CSNK1D

Summary

CSNK1D (casein kinase 1 delta, HGNC:2452) is a protein-coding gene on chromosome 17q25.3, encoding Casein kinase I isoform delta (P48730). Essential serine/threonine-protein kinase that regulates diverse cellular growth and survival processes including Wnt signaling, DNA repair and circadian rhythms.

This gene is a member of the casein kinase I (CKI) gene family whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein may also be involved in the regulation of apoptosis, circadian rhythm, microtubule dynamics, chromosome segregation, and p53-mediated effects on growth. The encoded protein is highly similar to the mouse and rat CK1 delta homologs. Three transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 1453 — RefSeq curated summary.

At a glance

• Gene–disease (curated): advanced sleep phase syndrome (Supportive, GenCC)
• Clinical variants (ClinVar): 54 total — 2 pathogenic
• Phenotypes (HPO): 6
• Druggable target: yes — 35 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_001893

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2452
Approved symbol	CSNK1D
Name	casein kinase 1 delta
Location	17q25.3
Locus type	gene with protein product
Status	Approved
Aliases	HCKID, CKID, CKIdelta
Ensembl gene	ENSG00000141551
Ensembl biotype	protein_coding
OMIM	600864
Entrez	1453

Gene structure

Transcript identifiers

Ensembl transcripts: 29 — 8 protein_coding_CDS_not_defined, 7 nonsense_mediated_decay, 7 protein_coding, 7 retained_intron

ENST00000269361, ENST00000314028, ENST00000392334, ENST00000398519, ENST00000403276, ENST00000577578, ENST00000578194, ENST00000578501, ENST00000578904, ENST00000579308, ENST00000579316, ENST00000580061, ENST00000580446, ENST00000580565, ENST00000580784, ENST00000581108, ENST00000581241, ENST00000581655, ENST00000581660, ENST00000581737, ENST00000582844, ENST00000584377, ENST00000584472, ENST00000584672, ENST00000584913, ENST00000585026, ENST00000865418, ENST00000865419, ENST00000865420

RefSeq mRNA: 3 — MANE Select: NM_001893 NM_001363749, NM_001893, NM_139062

CCDS: CCDS11805, CCDS11806, CCDS86654

Canonical transcript exons

ENST00000314028 — 9 exons

Exon	Start	End
ENSE00002701091	82273306	82273700
ENSE00002703794	82242667	82244831
ENSE00003481082	82265686	82265796
ENSE00003493845	82249431	82249602
ENSE00003494731	82253016	82253244
ENSE00003507266	82255429	82255577
ENSE00003527895	82252434	82252604
ENSE00003571444	82251379	82251527
ENSE00003633080	82248875	82249014

Expression profiles

Bgee: expression breadth ubiquitous, 299 present calls, max score 98.33.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 53.3936 / max 780.5744, expressed in 1826 samples.

FANTOM5 promoters (8 alternative TSS)

Promoter ID	TPM avg	Samples expressed
168952	22.9773	1817
168950	22.3432	1815
168951	4.0904	1635
168949	2.5873	1469
168946	0.9368	610
168947	0.1752	55
168944	0.1554	49
168945	0.1278	41

Top tissues by expression

301 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
left testis	UBERON:0004533	98.33	gold quality
right testis	UBERON:0004534	98.29	gold quality
small intestine Peyer’s patch	UBERON:0003454	97.96	gold quality
granulocyte	CL:0000094	97.95	gold quality
metanephros cortex	UBERON:0010533	97.89	gold quality
left uterine tube	UBERON:0001303	97.87	gold quality
adenohypophysis	UBERON:0002196	97.87	gold quality
left lobe of thyroid gland	UBERON:0001120	97.82	gold quality
minor salivary gland	UBERON:0001830	97.77	gold quality
mucosa of stomach	UBERON:0001199	97.76	gold quality
right lung	UBERON:0002167	97.73	gold quality
stromal cell of endometrium	CL:0002255	97.70	gold quality
right lobe of thyroid gland	UBERON:0001119	97.70	gold quality
upper lobe of left lung	UBERON:0008952	97.70	gold quality
body of uterus	UBERON:0009853	97.69	gold quality
right adrenal gland cortex	UBERON:0035827	97.64	gold quality
endocervix	UBERON:0000458	97.56	gold quality
transverse colon	UBERON:0001157	97.56	gold quality
body of stomach	UBERON:0001161	97.55	gold quality
lower esophagus	UBERON:0013473	97.55	gold quality
left adrenal gland cortex	UBERON:0035825	97.55	gold quality
lower esophagus muscularis layer	UBERON:0035833	97.55	gold quality
left adrenal gland	UBERON:0001234	97.53	gold quality
right ovary	UBERON:0002118	97.53	gold quality
muscle layer of sigmoid colon	UBERON:0035805	97.53	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	97.53	gold quality
left ovary	UBERON:0002119	97.51	gold quality
right adrenal gland	UBERON:0001233	97.47	gold quality
lower esophagus mucosa	UBERON:0035834	97.46	gold quality
pituitary gland	UBERON:0000007	97.42	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	13.74
E-MTAB-7606	no	512.61

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

129 targeting CSNK1D, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-126-5P	100.00	72.71	3180
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-33A-5P	99.99	68.62	1055
HSA-MIR-33B-5P	99.99	68.58	1062
HSA-MIR-548P	99.98	72.25	3784
HSA-MIR-27A-3P	99.98	72.13	2955
HSA-MIR-27B-3P	99.98	72.13	2955
HSA-MIR-9985	99.98	72.11	2939
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-512-3P	99.97	67.35	1049
HSA-MIR-1468-3P	99.96	72.74	3797
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-559	99.95	72.28	3609
HSA-MIR-548AB	99.95	71.31	3488
HSA-MIR-96-5P	99.95	72.80	2140
HSA-MIR-548A-5P	99.94	71.27	3482
HSA-MIR-548AD-5P	99.94	71.23	3502
HSA-MIR-548AE-5P	99.94	71.23	3502
HSA-MIR-548AK	99.94	71.24	3488
HSA-MIR-548AM-5P	99.94	71.24	3488
HSA-MIR-548AP-5P	99.94	71.14	3489
HSA-MIR-548AQ-5P	99.94	71.34	3426
HSA-MIR-548AR-5P	99.94	71.28	3515
HSA-MIR-548AS-5P	99.94	71.22	3482

Literature-anchored findings (GeneRIF, showing 40)

• findings support a model in which sub-cellular localization at the centrosome is mediated, at least in part, through the action of CG-NAP/AKAP450 (PMID:12270714)
• Ckidelta phosphorylates tau at sites that modulate tau/microtubule binding, and that the expression pattern of Ckidelta in Alzheimer’s disease is consistent with it playing an important role in tau aggregation (PMID:14761950)
• identification of a missense mutation (T44A) in the human CKIdelta gene, which results in familial advanced sleep phase syndrome; CKIdelta is a central component in the mammalian clock (PMID:15800623)
• Inhibition of HCKID alters mitotic spindle formation and induces apoptosis in trophoblast cells. (PMID:16027726)
• Novel human CKIdelta mutation R324H may alter the physiological role and enhance the transforming ability of CKIdelta through a Wnt/beta-catenin independent mechanism and thereby influence colonic adenoma development. (PMID:17131344)
• phosphorylation sites in tau from Alzheimer brain show that casein kinase 1delta may have a role, together with glycogen synthase kinase-3beta, in the pathogenesis of Alzheimer disea (PMID:17562708)
• Signal transduction pathway is defined downstream of CCK2 receptor showing that CK1 delta and epsilon phosphorylate PKD2 at 3 sites, resulting in nuclear accumulation of PKD2 and phosphorylation of nuclear PKD2 substrates in human gastric cancer cells. (PMID:17962809)
• The degradation rate of PER2, which is regulated by CKIepsilon/delta-dependent phosphorylation, was temperature-insensitive in living clock cells. (PMID:19805222)
• identified CK1delta/epsilon as new regulators of YAP and uncovered an intricate mechanism of YAP regulation (PMID:20048001)
• Site-directed mutagenesis demonstrated that only Ser-74 phosphorylation was involved in deoxycytidine kinase (dCK) activation by CKI delta, strengthening the key role of this residue in the control of dCK activity. (PMID:20637175)
• These results provide strong evidence that the centrosomal localization of CK1delta is required for Wnt-3a-dependent neuritogenesis. (PMID:21422228)
• casein kinase 1-delta phosphorylation of PGC-1alpha within its arginine/serine-rich domain enhances its degradation through the proteasome system (PMID:22052997)
• CKIdelta-EB1 complexes contribute to the increase in microtubule growth speeds observed in polarized T cells, a mechanism that might serve to generate long-stable microtubules necessary for centrosome translocation. (PMID:22123863)
• Casein kinase 1 proteomics reveal prohibitin 2 function in molecular clock (PMID:22384121)
• These results do not support that genetic variation in CSNK1D and CSNK1E is a susceptibility factor for major psychiatric disorders in the Japanese population. (PMID:22981886)
• molecular docking studies to examine the effect of the S97 mutation on its ATP-binding affinity; results explained the underlying molecular mechanism behind the observed cancer associated phenotype caused by S97C mutation in CK1delta protein (PMID:23527964)
• decreases in CKIdelta activity can contribute to the pathogenesis of migraine. (PMID:23636092)
• CK1delta and CK1epsilon play a decisive role in triggering late steps of pre-40S maturation that are required for acquisition of functionality of 40S ribosomal subunits in protein translation. (PMID:24424021)
• role for CK1delta in controlling the cell cycle (PMID:24817118)
• Results indicate that changes in the expression levels of casein kinase 1 isoforms CK1delta and DK1epsilon in colorectal tumors correlate with patients’ survival. (PMID:25404202)
• The dynamical and conformational properties for each of three isoforms of CK1 are explored through molecular dynamics (MD) simulations. (PMID:25665722)
• site-specific phosphorylation of adiponectin, especially at sites targeted by CK1delta in vitro, provides an additional regulatory mechanism for modulating adiponectin complex formation and function. (PMID:25724478)
• Inhibition of CK1delta increases lipid droplet formation and proliferation of both cancer and normal cells specifically under hypoxia and in an HIF-1alpha- and lipin-1-dependent manner. (PMID:25744540)
• the results suggest that CK1delta activity can be modulated by the interplay between CK1delta and CDK2/E or CDK5/p35. (PMID:26464264)
• CK1delta inhibition represents a promising strategy for targeted treatment in human breast cancer with Wnt/beta-catenin involvement. (PMID:26676609)
• Expression of truncated hyperactive form of CKIdelta causes mislocalization and aggregation of TDP-43 in cultured cells. (PMID:26769969)
• Protein kinase C alpha (PKCalpha) is able to phosphorylate CK1delta at its C-terminally located residues S328, T329, and S370. (PMID:26803658)
• Study describes a specific mechanism for the regulation of CK1delta activity by proline-directed kinases, and demonstrate the relevance of this regulation in the control of a key CK1delta substrate, the PER2 protein. (PMID:28545154)
• Our results reveal a new mechanism of ZNF322A oncoprotein destruction regulated by the CK1delta/GSK3beta/FBXW7a axis. Deregulation of this signaling axis results in ZNF322A overexpression and promotes cancer progression (PMID:28581525)
• Report temperature-compensated CKIdelta-dependent multi-site phosphorylation in mammals underlies temperature compensated phosphorylation in circadian clocks. (PMID:28886336)
• CK1delta phosphorylates Brg1 at Ser31/Ser35 residues to facilitate the binding of Brg1 to FBW7, leading to ubiquitination-mediated degradation. (PMID:30177679)
• X-ray crystallographic analysis of ligand-CK1delta complexes confirmed the expected binding mode of the 3,4-diaryl-isoxazole inhibitors. Surprisingly, the original compounds underwent spontaneous Pictet-Spengler cyclization with traces of formaldehyde during the co-crystallization process to form highly potent new ligands. (PMID:30832206)
• Human Rad17 is constitutively phosphorylated in vivo on a C-terminal threonine, T670. Rad17-T670 is phosphorylated by casein kinase 1delta/epsilon. (PMID:31353086)
• The effect of CK1delta/epsilon inhibition strongly depends on endogenous PER2 protein levels, which differs depending on both the molecular cause of the circadian disruption and the patient’s lighting environment. (PMID:31353796)
• Structure, regulation, and (patho-)physiological functions of the stress-induced protein kinase CK1 delta (CSNK1D). (PMID:31376410)
• CRISPR-mediated gene targeting of CK1delta/epsilon leads to enhanced understanding of their role in endocytosis via phosphoregulation of GAPVD1. (PMID:32321936)
• Targeting Casein Kinase 1 Delta Sensitizes Pancreatic and Bladder Cancer Cells to Gemcitabine Treatment by Upregulating Deoxycytidine Kinase. (PMID:32430484)
• CK1delta-Derived Peptides as Novel Tools Inhibiting the Interactions between CK1delta and APP695 to Modulate the Pathogenic Metabolism of APP. (PMID:34203978)
• Upregulation of Stress-Induced Protein Kinase CK1 Delta is associated with a Poor Prognosis for patients with Hepatocellular Carcinoma. (PMID:34280005)
• Casein Kinase 1delta Phosphorylates TDP-43 and Suppresses Its Function in Tau mRNA Processing. (PMID:36641675)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	csnk1db	ENSDARG00000006125
danio_rerio	csnk1da	ENSDARG00000008370
mus_musculus	Csnk1d	ENSMUSG00000025162
rattus_norvegicus	Csnk1d	ENSRNOG00000036676
drosophila_melanogaster	dco	FBGN0002413
caenorhabditis_elegans		WBGENE00002203

Paralogs (12): VRK2 (ENSG00000028116), CDC7 (ENSG00000097046), VRK1 (ENSG00000100749), VRK3 (ENSG00000105053), CSNK1A1 (ENSG00000113712), TTBK2 (ENSG00000128881), CSNK1G2 (ENSG00000133275), TTBK1 (ENSG00000146216), CSNK1G3 (ENSG00000151292), CSNK1G1 (ENSG00000169118), CSNK1A1L (ENSG00000180138), CSNK1E (ENSG00000213923)

Protein

Protein identifiers

Casein kinase I isoform delta — P48730 (reviewed: P48730)

Alternative names: Tau-protein kinase CSNK1D

All UniProt accessions (9): B4DLF1, P48730, H0Y2N6, H7BYT1, J3KRM8, J3KRS6, J3QQI9, J3QQU8, J3QS70

UniProt curated annotations — full annotation on UniProt →

Function. Essential serine/threonine-protein kinase that regulates diverse cellular growth and survival processes including Wnt signaling, DNA repair and circadian rhythms. It can phosphorylate a large number of proteins. Casein kinases are operationally defined by their preferential utilization of acidic proteins such as caseins as substrates. Phosphorylates connexin-43/GJA1, MAP1A, SNAPIN, MAPT/TAU, TOP2A, DCK, HIF1A, EIF6, p53/TP53, DVL2, DVL3, ESR1, AIB1/NCOA3, DNMT1, PKD2, YAP1, PER1 and PER2. Central component of the circadian clock. In balance with PP1, determines the circadian period length through the regulation of the speed and rhythmicity of PER1 and PER2 phosphorylation. Controls PER1 and PER2 nuclear transport and degradation. YAP1 phosphorylation promotes its SCF(beta-TRCP) E3 ubiquitin ligase-mediated ubiquitination and subsequent degradation. DNMT1 phosphorylation reduces its DNA-binding activity. Phosphorylation of ESR1 and AIB1/NCOA3 stimulates their activity and coactivation. Phosphorylation of DVL2 and DVL3 regulates WNT3A signaling pathway that controls neurite outgrowth. Phosphorylates NEDD9/HEF1. EIF6 phosphorylation promotes its nuclear export. Triggers down-regulation of dopamine receptors in the forebrain. Activates DCK in vitro by phosphorylation. TOP2A phosphorylation favors DNA cleavable complex formation. May regulate the formation of the mitotic spindle apparatus in extravillous trophoblast. Modulates connexin-43/GJA1 gap junction assembly by phosphorylation. Probably involved in lymphocyte physiology. Regulates fast synaptic transmission mediated by glutamate.

Subunit / interactions. Monomer. Component of the circadian core oscillator, which includes the CRY proteins, CLOCK, or NPAS2, ARTNL/BMAL1 or ARTNL2/BMAL2, CSNK1D and/or CSNK1E, TIMELESS and the PER proteins. Interacts with DNMT1 and MAP1A. Interacts directly with PER1 and PER2 which may lead to their degradation. Interacts with MAPT/TAU. Interacts with SNAPIN. Interacts with DBNDD2. Interacts with AKAP9/AKAP450; this interaction promotes centrosomal subcellular location. Binds to tubulins in mitotic cells upon DNA damage. Interacts with GJA1. Interacts with DDX3X; this interaction enhances CSNK1D kinase activity in vitro, but it is unclear whether this interaction is physiologically relevant. Interacts with FAM83A, FAM83B, FAM83E and FAM83H (via DUF1669).

Subcellular location. Cytoplasm. Nucleus. Cytoskeleton. Microtubule organizing center. Centrosome. Perinuclear region. Cell membrane. Spindle. Golgi apparatus.

Tissue specificity. Expressed in all tissues examined, including brain, heart, lung, liver, pancreas, kidney, placenta and skeletal muscle. However, kinase activity is not uniform, with highest kinase activity in splenocytes. In blood, highly expressed in hemopoietic cells and mature granulocytes. Also found in monocytes and lymphocytes.

Post-translational modifications. Autophosphorylated on serine and threonine residues; this autophosphorylation represses activity. Reactivated by phosphatase-mediated dephosphorylation. May be dephosphorylated by PP1.

Disease relevance. Advanced sleep phase syndrome, familial, 2 (FASPS2) [MIM:615224] An autosomal dominant disorder characterized by very early sleep onset and offset. Individuals are ‘morning larks’ with a 4 hours advance of the sleep, temperature and melatonin rhythms. The disease is caused by variants affecting the gene represented in this entry.

Activity regulation. Exhibits substrate-dependent heparin activation. Drug-mediated inhibition leads to a delay of the oscillations with the magnitude of this effect dependent upon the timing of drug administration. Inhibited by phosphorylation. Repressed by 3-[(2,4,6-trimethoxyphenyl)methylidenyl]-indolin-2-one (IC261), N-(2-aminoethyl)-5-chloroisoquinoline-8-sulfonamide (CKI-7), 4-[4-(2,3-dihydro-benzo[1,4]dioxin-6-yl)-5-pyridin-2-yl-1H-imidazol-2-yl]benzamide (D4476), 3,4-diaryl-isoxazoles and -imidazoles, and 4-(3-cyclohexyl-5-(4-fluoro-phenyl)-3H-imidazol-4-yl) pyrimidin-2-ylamine (PF670462, PF670).

Miscellaneous. May be involved in Alzheimer disease by phosphorylating MAPT/TAU.

Similarity. Belongs to the protein kinase superfamily. CK1 Ser/Thr protein kinase family. Casein kinase I subfamily.

Isoforms (2)

UniProt ID	Names	Canonical?
P48730-1	1	yes
P48730-2	2

RefSeq proteins (3): NP_001350678, NP_001884, NP_620693 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000719	Prot_kinase_dom	Domain
IPR008271	Ser/Thr_kinase_AS	Active_site
IPR011009	Kinase-like_dom_sf	Homologous_superfamily
IPR017441	Protein_kinase_ATP_BS	Binding_site
IPR050235	CK1_Ser-Thr_kinase-like	Family

Pfam: PF00069

Enzyme classification (BRENDA):

• EC 2.7.11.1 — non-specific serine/threonine protein kinase (BRENDA: 71 organisms, 682 substrates, 228 inhibitors, 23 Km, 6 kcat entries)
• EC 2.7.11.26 — tau-protein kinase (BRENDA: 18 organisms, 200 substrates, 549 inhibitors, 0 Km, 0 kcat entries)

Substrate kinetics (BRENDA)

8 substrates with measured Km, best-characterized 8. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
ATP	0.0007–0.64	11
KKRAARATSNVFA	0.013–0.045	3
PAH1 PHOSPHATIDATE PHOSPHATASE	0.0002	2
RRRLSSLRA	0.0036–0.0037	2
GTP	0.46	1
KKRAARASSNVFA	0.02	1
LYS-LYS-PHE-ASN-ARG-THR-LEU-SER-VAL-ALA	0.0093	1
MYELIN BASIC PROTEIN	0.145	1

Catalyzed reactions (Rhea), 4 shown:

• L-seryl-[tau protein] + ATP = O-phospho-L-seryl-[tau protein] + ADP + H(+) (RHEA:12801)
• L-seryl-[protein] + ATP = O-phospho-L-seryl-[protein] + ADP + H(+) (RHEA:17989)
• L-threonyl-[protein] + ATP = O-phospho-L-threonyl-[protein] + ADP + H(+) (RHEA:46608)
• L-threonyl-[tau protein] + ATP = O-phospho-L-threonyl-[tau protein] + ADP + H(+) (RHEA:53904)

UniProt features (59 total): helix 14, strand 11, modified residue 9, turn 6, sequence variant 4, region of interest 3, compositionally biased region 3, binding site 2, mutagenesis site 2, chain 1, domain 1, splice variant 1, sequence conflict 1, active site 1

Structure

Experimental structures (PDB)

46 structures, top 30 by resolution.

PDB	Method	Resolution (Å)
6RCG	X-RAY DIFFRACTION	1.4
6RCH	X-RAY DIFFRACTION	1.45
8IZC	X-RAY DIFFRACTION	1.45
6PXN	X-RAY DIFFRACTION	1.55
6GZM	X-RAY DIFFRACTION	1.59
8D7O	X-RAY DIFFRACTION	1.65
8D7N	X-RAY DIFFRACTION	1.66
4TWC	X-RAY DIFFRACTION	1.7
7P7G	X-RAY DIFFRACTION	1.7
6HMR	X-RAY DIFFRACTION	1.78
4HGT	X-RAY DIFFRACTION	1.8
6F26	X-RAY DIFFRACTION	1.83
7NZY	X-RAY DIFFRACTION	1.85
6F1W	X-RAY DIFFRACTION	1.86
5IH4	X-RAY DIFFRACTION	1.9
6RU8	X-RAY DIFFRACTION	1.92
3UZP	X-RAY DIFFRACTION	1.94
4KB8	X-RAY DIFFRACTION	1.95
7P7F	X-RAY DIFFRACTION	1.96
4KBA	X-RAY DIFFRACTION	1.98
4KBC	X-RAY DIFFRACTION	1.98
5W4W	X-RAY DIFFRACTION	1.99
3UYT	X-RAY DIFFRACTION	2
6PXO	X-RAY DIFFRACTION	2
6HMP	X-RAY DIFFRACTION	2.04
6RU6	X-RAY DIFFRACTION	2.05
4HNF	X-RAY DIFFRACTION	2.07
6RU7	X-RAY DIFFRACTION	2.08
4KBK	X-RAY DIFFRACTION	2.1
5OKT	X-RAY DIFFRACTION	2.13

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P48730-F1	82.10	0.68

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 128 (proton acceptor)

Ligand- & substrate-binding residues (2): 38; 15–23

Post-translational modifications (9): 328, 331, 370, 375, 382, 383, 384, 407, 411

Mutagenesis-validated functional residues (2):

Position	Phenotype
38	impaired kinase activity and abnormal subcellular localization with exclusive accumulation to the nucleus.
176	impaired kinase activity and abnormal subcellular localization with exclusive accumulation to the nucleus.

Function

Pathways and Gene Ontology

Reactome pathways

31 pathways

ID	Pathway
R-HSA-204005	COPII-mediated vesicle transport
R-HSA-2565942	Regulation of PLK1 Activity at G2/M Transition
R-HSA-380259	Loss of Nlp from mitotic centrosomes
R-HSA-380270	Recruitment of mitotic centrosome proteins and complexes
R-HSA-380284	Loss of proteins required for interphase microtubule organization from the centrosome
R-HSA-380320	Recruitment of NuMA to mitotic centrosomes
R-HSA-5620912	Anchoring of the basal body to the plasma membrane
R-HSA-6791226	Major pathway of rRNA processing in the nucleolus and cytosol
R-HSA-8854518	AURKA Activation by TPX2
R-HSA-9931521	The CRY:PER:kinase complex represses transactivation by the BMAL:CLOCK (ARNTL:CLOCK) complex
R-HSA-9931530	Phosphorylation and nuclear translocation of the CRY:PER:kinase complex
R-HSA-1640170	Cell Cycle
R-HSA-1852241	Organelle biogenesis and maintenance
R-HSA-199977	ER to Golgi Anterograde Transport
R-HSA-199991	Membrane Trafficking
R-HSA-380287	Centrosome maturation
R-HSA-392499	Metabolism of proteins
R-HSA-400253
R-HSA-446203	Asparagine N-linked glycosylation
R-HSA-453274	Mitotic G2-G2/M phases
R-HSA-5617833	Cilium Assembly
R-HSA-5653656	Vesicle-mediated transport
R-HSA-597592	Post-translational protein modification
R-HSA-68877	Mitotic Prometaphase
R-HSA-68886	M Phase
R-HSA-69275	G2/M Transition
R-HSA-69278	Cell Cycle, Mitotic
R-HSA-72312	rRNA processing
R-HSA-8868773	rRNA processing in the nucleus and cytosol
R-HSA-8953854	Metabolism of RNA

MSigDB gene sets: 390 (showing top): GOBP_CIRCADIAN_RHYTHM, BORCZUK_MALIGNANT_MESOTHELIOMA_UP, RODRIGUES_THYROID_CARCINOMA_ANAPLASTIC_UP, GOBP_PROTEIN_LOCALIZATION_TO_CYTOSKELETON, GOBP_REGULATION_OF_PROTEASOMAL_UBIQUITIN_DEPENDENT_PROTEIN_CATABOLIC_PROCESS, YAGI_AML_WITH_INV_16_TRANSLOCATION, KEGG_HEDGEHOG_SIGNALING_PATHWAY, GOBP_VESICLE_LOCALIZATION, GOBP_VESICLE_ORGANIZATION, ENK_UV_RESPONSE_KERATINOCYTE_UP, GOBP_PROTEIN_LOCALIZATION_TO_CILIUM, GOBP_NON_CANONICAL_WNT_SIGNALING_PATHWAY, GOZGIT_ESR1_TARGETS_DN, GOBP_REGULATION_OF_NON_CANONICAL_WNT_SIGNALING_PATHWAY, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN

GO Biological Process (20): protein phosphorylation (GO:0006468), endocytosis (GO:0006897), microtubule nucleation (GO:0007020), Golgi organization (GO:0007030), signal transduction (GO:0007165), Wnt signaling pathway (GO:0016055), positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436), circadian regulation of gene expression (GO:0032922), protein localization to Golgi apparatus (GO:0034067), regulation of circadian rhythm (GO:0042752), COPII vesicle coat assembly (GO:0048208), spindle assembly (GO:0051225), protein localization to cilium (GO:0061512), protein localization to centrosome (GO:0071539), positive regulation of canonical Wnt signaling pathway (GO:0090263), midbrain dopaminergic neuron differentiation (GO:1904948), non-motile cilium assembly (GO:1905515), positive regulation of non-canonical Wnt signaling pathway (GO:2000052), regulation of Wnt signaling pathway (GO:0030111), rhythmic process (GO:0048511)

GO Molecular Function (10): protein kinase activity (GO:0004672), protein serine/threonine kinase activity (GO:0004674), ATP binding (GO:0005524), cadherin binding (GO:0045296), tau-protein kinase activity (GO:0050321), protein serine kinase activity (GO:0106310), nucleotide binding (GO:0000166), protein binding (GO:0005515), kinase activity (GO:0016301), transferase activity (GO:0016740)

GO Cellular Component (18): nucleus (GO:0005634), nucleoplasm (GO:0005654), cytoplasm (GO:0005737), Golgi apparatus (GO:0005794), centrosome (GO:0005813), spindle (GO:0005819), cytosol (GO:0005829), spindle microtubule (GO:0005876), plasma membrane (GO:0005886), cilium (GO:0005929), actin cytoskeleton (GO:0015629), endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116), ciliary basal body (GO:0036064), perinuclear region of cytoplasm (GO:0048471), sperm principal piece (GO:0097228), sperm end piece (GO:0097229), cytoskeleton (GO:0005856), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-13 pathways:

Category	Pathways
G2/M Transition	3
Centrosome maturation	2
Circadian clock	2
ER to Golgi Anterograde Transport	1
Loss of proteins required for interphase microtubule organization from the centrosome	1
Mitotic Prometaphase	1
Assembly of the 9+0 primary cilium	1
rRNA processing in the nucleus and cytosol	1
Membrane Trafficking	1
Transport to the Golgi and subsequent modification	1
Vesicle-mediated transport	1
Post-translational protein modification	1
Cell Cycle, Mitotic	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	7
cytoplasm	3
circadian rhythm	2
protein localization to organelle	2
positive regulation of Wnt signaling pathway	2
protein kinase activity	2
intracellular membrane-bounded organelle	2
microtubule organizing center	2
intracellular membraneless organelle	2
sperm flagellum	2
phosphorylation	1
protein modification process	1
vesicle budding from membrane	1
membrane invagination	1
vesicle-mediated transport	1
import into cell	1
microtubule cytoskeleton organization	1
microtubule polymerization	1
organelle organization	1
endomembrane system organization	1
cell communication	1
cellular process	1
signaling	1
regulation of cellular process	1
cellular response to stimulus	1
cell surface receptor signaling pathway	1
regulation of proteasomal ubiquitin-dependent protein catabolic process	1
proteasome-mediated ubiquitin-dependent protein catabolic process	1
positive regulation of proteasomal protein catabolic process	1
positive regulation of ubiquitin-dependent protein catabolic process	1
regulation of gene expression	1
regulation of biological process	1
vesicle coat assembly	1
protein-containing complex assembly	1
COPII-coated vesicle budding	1
spindle organization	1
chromosome segregation	1
membraneless organelle assembly	1
protein localization to microtubule organizing center	1
canonical Wnt signaling pathway	1

Protein interactions and networks

STRING

2196 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CSNK1D	CRY1	Q16526	865
CSNK1D	PER2	O15055	836
CSNK1D	PER3	P56645	831
CSNK1D	CHKA	P35790	784
CSNK1D	BMAL1	O00327	720
CSNK1D	CRY2	Q49AN0	699
CSNK1D	CLOCK	O15516	679
CSNK1D	NR1D1	P20393	661
CSNK1D	NPAS2	Q99743	660
CSNK1D	BHLHE40	O14503	650
CSNK1D	FBXL3	Q9UKT7	635
CSNK1D	DBT	P11182	619
CSNK1D	TIMELESS	Q9UNS1	568
CSNK1D	BMAL2	Q8WYA1	546
CSNK1D	NR1D2	Q14995	538

IntAct

170 interactions, top by confidence:

A	B	Type	Score
IKBKG	IKBKB	psi-mi:“MI:0914”(association)	0.980
FAM83H	CSNK1A1	psi-mi:“MI:0914”(association)	0.920
CSNK1A1	FAM83G	psi-mi:“MI:0914”(association)	0.900
CSNK1D	PER2	psi-mi:“MI:0217”(phosphorylation reaction)	0.810
PER2	CSNK1D	psi-mi:“MI:0915”(physical association)	0.810
CSNK1D	PER2	psi-mi:“MI:0914”(association)	0.810
FAM83B	CSNK1A1	psi-mi:“MI:0914”(association)	0.800
CSNK1D	GAPVD1	psi-mi:“MI:0915”(physical association)	0.740
CSNK1D	DVL3	psi-mi:“MI:0915”(physical association)	0.670
DVL3	CSNK1D	psi-mi:“MI:0915”(physical association)	0.670
CSNK1D	ZNF618	psi-mi:“MI:0915”(physical association)	0.670
CSNK1D	LURAP1	psi-mi:“MI:0915”(physical association)	0.610
LURAP1	CSNK1D	psi-mi:“MI:0915”(physical association)	0.610
CSNK1D	MDM2	psi-mi:“MI:0915”(physical association)	0.610
MDM2	CSNK1D	psi-mi:“MI:0403”(colocalization)	0.610
MDM2	CSNK1D	psi-mi:“MI:0915”(physical association)	0.610
CSNK1D	TRIM9	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (375): DVL3 (Two-hybrid), TRIM9 (Two-hybrid), LURAP1 (Two-hybrid), BRCA1 (Two-hybrid), CSNK1D (Affinity Capture-MS), CSNK1D (Two-hybrid), CSNK1D (Affinity Capture-Western), MAPT (Biochemical Activity), TP53 (Biochemical Activity), CSNK1D (Affinity Capture-Western), PER2 (Two-hybrid), CSNK1D (Affinity Capture-MS), CSNK1D (Affinity Capture-MS), CSNK1D (Affinity Capture-MS), CSNK1D (Affinity Capture-MS)

ESM2 similar proteins: A7E3X2, O74135, P29295, P35508, P40233, P40234, P40236, P42158, P48730, P49674, P51566, P78368, Q03141, Q06486, Q20471, Q39050, Q4R9A9, Q556Y4, Q5BP74, Q5PRD4, Q5R4V3, Q5RC72, Q5XF24, Q5ZJS0, Q5ZLL1, Q62761, Q62762, Q62763, Q6K9N1, Q6NRT0, Q6P3K7, Q6P647, Q7T2E3, Q8BTH8, Q8BVP5, Q8C4X2, Q8LPI7, Q8LPJ1, Q8VYK9, Q8WQ99

Diamond homologs: A7E3X2, B9VVJ6, O15726, O19175, O74135, O76324, O80888, P16912, P22517, P23291, P23292, P28327, P29295, P34516, P34633, P35507, P35508, P35509, P39962, P40230, P40233, P40234, P40235, P40236, P42158, P42168, P48729, P48730, P49615, P49674, P51166, P54367, P67827, P67828, P67829, P67962, P67963, P78368, P81123, P97633

SIGNOR signaling

76 interactions.

A	Effect	B	Mechanism
CSNK1D	down-regulates	MAPT	phosphorylation
CSNK1D	down-regulates	LEF1	phosphorylation
CSNK1D	up-regulates	KIR3DL1	phosphorylation
CSNK1D	down-regulates	HIF1A	phosphorylation
CSNK1D	down-regulates	MDM2	phosphorylation
CSNK1D	up-regulates	NCOA3	phosphorylation
CSNK1D	up-regulates	DVL2	phosphorylation
CSNK1D	up-regulates	UHRF1	phosphorylation
CSNK1D	down-regulates	YAP1	phosphorylation
GSK3B/Axin/APC	up-regulates	CSNK1D	binding
CSNK1D	up-regulates	GSK3B/Axin/APC	phosphorylation
CSNK1D	up-regulates	GSK3B/Axin/APC	binding
CSNK1D	down-regulates	WWTR1	phosphorylation
CSNK1D	unknown	BACE1	phosphorylation
CSNK1D	“down-regulates quantity by destabilization”	ZNF322	phosphorylation
CSNK1D	“down-regulates quantity by destabilization”	PER2	phosphorylation
CSNK1D	“down-regulates quantity by destabilization”	PER1	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 155 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Regulation of TP53 Degradation	5	14.9×	1e-03
SUMO E3 ligases SUMOylate target proteins	6	10.9×	1e-03
PKR-mediated signaling	7	10.1×	8e-04
SUMOylation	6	10.0×	1e-03
TP53 Regulates Transcription of DNA Repair Genes	5	9.2×	6e-03
AURKA Activation by TPX2	5	7.8×	8e-03
Transcriptional Regulation by TP53	10	6.3×	7e-04
SARS-CoV-2 Infection	7	5.7×	6e-03

GO biological processes:

GO term	Partners	Fold	FDR
amyloid fibril formation	5	22.3×	3e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

54 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	0
Uncertain significance	27
Likely benign	10
Benign	2

Top pathogenic / likely-pathogenic (2)

Variant ID	HGVS	Classification
50319	NM_001893.6(CSNK1D):c.137A>G (p.His46Arg)	Pathogenic
8741	NM_001893.6(CSNK1D):c.130A>G (p.Thr44Ala)	Pathogenic

SpliceAI

2054 predictions. Top by Δscore:

Variant	Effect	Δscore
17:82248870:CCTA:C	donor_loss	1.0000
17:82248871:CTA:C	donor_loss	1.0000
17:82248988:C:CT	acceptor_gain	1.0000
17:82249010:GTTAG:G	acceptor_gain	1.0000
17:82249011:TTAG:T	acceptor_gain	1.0000
17:82249012:TAG:T	acceptor_gain	1.0000
17:82249013:AG:A	acceptor_gain	1.0000
17:82249015:C:A	acceptor_loss	1.0000
17:82249015:C:CC	acceptor_gain	1.0000
17:82249472:T:TA	donor_gain	1.0000
17:82250047:AGGGT:A	donor_gain	1.0000
17:82251374:CTT:C	donor_loss	1.0000
17:82251376:TACAA:T	donor_loss	1.0000
17:82251377:A:AC	donor_gain	1.0000
17:82251378:C:CT	donor_gain	1.0000
17:82251378:CA:C	donor_gain	1.0000
17:82251378:CAA:C	donor_gain	1.0000
17:82251378:CAAA:C	donor_gain	1.0000
17:82251378:CAAAT:C	donor_gain	1.0000
17:82251480:C:CT	acceptor_gain	1.0000
17:82251483:C:CT	acceptor_gain	1.0000
17:82251484:A:T	acceptor_gain	1.0000
17:82251488:C:CT	acceptor_gain	1.0000
17:82251490:C:CT	acceptor_gain	1.0000
17:82251523:TTCGG:T	acceptor_gain	1.0000
17:82251524:TCGG:T	acceptor_gain	1.0000
17:82251525:CGG:C	acceptor_gain	1.0000
17:82251525:CGGC:C	acceptor_gain	1.0000
17:82251528:C:CC	acceptor_gain	1.0000
17:82252432:A:AC	donor_gain	1.0000

AlphaMissense

2703 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
17:82251394:C:A	W290C	1.000
17:82251394:C:G	W290C	1.000
17:82251395:C:A	W290L	1.000
17:82251395:C:G	W290S	1.000
17:82251396:A:G	W290R	1.000
17:82251396:A:T	W290R	1.000
17:82251400:G:C	F288L	1.000
17:82251400:G:T	F288L	1.000
17:82251401:A:G	F288S	1.000
17:82251402:A:C	F288V	1.000
17:82251402:A:G	F288L	1.000
17:82251402:A:T	F288I	1.000
17:82251410:T:A	D285V	1.000
17:82251411:C:G	D285H	1.000
17:82251437:A:G	L276P	1.000
17:82251443:C:G	R274P	1.000
17:82251473:G:T	P264H	1.000
17:82251484:A:C	F260L	1.000
17:82251484:A:T	F260L	1.000
17:82251485:A:C	F260C	1.000
17:82251485:A:G	F260S	1.000
17:82251486:A:G	F260L	1.000
17:82251497:C:G	R256P	1.000
17:82252447:A:C	C241W	1.000
17:82252474:T:A	K232N	1.000
17:82252474:T:G	K232N	1.000
17:82252475:T:A	K232I	1.000
17:82252476:T:C	K232E	1.000
17:82252476:T:G	K232Q	1.000
17:82252487:A:C	I228S	1.000

dbSNP variants (sampled 300 via entrez): RS1000015641 (17:82246256 T>C,G), RS1000041621 (17:82244390 T>C), RS1000071215 (17:82246488 T>C), RS1000074297 (17:82244186 C>T), RS1000093193 (17:82273903 C>T), RS1000165210 (17:82264028 G>A), RS1000234448 (17:82264483 C>A), RS1000324183 (17:82255785 G>A,C), RS1000459710 (17:82248799 G>A), RS1000494545 (17:82265953 A>C), RS1000543732 (17:82240316 AAGACGAGGAGGCAGGGAGC>A,AAGACGAGGAGGCAGGGAGCAGACGAGGAGGCAGGGAGC), RS1000562211 (17:82263401 G>C,T), RS1000601582 (17:82249960 G>C), RS1000749857 (17:82259331 T>C,G), RS1000924850 (17:82272824 T>C)

Disease associations

OMIM: gene MIM:600864 | disease phenotypes: MIM:615224

GenCC curated gene-disease

Disease	Classification	Inheritance
advanced sleep phase syndrome	Supportive	Autosomal dominant

Mondo (2): advanced sleep phase syndrome 2 (MONDO:0014088), advanced sleep phase syndrome (MONDO:0015609)

Orphanet (1): Familial advanced sleep-phase syndrome (Orphanet:164736)

HPO phenotypes

6 total (6 of 6 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0002076	Migraine
HP:0002077	Migraine with aura
HP:0002083	Migraine without aura
HP:0006979	Sleep-wake cycle disturbance
HP:0031873	Early chronotype

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (6): CHEMBL2111458 (PROTEIN FAMILY), CHEMBL2828 (SINGLE PROTEIN), CHEMBL3038494 (PROTEIN COMPLEX), CHEMBL4523610 (PROTEIN FAMILY), CHEMBL6195517 (PROTEIN-PROTEIN INTERACTION), CHEMBL6195535 (PROTEIN-PROTEIN INTERACTION)

Molecules with ChEMBL bioactivity

35 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 356,188 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL288441	BOSUTINIB	4	12,255
CHEMBL502835	NINTEDANIB	4	8,545
CHEMBL535	SUNITINIB	4	79,020
CHEMBL553	ERLOTINIB	4	108,300
CHEMBL939	GEFITINIB	4	117,814
CHEMBL223360	LINIFANIB	3	3,925
CHEMBL31965	CANERTINIB	3	8,083
CHEMBL522892	DOVITINIB	3	4,944
CHEMBL1230165	SILMITASERTIB	2	593
CHEMBL14762	SELICICLIB	2	3,787
CHEMBL1614713	CC-401	2	389
CHEMBL1721885	SU-014813	2	363
CHEMBL1944698	ZOTIRACICLIB	2	2,915
CHEMBL1967878	CENISERTIB	2	358
CHEMBL1980297	ILORASERTIB	2	581
CHEMBL215152	DEFOSBARASERTIB	2	372
CHEMBL230011	TG100-115	2	1,504
CHEMBL2364611	GALUNISERTIB	2	1,929
CHEMBL363648	TAK-715	2	442
CHEMBL4129018	MW-150	2	69
CHEMBL513909	BI-2536	2
CHEMBL521851	PICTILISIB	2
CHEMBL564829	MILCICLIB	2
CHEMBL607707	PELITINIB	2
CHEMBL1090479	GSK-1070916	1
CHEMBL1230122	R-1487	1
CHEMBL1908397	KW-2449	1
CHEMBL269538	HARMINE	1
CHEMBL296468	BMS-387032	1
CHEMBL3544966	GSK-1059615	1

PharmGKB: 1 entry (VIP=true, CPIC=false)

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — Casein kinase 1 (CK1) family

Most potent curated ligand interactions (7 total), top 7:

Ligand	Action	Affinity	Parameter
PF-670462	Inhibition	7.85	pIC50
CDK inhibitor 4.35	Inhibition	7.35	pIC50
compound 14 [PMID: 24900428]	Inhibition	7.23	pIC50
JNJ-6204	Inhibition	7.21	pIC50
D4476	Inhibition	6.52	pIC50
PF-4800567	Inhibition	6.15	pIC50
IC261	Inhibition	6.0	pIC50

Binding affinities (BindingDB)

790 measured of 1123 human assays (1124 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value	Patent
N-(6-(4-(4-fluorophenyl)-1- (1-(2-hydroxyethyl)piperidin- 4-yl)-1H-imidazol-5-yl)imidazo [1,2-b]pyridazin-2-yl)- 4-methyl-2-(pyridin-3-yl) thiazole-5-carboxamide	IC50	0.034 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-fluoro-N-(6-(4-(4- fluorophenyl)-1-(1- (2-hydroxyethyl)azetidin- 3-yl)-1H-imidazol-5- yl)imidazo[1,2-b]pyridazin- 2-yl)isonicotinamide	IC50	0.034 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(4-(4-fluorophenyl)-1-(piperidin-4-yl)-1H-imidazol-5-yl)imidazo[1,2-b]pyridazin-2-yl)-4-methyl-2-(pyridin-3-yl)thiazole-5-carboxamide	IC50	0.06 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(4-(4-fluorophenyl)-1-(piperidin-4-yl)-1H-imidazol-5-yl)imidazo[1,2-b]pyridazin-2-yl)isonicotinamide	IC50	0.064 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(1-(1-(2-aminoacetyl)piperidin-4- yl)-4-(4-fluorophenyl)-1H-imidazol-5- yl)imidazo[1,2-b]pyridazin-2-yl)-2- fluoroisonicotinamide	IC50	0.085 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(1-(1-(2-amino-2- oxoethyl)piperidin-4-yl)-4-(4- fluorophenyl)-1H-imidazol-5- yl)imidazo[1,2-b] pyridazin-2-yl)-4- methyl-2-(pyridin-3-yl) thiazole-5- carboxamide	IC50	0.091 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(2-(4-fluorophenyl) imidazo[1,2-a]pyridin-3-yl) imidazo[1,2-b]pyridazin-2-yl)- 2-pivalamidoisonicotinamide	IC50	0.096 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-fluoro-N-[6-[3-(4-fluorophenyl)-5-[4-(2-hydroxyethyl)piperazin-1-yl]-1-methylpyrazol-4-yl]imidazo[1,2-b]pyridazin-2-yl]pyridine-4-carboxamide	IC50	0.1 nM	US-9475817: Pyrazole substituted imidazopyrazines as casein kinase 1 d/e inhibitors
N-[6-[5-[4-(2-aminoacetyl)piperazin-1-yl]-3-(4-fluorophenyl)-1-methylpyrazol-4-yl]imidazo[1,2-b]pyridazin-2-yl]-2-fluoropyridine-4-carboxamide	IC50	0.1 nM	US-9475817: Pyrazole substituted imidazopyrazines as casein kinase 1 d/e inhibitors
2-Fluoro-N-(6-(2-(4-fluorophenyl)-7-pivaloyl- 5,6,7,8-tetrahydroimidazo[1,2-a]pyrazin-3- yl)imidazo[1,2-b]pyridazin-2- yl)isonicotinamide	IC50	0.1 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(1-(1-((1,3-dimethyl-1H-pyrazol-4- yl)methyl)piperidin-4-yl)-4-(4- fluorophenyl)-1H-imidazol-5- yl)imidazo[1,2-b]pyridazin-2-yl)-2- fluoroisonicotinamide	IC50	0.101 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(4-(4-fluorophenyl)-1- (2-morpholinoethyl)-1H- imidazol-5-yl)imidazo[1,2-b] pyridazin-2-yl)-3- (pyridin-3-yl)benzamide	IC50	0.104 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(4-(4-chlorophenyl)-1-(2- fluoroethyl)-2-methyl-1H-imidazol- 5-yl)imidazo[1,2-b]pyridazin-2-yl)- 2-fluoroisonicotinamide	IC50	0.109 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(4-(4-fluorophenyl)-1- (2-morpholinoethyl)-1H- imidazol-5-yl)imidazo[1,2-b] pyridazin-2-yl)-2- morpholinoisonicotinamide	IC50	0.11 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-Fluoro-N-(6-(1-(2-fluoroethyl)-4-(4-fluorophenyl)-2-methyl-1H-imidazol-5-yl)imidazo[1,2-b]pyridazin-2-yl)isonicotinamide	IC50	0.11 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-(dimethylamino)-N-(6-(2-(4- fluorophenyl)imidazo[1,2-a] pyridin-3-yl)imidazo[1,2-b] pyridazin-2-yl) isonicotinamide	IC50	0.111 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
(S)-2-fluoro-N-(6-(4-(4- fluorophenyl)-2-methyl-1- (1-(3,3,3-trifluoro-2- hydroxypropyl)piperidin-4- yl)-1H-imidazol-5-yl)imidazo [1,2-b]pyridazin-2- yl)isonicotinamide	IC50	0.112 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(1-(1-(3,3- difluorocyclobutanecarbonyl)piperidin- 4-yl)-4-(4-fluorophenyl)-1H-imidazol-5- yl)imidazo[1,2-b]pyridazin-2-yl)-2- fluoroisonicotinamide	IC50	0.116 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(4-(4-chlorophenyl)-2-methyl- 1-(2,2,2-trifluoroethyl)-1H- imidazol-5-yl)imidazo[1,2-b] pyridazin-2-yl)-2-fluoroisonicotin- amide	IC50	0.126 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-fluoro-N-(6-(4-(4-fluorophenyl)-1-(1- (2-hydroxyacetyl)piperidin-4-yl)-1H- imidazol-5-yl)imidazo[1,2-6]pyridazin- 2-yl)isonicotinamide	IC50	0.128 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-fluoro-N-(6-(4-(4-fluorophenyl)-1-(1 isonicotinoylpiperidin-4-yl)-1H- imidazol-5-yl)imidazo[1,2-b]pyridazin- 2-yl)isonicotinamide	IC50	0.13 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-fluoro-N-(6-(4-(4-fluorophenyl)-1-(1- (2-methoxyethyl)piperidin-4-yl)-1H- imidazol-5-yl)imidazo[1,2-b]pyridazin- 2-yl)isonicotinamide	IC50	0.136 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
3,3,3-trifluoropropyl 4-(5-(2-(2- fluoroisonicotinamido)imidazo[1,2- b]pyridazin-6-yl)-4-(4-fluorophenyl)- 1H-imidazol-1-yl)piperidine-1- carboxylate	IC50	0.142 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(1-(1-(3- chloropropanoyl)piperidin-4-yl)-4-(4- fluorophenyl)-1H-imidazol-5- yl)imidazo[1,2-b]pyridazin-2-yl)-2- fluoroisonicotinamide	IC50	0.143 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(1-(1-(2-amino-2- oxoethyl)piperidin-4-yl)-4-(4- fluorophenyl)-1H-imidazol-5- yl)imidazo[1,2-b]pyridazin-2-yl)-2,6- difluoroisonicotinamide	IC50	0.146 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-fluoro-N-(6-(4-(4-fluorophenyl)- 1-(2-(1H-pyrazol-4-yl)ethyl-1H- imidazol-5-yl)imidazo[1,2-b] pyridazin-2-yl)isonicotinamide	IC50	0.147 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
6-fluoro-N-(6-(4-(4-fluoro- phenyl)-1,2-dimethyl-1H- imidazol-5-yl)imidazo[1,2-b] pyridazin-2-yl)nicotinamide	IC50	0.152 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(4-(4-fluorophenyl)-1-(1-(3,3,3-trifluoropropyl)piperidin-4-yl)-1H-imidazol-5-yl)imidazo[1,2-b]pyridazin-2-yl)thiazole-5-carboxamide	IC50	0.159 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-fluoro-N-(6-(4-(4-fluorophenyl)-1-(1- ((5-methylisoxazol-3- yl)methyl)piperidin-4-yl)-1H-imidazol- 5-yl)imidazo[1,2-b]pyridazin-2- yl)isonicotinamide	IC50	0.165 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(4-(4-fluorophenyl)-1-(furan-3- ylmethyl)-1H-imidazol-5-yl)imidazo[1,2- b]pyridazin-2-yl)pivalamide	IC50	0.169 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(1-(1-((1H-pyrazol-5- yl)methyl)piperidin-4-yl)-4-(4- fluorophenyl)-1H-imidazol-5- yl)imidazo[1,2-b]pyridazin-2-yl)-2- fluoroisonicotinamide	IC50	0.17 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
oxetan-3-yl 4-[4-(4-fluorophenyl)-5-[2-[(2-fluoropyridine-4-carbonyl)amino]imidazo[1,2-b]pyridazin-6-yl]imidazol-1-yl]piperidine-1-carboxylate	IC50	0.171 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(1-(1-(1- cyanocyclopropanecarbonyl)piperidin- 4-yl)-4-(4-fluorophenyl)-1H-imidazol-5- yl)imidazo[1,2-b]pyridazin-2-yl)-2- fluoroisonicotinamide	IC50	0.172 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(4-(4-fluorophenyl)-1-(1-(isoxazole-3-carbonyl)piperidin-4-yl)-1H-imidazol-5-yl)imidazo[1,2-b]pyridazin-2-yl)thiazole-5-carboxamide	IC50	0.173 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(4-(4-fluorophenyl)-1- (1-(3,3,3-trifluoropropanoyl) piperidin-4-yl)-1H- imidazol-5-yl)imidazo[1,2-b] pyridazin-2-yl)thiazole- 5-carboxamide	IC50	0.175 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-fluoro-N-(6-(4-(4-fluorophenyl)-1-(1- (2-hydroxy-2-methylpropanoyl) piperidin-4-yl)-1H-imidazol-5- yl)imidazo[1,2-b]pyridazin-2- yl)isonicotinamide	IC50	0.178 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
methyl 4-[4-(4-fluorophenyl)-5-[2-[(2-fluoropyridine-4-carbonyl)amino]imidazo[1,2-b]pyridazin-6-yl]imidazol-1-yl]piperidine-1-carboxylate	IC50	0.179 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-fluoro-N-(6-(4-(4-fluorophenyl)-1-(1- (2-morpholinoethyl)piperidin-4-yl)-1H- imidazol-5-yl)imidazo[1,2-b]pyridazin- 2-yl)isonicotinamide	IC50	0.183 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(1-(1-(1H-imidazole-4- carbonyl)piperidin-4-yl)-4-(4- fluorophenyl)-1H-imidazol-5- yl)imidazo(1,2-b]pyridazin-2-yl)-2- fluoroisonicotinamide	IC50	0.183 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-fluoro-N-(6-(4-(4-fluorophenyl)-1-(1- (2-morpholinoacetyl)piperidin-4-yl)-1H- imidazol-5-yl)imidazo[1,2-b]pyridazin- 2-yl)isonicotinamide	IC50	0.186 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-fluoro-N-(6-(4-(4-fluoro-3- methylphenyl)-1-(2-fluoroethyl)- 2-methyl-1H-imidazol-5-yl) imidazo[1,2-b]pyridazin-2-yl) isonicotinamide	IC50	0.186 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(4-(4-fluorophenyl)-1,2- dimethyl-1H-imidazol-5-yl) imidazo[1,2-b]pyridazin-2- yl)isoquinoline-6- carboxamide	IC50	0.187 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
2-fluoro-N-(6-(1-(1-(4- fluorobenzoyl)piperidin-4-yl)-4-(4- fluorophenyl)-1H-imidazol-5- yl)imidazo[1,2-b]pyridazin-2- yl)isonicotinamide	IC50	0.191 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(4-(4-fluorophenyl)-1- (2-morpholinoethyl)-1H- imidazol-5-yl)imidazo[1,2-b] pyridazin-2-yl)quinoline- 4-carboxamide	IC50	0.192 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(1-(1- (cyclobutanecarbonyl)piperidin-4-yl)-4- (4-fluorophenyl)-1H-imidazol-5- yl)imidazo[1,2-b]pyridazin-2-yl)-2- fluoroisonicotinamide	IC50	0.193 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
(S)—N-(6-(4-(4-fluorophenyl)-1-(1-(3,3,3-trifluoro-2-hydroxypropyl)piperidin-4-yl)-1H-imidazol-5-yl)imidazo[1,2-b]pyridazin-2-yl)thiazole-5-carboxamide	IC50	0.194 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
(S)-N-(6-(4-(4-fluorophenyl)-1-(1-(3,3,3- trifluoro-2-hydroxypropyl)piperidin-4-yl)- 1H-imidazol-5-yl)imidazo[1,2- b]pyridazin-2-yl)isonicotinamide	IC50	0.195 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(1-(1-(2-cyanoethyl)piperidin-4-yl)-4-(4-fluorophenyl)-1H-imidazol-5-yl)imidazo[1,2-b]pyridazin-2-yl)-2-fluoroisonicotinamide	IC50	0.197 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-(6-(1-(1-(2-cyanoacetyl)piperidin-4- yl)-4-(4-fluorophenyl)-1H-imidazol-5- yl)imidazo[1,2-b]pyridazin-2-yl)-2- fluoroisonicotinamide	IC50	0.198 nM	US-9556179: Substituted imidazoles as casein kinase 1 D/E inhibitors
N-[6-[5-[4-(2-amino-2-oxoethyl)piperazin-1-yl]-3-(4-fluorophenyl)-1-methylpyrazol-4-yl]imidazo[1,2-b]pyridazin-2-yl]-2-fluoropyridine-4-carboxamide	IC50	0.2 nM	US-9475817: Pyrazole substituted imidazopyrazines as casein kinase 1 d/e inhibitors

ChEMBL bioactivities

1572 potent at pChembl≥5 of 1615 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
10.47	IC50	0.034	nM	CHEMBL5914602
10.47	IC50	0.034	nM	CHEMBL5809866
10.22	IC50	0.06	nM	CHEMBL5819750
10.19	IC50	0.064	nM	CHEMBL5854794
10.07	IC50	0.085	nM	CHEMBL5865470
10.04	IC50	0.091	nM	CHEMBL5757040
10.02	IC50	0.096	nM	CHEMBL5927613
10.00	IC50	0.1	nM	CHEMBL3961316
10.00	IC50	0.1	nM	CHEMBL3962177
10.00	IC50	0.101	nM	CHEMBL5973836
10.00	IC50	0.1	nM	CHEMBL5743590
9.98	IC50	0.104	nM	CHEMBL6053955
9.96	IC50	0.11	nM	CHEMBL5862825
9.96	IC50	0.111	nM	CHEMBL5870727
9.96	IC50	0.11	nM	CHEMBL5884113
9.96	IC50	0.109	nM	CHEMBL5966787
9.95	IC50	0.112	nM	CHEMBL5767137
9.94	IC50	0.116	nM	CHEMBL5883463
9.90	IC50	0.126	nM	CHEMBL5868404
9.89	IC50	0.128	nM	CHEMBL6055485
9.89	IC50	0.13	nM	CHEMBL5852327
9.87	IC50	0.136	nM	CHEMBL5766994
9.85	IC50	0.143	nM	CHEMBL5805800
9.85	IC50	0.142	nM	CHEMBL5929543
9.84	IC50	0.146	nM	CHEMBL6060995
9.83	IC50	0.147	nM	CHEMBL5891223
9.82	IC50	0.152	nM	CHEMBL6041089
9.80	IC50	0.159	nM	CHEMBL5885272
9.78	IC50	0.165	nM	CHEMBL6017462
9.77	IC50	0.17	nM	CHEMBL5953519
9.77	IC50	0.171	nM	CHEMBL5763121
9.77	IC50	0.169	nM	CHEMBL5803646
9.76	IC50	0.172	nM	CHEMBL5960479
9.76	IC50	0.173	nM	CHEMBL5815025
9.76	IC50	0.175	nM	CHEMBL5996818
9.75	IC50	0.178	nM	CHEMBL5894735
9.75	IC50	0.179	nM	CHEMBL6022811
9.74	IC50	0.183	nM	CHEMBL5980138
9.74	IC50	0.183	nM	CHEMBL5928816
9.73	IC50	0.186	nM	CHEMBL5914505
9.73	IC50	0.186	nM	CHEMBL5886294
9.73	IC50	0.187	nM	CHEMBL5822120
9.72	IC50	0.191	nM	CHEMBL6060125
9.72	IC50	0.192	nM	CHEMBL5964363
9.71	IC50	0.195	nM	CHEMBL5742519
9.71	IC50	0.197	nM	CHEMBL5764626
9.71	IC50	0.193	nM	CHEMBL5748483
9.71	IC50	0.194	nM	CHEMBL5885676
9.70	IC50	0.2	nM	CHEMBL3939027
9.70	IC50	0.2	nM	CHEMBL4108038

PubChem BioAssay actives

401 with measured affinity, of 2886 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-[3-(4-fluorophenyl)-1-methylpyrazol-4-yl]-1H-pyrazolo[3,4-b]pyridine	1985767: Inhibition of N-terminal GST-tagged recombinant human CK1 delta expressed in Escherichia coli BL21 cells using PLSRTL-pS-VA-pS-LPGL as substrate measured after 60 mins in presence of ATP by ADP-Glo assay	ic50	0.0014	uM
4-N-[5-chloro-4-[5-(cyclopropylmethyl)-1-methylpyrazol-4-yl]pyrimidin-2-yl]cyclohexane-1,4-diamine	1868082: Inhibition of CSNK1D (unknown origin)	ic50	0.0018	uM
4-[3-(4-fluorophenyl)-1-methylpyrazol-4-yl]-1H-pyrrolo[2,3-b]pyridine	1985767: Inhibition of N-terminal GST-tagged recombinant human CK1 delta expressed in Escherichia coli BL21 cells using PLSRTL-pS-VA-pS-LPGL as substrate measured after 60 mins in presence of ATP by ADP-Glo assay	ic50	0.0022	uM
4-[3-(5-fluoro-2-pyridinyl)-1-methylpyrazol-4-yl]-1H-pyrrolo[2,3-b]pyridine	1985767: Inhibition of N-terminal GST-tagged recombinant human CK1 delta expressed in Escherichia coli BL21 cells using PLSRTL-pS-VA-pS-LPGL as substrate measured after 60 mins in presence of ATP by ADP-Glo assay	ic50	0.0029	uM
4-[5-(4-fluorophenyl)-3-[1-(1,2-oxazol-3-ylmethyl)piperidin-4-yl]imidazol-4-yl]pyrimidin-2-amine	1733442: Inhibition of wild-type human CK1delta using PLSRTLpSVASLPGL as substrate incubated for 40 mins in presence of ATP by Kinase-Glo luminescence assay	ic50	0.0039	uM
5-(3-chloroanilino)benzo[c][2,6]naphthyridine-8-carboxylic acid	1831537: Inhibition of CK1 (unknown origin)	ic50	0.0040	uM
(E)-3-(2,4-dimethoxyphenyl)-N-[4-[5-(4-fluorophenyl)-2-methylsulfanyl-1H-imidazol-4-yl]-2-pyridinyl]prop-2-enamide	1989847: Inhibition of CK1delta (unknown origin)	ic50	0.0040	uM
(E)-3-(2,4-dimethoxyphenyl)-N-[4-[5-(4-fluorophenyl)-2-methylsulfinyl-1H-imidazol-4-yl]-2-pyridinyl]prop-2-enamide	448712: Inhibition of recombinant CK1delta kinase domain by Cherenkov counting	ic50	0.0050	uM
9-[3-(4-fluorophenyl)-1-methylpyrazol-4-yl]-2,3,4,5-tetrahydropyrido[2,3-f][1,4]oxazepine	767016: Inhibition of CK1 delta (unknown origin) using PLSRTLpSVASLPGL as substrate after 60 mins by microplate reader analysis	ic50	0.0060	uM
3-[4-[3-(4-fluorophenyl)-1-methylpyrazol-4-yl]-2-pyridinyl]morpholine	1989847: Inhibition of CK1delta (unknown origin)	ic50	0.0066	uM
4-[3-cyclohexyl-5-(4-fluorophenyl)imidazol-4-yl]pyrimidin-2-amine	767016: Inhibition of CK1 delta (unknown origin) using PLSRTLpSVASLPGL as substrate after 60 mins by microplate reader analysis	ic50	0.0078	uM
(7S)-2-(3,5-difluoro-4-hydroxyanilino)-7,8-dimethyl-5-[(3-methyl-1,2-oxazol-5-yl)methyl]-7H-pteridin-6-one	2077284: Inhibition of human CK1 delta assessed as inhibition constant by Cheng-Prusoff equation analysis	ki	0.0083	uM
N-(1,3-benzothiazol-2-ylmethyl)-9-(3-fluorophenyl)-2-morpholin-4-ylpurin-6-amine	1373027: Inhibition of recombinant human full length N-terminal GST-tagged CK1delta expressed in baculovirus in Sf9 insect cells using ULight-Topo-IIa(Thr1342) peptide as substrate after 10 mins by TR-FRET assay	ic50	0.0090	uM
N-[(4,5-difluoro-1H-benzimidazol-2-yl)methyl]-9-(2,5-difluorophenyl)-2-morpholin-4-ylpurin-6-amine	1373027: Inhibition of recombinant human full length N-terminal GST-tagged CK1delta expressed in baculovirus in Sf9 insect cells using ULight-Topo-IIa(Thr1342) peptide as substrate after 10 mins by TR-FRET assay	ic50	0.0100	uM
2-(2-methoxyphenyl)-N-[6-(trifluoromethyl)-1,3-benzothiazol-2-yl]acetamide	1129148: Inhibition of human recombinant CK-1delta using casein as substrate after 60 mins by Kinase-Glo assay	ic50	0.0100	uM
4-[2-(5-fluoro-2-pyridinyl)-6,6-dimethyl-5,7-dihydro-4H-pyrazolo[1,5-a]pyridin-3-yl]-1H-pyrazolo[3,4-b]pyridine	1985766: Displacement of kinase tracer 8 from NanoLuc-tagged CK1 delta (unknown origin) transfected in CHO cells by BRET assay	ic50	0.0110	uM
2-(5-fluoro-2-pyridinyl)-6,6-dimethyl-3-(1H-pyrrolo[2,3-b]pyridin-4-yl)-4,7-dihydropyrazolo[5,1-c][1,4]oxazine	1985766: Displacement of kinase tracer 8 from NanoLuc-tagged CK1 delta (unknown origin) transfected in CHO cells by BRET assay	ic50	0.0110	uM
1-[4-[3-(4-fluorophenyl)-1-methylpyrazol-4-yl]-2-pyridinyl]-N-methylmethanamine	767016: Inhibition of CK1 delta (unknown origin) using PLSRTLpSVASLPGL as substrate after 60 mins by microplate reader analysis	ic50	0.0129	uM
4-[3-(4-fluorophenyl)-1-methylpyrazol-4-yl]-6-methyl-7H-pyrrolo[3,4-b]pyridin-5-one	1539770: Inhibition of human CK1delta in presence of [gamma33P]-ATP	ic50	0.0130	uM
[4-[3-(4-fluorophenyl)-1-methylpyrazol-4-yl]-2-pyridinyl]methanol	767016: Inhibition of CK1 delta (unknown origin) using PLSRTLpSVASLPGL as substrate after 60 mins by microplate reader analysis	ic50	0.0142	uM
Sunitinib	435524: Binding constant for full-length CSNK1D	kd	0.0150	uM
2-[2-[(E)-2-(4-fluorophenyl)ethenyl]-5-methoxypyrimidin-4-yl]-1,5,6,7-tetrahydropyrrolo[3,2-c]pyridin-4-one	712792: Inhibition of CK1-delta using biotin[long chain]-KKRRRAL{pS}VATLPGL substrate in presence of 11 uM ATP	ic50	0.0150	uM
N-[6-(trifluoromethyl)-1,3-benzothiazol-2-yl]-2-(3,4,5-trimethoxyphenyl)acetamide	1129148: Inhibition of human recombinant CK-1delta using casein as substrate after 60 mins by Kinase-Glo assay	ic50	0.0150	uM
4-[2-[6-[(4,5-difluoro-1H-benzimidazol-2-yl)methylamino]-2-morpholin-4-ylpurin-9-yl]ethyl]phenol	1989849: Inhibition of CK1delta (unknown origin) using Light-TopoIla(Thr1342) peptide as substrate incubated for 10 mins in presence of ATP by TR-FRET assay	ic50	0.0180	uM
2-[2-[(4-fluorophenoxy)methyl]-5-methoxy-4-pyridinyl]-1,5,6,7-tetrahydropyrrolo[3,2-c]pyridin-4-one	712792: Inhibition of CK1-delta using biotin[long chain]-KKRRRAL{pS}VATLPGL substrate in presence of 11 uM ATP	ic50	0.0210	uM
2-[[2-(trifluoromethoxy)benzoyl]amino]-N-[6-(trifluoromethyl)-1H-benzimidazol-2-yl]-1,3-thiazole-4-carboxamide	1375078: Inhibition of human CK1delta transcription variant 1 using GST-tagged mouse p53 (1 to 64 residues) as substrate in presence of radiolabelled-ATP by Cherenkov counting method	ic50	0.0220	uM
2-(2-anilino-5-methoxypyrimidin-4-yl)-1,5,6,7-tetrahydropyrrolo[3,2-c]pyridin-4-one	712792: Inhibition of CK1-delta using biotin[long chain]-KKRRRAL{pS}VATLPGL substrate in presence of 11 uM ATP	ic50	0.0220	uM
2-[2-(benzylamino)-5-methoxypyrimidin-4-yl]-1,5,6,7-tetrahydropyrrolo[3,2-c]pyridin-4-one	712792: Inhibition of CK1-delta using biotin[long chain]-KKRRRAL{pS}VATLPGL substrate in presence of 11 uM ATP	ic50	0.0220	uM
2-(3-chlorophenyl)-N-[6-(trifluoromethyl)-1,3-benzothiazol-2-yl]acetamide	1129148: Inhibition of human recombinant CK-1delta using casein as substrate after 60 mins by Kinase-Glo assay	ic50	0.0230	uM
4-[4-(4-fluorophenyl)-5-(2-methoxypyrimidin-4-yl)imidazol-1-yl]cyclohexan-1-ol	1899315: Binding affinity to CK1delta (unknown origin)	ki	0.0250	uM
4-[3-(5-fluoro-2-pyridinyl)-1-methylpyrazol-4-yl]-1H-pyrrolo[2,3-b]pyridin-6-amine	1985766: Displacement of kinase tracer 8 from NanoLuc-tagged CK1 delta (unknown origin) transfected in CHO cells by BRET assay	ic50	0.0320	uM
3-[(3-chlorophenoxy)methyl]-1-(oxan-4-yl)pyrazolo[3,4-d]pyrimidin-4-amine	1337183: Inhibition of human full length CK1delta1 (2 to 415 residues) using PLSRTLpSVASLPGL as substrate after 2 hrs by kinase-glo assay	ic50	0.0320	uM
(E)-3-(2,4-dimethoxyphenyl)-N-[4-[3-(4-fluorophenyl)-5-propan-2-yl-1,2-oxazol-4-yl]-2-pyridinyl]prop-2-enamide	448712: Inhibition of recombinant CK1delta kinase domain by Cherenkov counting	ic50	0.0330	uM
2-(4-methoxyphenyl)-N-[6-(trifluoromethyl)-1,3-benzothiazol-2-yl]acetamide	1129148: Inhibition of human recombinant CK-1delta using casein as substrate after 60 mins by Kinase-Glo assay	ic50	0.0330	uM
(4Z)-4-(2-amino-5-oxo-1H-imidazol-4-ylidene)-2-bromo-1,5,6,7-tetrahydropyrrolo[2,3-c]azepin-8-one	1924344: Inhibition of CK1 (unknown origin)	ic50	0.0350	uM
2-[2-[(2,4-difluorophenoxy)methyl]-5-methoxy-4-pyridinyl]-1,5,6,7-tetrahydropyrrolo[3,2-c]pyridin-4-one	712792: Inhibition of CK1-delta using biotin[long chain]-KKRRRAL{pS}VATLPGL substrate in presence of 11 uM ATP	ic50	0.0360	uM
4-[4-(4-fluorophenyl)-2-(4-methylsulfinylphenyl)-1H-imidazol-5-yl]pyridine	435524: Binding constant for full-length CSNK1D	kd	0.0370	uM
9-(3-fluorophenyl)-N-[(6-methyl-2-pyridinyl)methyl]-2-morpholin-4-ylpurin-6-amine	1373027: Inhibition of recombinant human full length N-terminal GST-tagged CK1delta expressed in baculovirus in Sf9 insect cells using ULight-Topo-IIa(Thr1342) peptide as substrate after 10 mins by TR-FRET assay	ic50	0.0370	uM
4-[4-(4-fluorophenyl)-2-(4-methylsulfonylphenyl)-1H-imidazol-5-yl]pyridine	1899315: Binding affinity to CK1delta (unknown origin)	ki	0.0390	uM
3-phenyl-4-pyridin-4-yl-6-(4-pyrimidin-2-ylpiperazin-1-yl)pyridazine	1645936: Inhibition of human CK1delta	ki	0.0400	uM
2-[2-[(3,4-difluorophenoxy)methyl]-5-methoxy-4-pyridinyl]-1,5,6,7-tetrahydropyrrolo[3,2-c]pyridin-4-one	712792: Inhibition of CK1-delta using biotin[long chain]-KKRRRAL{pS}VATLPGL substrate in presence of 11 uM ATP	ic50	0.0400	uM
1-tert-butyl-3-(4-chlorophenyl)pyrazolo[3,4-d]pyrimidin-4-amine	435450: Inhibition of CK1delta in the presence of 20uM ATP	ic50	0.0410	uM
N-(1,3-benzoxazol-2-ylmethyl)-9-(3-fluorophenyl)-2-morpholin-4-ylpurin-6-amine	1373027: Inhibition of recombinant human full length N-terminal GST-tagged CK1delta expressed in baculovirus in Sf9 insect cells using ULight-Topo-IIa(Thr1342) peptide as substrate after 10 mins by TR-FRET assay	ic50	0.0420	uM
N-(5-chloro-6-fluoro-1H-benzimidazol-2-yl)-2-[[2-(trifluoromethoxy)benzoyl]amino]-1,3-oxazole-4-carboxamide	1989847: Inhibition of CK1delta (unknown origin)	ic50	0.0420	uM
2-(3-methoxyphenyl)-N-[6-(trifluoromethyl)-1,3-benzothiazol-2-yl]acetamide	1129148: Inhibition of human recombinant CK-1delta using casein as substrate after 60 mins by Kinase-Glo assay	ic50	0.0420	uM
N-[(4,5-difluoro-1H-benzimidazol-2-yl)methyl]-9-(3-fluorophenyl)-2-morpholin-4-ylpurin-6-amine	1373027: Inhibition of recombinant human full length N-terminal GST-tagged CK1delta expressed in baculovirus in Sf9 insect cells using ULight-Topo-IIa(Thr1342) peptide as substrate after 10 mins by TR-FRET assay	ic50	0.0440	uM
5-(2-aminoethylsulfanyl)-3-propan-2-yl-N-[(4-pyridin-2-ylphenyl)methyl]-2H-pyrazolo[4,3-d]pyrimidin-7-amine	1587609: Inhibition of CK1delta (unknown origin)	ic50	0.0450	uM
4-[2-(4-fluorophenyl)-6,7-dihydro-4H-pyrazolo[5,1-c][1,4]oxazin-3-yl]-N-(oxan-4-yl)pyrimidin-2-amine	1985766: Displacement of kinase tracer 8 from NanoLuc-tagged CK1 delta (unknown origin) transfected in CHO cells by BRET assay	ic50	0.0450	uM
N-[(4,5-difluoro-1H-benzimidazol-2-yl)methyl]-2-(4-methylpiperazin-1-yl)-9-thiophen-3-ylpurin-6-amine	1373027: Inhibition of recombinant human full length N-terminal GST-tagged CK1delta expressed in baculovirus in Sf9 insect cells using ULight-Topo-IIa(Thr1342) peptide as substrate after 10 mins by TR-FRET assay	ic50	0.0470	uM
2-phenyl-N-[6-(trifluoromethyl)-1,3-benzothiazol-2-yl]acetamide	1129148: Inhibition of human recombinant CK-1delta using casein as substrate after 60 mins by Kinase-Glo assay	ic50	0.0470	uM

CTD chemical–gene interactions

62 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
methylmercuric chloride	increases expression, affects cotreatment	3
bisphenol A	decreases expression, decreases methylation, increases expression, affects cotreatment, increases methylation	3
Acetaminophen	decreases expression, increases expression	2
Arsenic	affects methylation	2
Nickel	increases expression	2
Valproic Acid	affects expression, increases methylation	2
Cyclosporine	increases expression	2
FR900359	affects phosphorylation	1
ammonium 2,3,3,3-tetrafluoro-2-(heptafluoropropoxy)-propanoate	affects cotreatment, affects expression	1
triphenyl phosphate	affects expression	1
pyrogallol 1,3-dimethyl ether	affects cotreatment, affects localization, increases expression	1
trichostatin A	affects expression	1
beta-lapachone	increases expression	1
sodium arsenite	increases expression	1
cobaltous chloride	increases expression	1
nickel chloride	decreases expression	1
perfluorooctanoic acid	affects cotreatment, affects expression	1
coumarin	increases phosphorylation	1
vanadyl sulfate	increases expression	1
evodiamine	increases expression	1
di-n-butylphosphoric acid	affects expression	1
perfluorooctane sulfonic acid	affects expression, affects cotreatment	1
IC 261	increases expression	1
pyrazolanthrone	decreases activity	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	increases expression, affects cotreatment	1
erucylphospho-N,N,N-trimethylpropylammonium	increases expression	1
abrine	increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
perfluorobutanesulfonic acid	affects expression, affects cotreatment	1
PCI 5002	affects cotreatment, increases expression	1

ChEMBL screening assays

627 unique, capped per target: 622 binding, 4 functional, 1 admet

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1051274	Binding	Percent residual CK1 activity in the presence of 10uM inhibitor	Biochemical and three-dimensional-structural study of the specific inhibition of protein kinase CK2 by [5-oxo-5,6-dihydroindolo-(1,2-a)quinazolin-7-yl]acetic acid (IQA). — Biochem J
CHEMBL1963783	Functional	PUBCHEM_BIOASSAY: Navigating the Kinome. (Class of assay: other) Panel member name: CSNK1D	PubChem BioAssay data set
CHEMBL4407582	ADMET	Inhibition of recombinant human full-length GST-tagged CSNK1D expressed in baculovirus expression system at 25 uM using FRET-labeled Ser/Thr 11 peptide as substrate measured after 1 hr by Z’-lyte assay relative to control	Optimization and Mechanistic Characterization of Pyridopyrimidine Inhibitors of Bacterial Biotin Carboxylase. — J Med Chem

Cellosaurus cell lines

7 cell lines: 6 cancer cell line, 1 transformed cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B1PE	Abcam HeLa CSNK1D KO	Cancer cell line	Female
CVCL_D7MX	Ubigene A-549 CSNK1D KO	Cancer cell line	Male
CVCL_D8JE	Ubigene HCT 116 CSNK1D KO	Cancer cell line	Male
CVCL_D9CF	Ubigene HEK293 CSNK1D KO	Transformed cell line	Female
CVCL_E0B4	Ubigene HeLa CSNK1D KO	Cancer cell line	Female
CVCL_SJ81	HAP1 CSNK1D (-) 1	Cancer cell line	Male
CVCL_SJ82	HAP1 CSNK1D (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

3 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT03956745	Not specified	TERMINATED	Biomarkers for Circadian Timing in Healthy Adults
NCT03980340	Not specified	TERMINATED	Breath Biomarkers for Sleep Loss and Circadian Timing
NCT04690504	Not specified	COMPLETED	Validation of Circadian Biomarkers in Patients With Sleep Disorders