2244
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-6756-5P	99.82	67.97	2466
HSA-MIR-3133	99.81	70.92	3506
HSA-MIR-1273H-5P	99.77	66.32	2471
HSA-MIR-30B-3P	99.70	65.76	2325
HSA-MIR-3689A-3P	99.70	65.73	2306
HSA-MIR-3689B-3P	99.70	65.71	2311
HSA-MIR-3689C	99.70	65.71	2311
HSA-MIR-6779-5P	99.70	65.76	2363
HSA-MIR-3202	99.66	67.70	2737
HSA-MIR-24-3P	99.59	69.97	1934
HSA-MIR-762	99.58	66.61	1994
HSA-MIR-3136-3P	99.57	66.59	781

Literature-anchored findings (GeneRIF, showing 3)

• Results provide the first evidence of genetic variants in the CPNE5 gene influencing both alcohol dependence and obesity (PMID:26522866)
• Data revealed that CPNE5 mRNA expression was significantly lower in ESCC tissues and cell lines and correlated with significantly shorter overall survival. Multivariable analysis identified low CPNE5 expression to be an independent prognostic factor of OS. Analysis of recurrence patterns revealed that significantly more patients with local recurrence expressed lower levels of CPNE5 mRNA. (PMID:30272363)
• High expression of CPNE5 and CPNE9 predicts positive prognosis in multiple myeloma. (PMID:33780365)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	cpne5a	ENSDARG00000061466
danio_rerio	cpne5b	ENSDARG00000070919
mus_musculus	Cpne5	ENSMUSG00000024008
rattus_norvegicus	Cpne5	ENSRNOG00000000522

Paralogs (8): CPNE3 (ENSG00000085719), CPNE6 (ENSG00000100884), CPNE8 (ENSG00000139117), CPNE2 (ENSG00000140848), CPNE9 (ENSG00000144550), CPNE7 (ENSG00000178773), CPNE4 (ENSG00000196353), CPNE1 (ENSG00000214078)

Protein

Protein identifiers

Copine-5 — Q9HCH3 (reviewed: Q9HCH3)

Alternative names: Copine V

All UniProt accessions (3): A0A0J9YWA1, A0A0J9YWU8, Q9HCH3

UniProt curated annotations — full annotation on UniProt →

Function. Probable calcium-dependent phospholipid-binding protein that may play a role in calcium-mediated intracellular processes. Plays a role in dendrite formation by melanocytes.

Subcellular location. Perikaryon. Cell projection.

Tissue specificity. Expressed in the brain, heart, stomach, spleen, lymph node and testis. Expressed in melanocytes.

Cofactor. Binds 3 Ca(2+) ions per C2 domain.

Similarity. Belongs to the copine family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q9HCH3-1	1	yes
Q9HCH3-2	2

RefSeq proteins (13): NP_001300947, NP_001300948, NP_001300949, NP_001363817, NP_001363818, NP_001363819, NP_001363820, NP_001363821, NP_001363822, NP_001363823, NP_001363824, NP_001397816, NP_065990* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000008	C2_dom	Domain
IPR002035	VWF_A	Domain
IPR010734	Copine_C	Domain
IPR035892	C2_domain_sf	Homologous_superfamily
IPR036465	vWFA_dom_sf	Homologous_superfamily
IPR037768	C2B_Copine	Domain
IPR045052	Copine	Family

Pfam: PF00168, PF07002

UniProt features (32 total): binding site 20, domain 3, modified residue 3, sequence variant 2, chain 1, splice variant 1, region of interest 1, compositionally biased region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9HCH3-F1	85.40	0.58

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (20): 98; 100; 100; 100; 103; 108; 110; 110; 192; 192; 198; 254 …

Post-translational modifications (3): 19, 103, 140

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 143 (showing top): GOBP_REGULATION_OF_CELL_MORPHOGENESIS, GOBP_NEURON_PROJECTION_EXTENSION, GOBP_REGULATION_OF_DEVELOPMENTAL_GROWTH, GOBP_GROWTH, GOBP_NEUROGENESIS, GGGTGGRR_PAX4_03, GOBP_RESPONSE_TO_METAL_ION, E2F_Q3, GOBP_POSITIVE_REGULATION_OF_CELL_GROWTH, GOBP_POSITIVE_REGULATION_OF_DEVELOPMENTAL_GROWTH, GOBP_POSITIVE_REGULATION_OF_GROWTH, AACTTT_UNKNOWN, GOBP_CELLULAR_RESPONSE_TO_CALCIUM_ION, E2F1_Q3, SENESE_HDAC1_TARGETS_UP

GO Biological Process (3): cell differentiation (GO:0030154), cellular response to calcium ion (GO:0071277), positive regulation of dendrite extension (GO:1903861)

GO Molecular Function (2): calcium-dependent phospholipid binding (GO:0005544), metal ion binding (GO:0046872)

GO Cellular Component (6): plasma membrane (GO:0005886), neuron projection (GO:0043005), perikaryon (GO:0043204), extracellular exosome (GO:0070062), cell projection (GO:0042995), neuronal cell body (GO:0043025)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	2
cellular developmental process	1
response to calcium ion	1
cellular response to metal ion	1
positive regulation of cell growth	1
positive regulation of developmental growth	1
dendrite extension	1
regulation of dendrite extension	1
phospholipid binding	1
cation binding	1
membrane	1
cell periphery	1
plasma membrane bounded cell projection	1
neuronal cell body	1
extracellular vesicle	1
somatodendritic compartment	1
cell body	1

Protein interactions and networks

STRING

810 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CPNE5	FRMPD1	Q5SYB0	491
CPNE5	NCALD	P29554	476
CPNE5	ZNF326	Q5BKZ1	474
CPNE5	MCTP2	Q6DN12	469
CPNE5	TMEM51	Q9NW97	468
CPNE5	SLITRK5	O94991	457
CPNE5	SPATS2L	Q9NUQ6	433
CPNE5	RAB28	P51157	432
CPNE5	SLC2A13	Q96QE2	425
CPNE5	KCTD12	Q96CX2	424
CPNE5	RGS2	P41220	418
CPNE5	SUB1	P53999	398
CPNE5	NTM	Q9P121	398
CPNE5	LRRC10B	A6NIK2	387
CPNE5	FHIT	P49789	387
CPNE5	FAT4	Q6V0I7	387

IntAct

11 interactions, top by confidence:

A	B	Type	Score
CPNE5	RAD21	psi-mi:“MI:0914”(association)	0.530
RNF6	ALOX5	psi-mi:“MI:0914”(association)	0.530
CLINT1	PIK3C2A	psi-mi:“MI:0914”(association)	0.530
CPNE5	CPNE8	psi-mi:“MI:0915”(physical association)	0.400
CPNE5	NCK2	psi-mi:“MI:0914”(association)	0.350
Npc1	ESYT2	psi-mi:“MI:0914”(association)	0.350
CPNE9	RAD21	psi-mi:“MI:0914”(association)	0.350
CPNE9	GTPBP1	psi-mi:“MI:0914”(association)	0.350
DSCAM	CPNE5	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (66): RAD54B (Affinity Capture-MS), NCK1 (Affinity Capture-MS), RABEP2 (Affinity Capture-MS), RABGEF1 (Affinity Capture-MS), UTRN (Affinity Capture-MS), SNTB2 (Affinity Capture-MS), MBNL3 (Affinity Capture-MS), DTNB (Affinity Capture-MS), GATAD2B (Affinity Capture-MS), NCK2 (Affinity Capture-MS), NAPG (Affinity Capture-MS), FAM114A2 (Affinity Capture-MS), UBA2 (Affinity Capture-MS), DHRS7 (Affinity Capture-MS), SATB2 (Affinity Capture-MS)

ESM2 similar proteins: A0A1D5PPP7, F1NV61, O01382, O02002, O08738, O35397, O89094, O89110, P29452, P29594, P31944, P42574, P42575, P43527, P55211, P55212, P55213, P55215, P55865, P55866, P55867, P70343, P70677, P89116, Q08DY9, Q0IIM3, Q14344, Q14790, Q153Z0, Q2PFV2, Q3T0P5, Q504J1, Q5IS54, Q5IS99, Q60431, Q60446, Q61699, Q66HA8, Q8BLR2, Q8C3Q9

Diamond homologs: A8WMY4, D4A1R8, H1UBN0, H2KYS8, O75131, O95741, P59108, Q08DB4, Q0VE82, Q1RLL3, Q1ZXB3, Q2KHY1, Q54FY7, Q54P51, Q55GG1, Q5BJS7, Q5R4W6, Q5RAE1, Q5S1W2, Q5XQC7, Q7YXU4, Q86K21, Q86YQ8, Q8BLR2, Q8BT60, Q8C166, Q8IYJ1, Q8JZW4, Q941L3, Q96A23, Q96FN4, Q99829, Q9DC53, Q9HCH3, Q9UBL6, Q9XUB9, Q9Z140, A0JJX5, Q09219, Q12466

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

79 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	58
Likely benign	0
Benign	7

Top pathogenic / likely-pathogenic (0)

SpliceAI

4185 predictions. Top by Δscore:

Variant	Effect	Δscore
6:36742482:ACAAA:A	acceptor_gain	1.0000
6:36742483:CAAA:C	acceptor_gain	1.0000
6:36742483:CAAAC:C	acceptor_gain	1.0000
6:36742485:AA:A	acceptor_gain	1.0000
6:36742486:ACT:A	acceptor_loss	1.0000
6:36742487:C:CC	acceptor_gain	1.0000
6:36742487:C:T	acceptor_loss	1.0000
6:36743758:CATGG:C	acceptor_gain	1.0000
6:36743759:ATGG:A	acceptor_gain	1.0000
6:36743760:TGG:T	acceptor_gain	1.0000
6:36743760:TGGC:T	acceptor_loss	1.0000
6:36743761:GG:G	acceptor_gain	1.0000
6:36743761:GGCT:G	acceptor_loss	1.0000
6:36743762:GC:G	acceptor_loss	1.0000
6:36743763:C:CC	acceptor_gain	1.0000
6:36743764:T:G	acceptor_loss	1.0000
6:36743765:G:C	acceptor_gain	1.0000
6:36743765:G:GC	acceptor_gain	1.0000
6:36744325:CCTG:C	acceptor_loss	1.0000
6:36744326:C:CC	acceptor_gain	1.0000
6:36744337:CA:C	acceptor_gain	1.0000
6:36744338:A:C	acceptor_gain	1.0000
6:36745033:ACACT:A	donor_gain	1.0000
6:36745034:CACTC:C	donor_gain	1.0000
6:36745037:T:TA	donor_gain	1.0000
6:36745046:A:AC	donor_gain	1.0000
6:36745047:C:CA	donor_gain	1.0000
6:36745047:CG:C	donor_gain	1.0000
6:36745047:CGTTG:C	donor_gain	1.0000
6:36745061:T:TA	donor_gain	1.0000

AlphaMissense

3931 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
6:36742484:A:C	F522L	1.000
6:36742484:A:T	F522L	1.000
6:36742485:A:G	F522S	1.000
6:36742486:A:G	F522L	1.000
6:36743702:C:G	R517P	1.000
6:36743750:A:G	L501P	1.000
6:36743750:A:T	L501Q	1.000
6:36744272:G:C	F495L	1.000
6:36744272:G:T	F495L	1.000
6:36744273:A:C	F495C	1.000
6:36744273:A:G	F495S	1.000
6:36744274:A:G	F495L	1.000
6:36745091:C:T	G463E	1.000
6:36745092:C:A	G463W	1.000
6:36745094:T:A	D462V	1.000
6:36745106:A:G	L458P	1.000
6:36746442:C:T	G385E	1.000
6:36746443:C:A	G385W	1.000
6:36746444:G:C	F384L	1.000
6:36746444:G:T	F384L	1.000
6:36746446:A:G	F384L	1.000
6:36746448:C:T	G383D	1.000
6:36748222:A:C	N339K	1.000
6:36748222:A:T	N339K	1.000
6:36748226:G:A	S338F	1.000
6:36748232:G:A	T336I	1.000
6:36748237:A:C	D334E	1.000
6:36748237:A:T	D334E	1.000
6:36748238:T:A	D334V	1.000
6:36748238:T:C	D334G	1.000

dbSNP variants (sampled 300 via entrez): RS1000027565 (6:36812404 GTACTGTTTAATAATAAAAAGAATATT>G), RS1000029634 (6:36765821 G>A,C), RS1000044986 (6:36759556 C>G), RS1000074683 (6:36759787 G>A), RS1000081906 (6:36839044 G>A), RS1000114093 (6:36744507 C>A), RS1000140932 (6:36825199 C>A,T), RS1000198158 (6:36748697 A>C), RS1000209926 (6:36781607 G>C), RS1000278628 (6:36825599 G>A,C), RS1000294280 (6:36754194 A>G), RS1000336687 (6:36808333 C>G,T), RS1000341536 (6:36833286 T>C), RS1000347867 (6:36833446 T>C), RS1000353514 (6:36747452 A>C)

Disease associations

OMIM: gene MIM:604209 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

6 associations (top):

Study	Trait	p-value
GCST001969_24	Heart rate	9.000000e-07
GCST002481_11	Acne (severe)	2.000000e-06
GCST005441_10	Alcohol consumption (max-drinks)	9.000000e-07
GCST011956_17	Systemic lupus erythematosus	4.000000e-09
GCST90002380_159	Basophil percentage of white cells	8.000000e-10
GCST90002395_447	Mean platelet volume	3.000000e-10

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0007992	basophil percentage of leukocytes

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

26 total (human), top 26 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, increases methylation	2
Valproic Acid	increases expression, increases methylation	2
triphenyl phosphate	affects expression	1
kojic acid	increases expression	1
sodium arsenite	increases expression	1
4-nitroso-N-phenylaniline	affects response to substance	1
benzo(e)pyrene	decreases methylation	1
aflatoxin B2	decreases methylation	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	affects binding, increases reaction	1
(E)-4-((2-N-(4-methoxybenzenesulfonyl)amino)stilbazole)1-oxide	increases expression	1
MRK 003	decreases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Sunitinib	decreases expression	1
Acetaminophen	increases expression	1
Arbutin	increases expression	1
Doxorubicin	decreases expression	1
Lead	affects expression	1
Methapyrilene	decreases methylation	1
Plant Extracts	affects cotreatment, decreases expression	1
Silicon Dioxide	decreases expression	1
Tobacco Smoke Pollution	decreases expression	1
Zidovudine	affects cotreatment, increases expression	1
Cadmium Chloride	increases expression	1
Okadaic Acid	increases expression	1
Particulate Matter	decreases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.