CTBP1

Summary

CTBP1 (C-terminal binding protein 1, HGNC:2494) is a protein-coding gene on chromosome 4p16.3, encoding C-terminal-binding protein 1 (Q13363). Corepressor targeting diverse transcription regulators such as GLIS2 or BCL6.

This gene encodes a protein that binds to the C-terminus of adenovirus E1A proteins. This phosphoprotein is a transcriptional repressor and may play a role during cellular proliferation. This protein and the product of a second closely related gene, CTBP2, can dimerize. Both proteins can also interact with a polycomb group protein complex which participates in regulation of gene expression during development. Alternative splicing of transcripts from this gene results in multiple transcript variants.

Source: NCBI Gene 1487 — RefSeq curated summary.

At a glance

• Gene–disease (curated): hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome (Strong, GenCC)
• GWAS associations: 2
• Clinical variants (ClinVar): 360 total — 2 pathogenic, 1 likely-pathogenic
• Phenotypes (HPO): 155
• Transcription factor: yes — 10 downstream targets (CollecTRI)
• MANE Select transcript: NM_001012614

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2494
Approved symbol	CTBP1
Name	C-terminal binding protein 1
Location	4p16.3
Locus type	gene with protein product
Status	Approved
Aliases	BARS
Ensembl gene	ENSG00000159692
Ensembl biotype	protein_coding
OMIM	602618
Entrez	1487

Gene structure

Transcript identifiers

Ensembl transcripts: 67 — 58 protein_coding, 5 protein_coding_CDS_not_defined, 3 retained_intron, 1 nonsense_mediated_decay

ENST00000290921, ENST00000382950, ENST00000382952, ENST00000503594, ENST00000504092, ENST00000504784, ENST00000505826, ENST00000506180, ENST00000510568, ENST00000510739, ENST00000511907, ENST00000513420, ENST00000514210, ENST00000514495, ENST00000514596, ENST00000514669, ENST00000515399, ENST00000515690, ENST00000703138, ENST00000703163, ENST00000703164, ENST00000703165, ENST00000909000, ENST00000909001, ENST00000909002, ENST00000909003, ENST00000909004, ENST00000909005, ENST00000909006, ENST00000909007, ENST00000909008, ENST00000909009, ENST00000909010, ENST00000909011, ENST00000909012, ENST00000909013, ENST00000909014, ENST00000909015, ENST00000909016, ENST00000909017, ENST00000909018, ENST00000909019, ENST00000909020, ENST00000927645, ENST00000927646, ENST00000927647, ENST00000927648, ENST00000927649, ENST00000927650, ENST00000927651, ENST00000927652, ENST00000927653, ENST00000927654, ENST00000927655, ENST00000927656, ENST00000927657, ENST00000941586, ENST00000941587, ENST00000941588, ENST00000941589, ENST00000941590, ENST00000941591, ENST00000941592, ENST00000941593, ENST00000941594, ENST00000941595, ENST00000941596

RefSeq mRNA: 10 — MANE Select: NM_001012614 NM_001012614, NM_001328, NM_001377186, NM_001377187, NM_001377188, NM_001377189, NM_001377190, NM_001377191, NM_001377192, NM_001377193

CCDS: CCDS3348, CCDS43203, CCDS93461

Canonical transcript exons

ENST00000382952 — 10 exons

Exon	Start	End
ENSE00001047187	1214343	1214473
ENSE00001494025	1248916	1249130
ENSE00001533155	1241325	1241519
ENSE00003514483	1212913	1213030
ENSE00003562131	1238183	1238337
ENSE00003636221	1215991	1216205
ENSE00003637905	1228199	1228343
ENSE00003693325	1213478	1213605
ENSE00003788377	1225360	1225566
ENSE00003903707	1211445	1212423

Expression profiles

Bgee: expression breadth ubiquitous, 299 present calls, max score 99.27.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 70.7485 / max 609.8672, expressed in 1826 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
51073	58.1761	1823
51072	6.3534	1684
51071	3.3218	1470
51074	2.4715	1440
51070	0.4257	196

Top tissues by expression

299 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
tendon of biceps brachii	UBERON:0008188	99.27	gold quality
cerebellar hemisphere	UBERON:0002245	98.86	gold quality
right hemisphere of cerebellum	UBERON:0014890	98.86	gold quality
cerebellar cortex	UBERON:0002129	98.83	gold quality
cerebellum	UBERON:0002037	98.76	gold quality
medial globus pallidus	UBERON:0002477	98.74	gold quality
adenohypophysis	UBERON:0002196	98.60	gold quality
pituitary gland	UBERON:0000007	98.58	gold quality
postcentral gyrus	UBERON:0002581	98.51	gold quality
parietal lobe	UBERON:0001872	98.40	gold quality
buccal mucosa cell	CL:0002336	98.23	gold quality
globus pallidus	UBERON:0001875	98.23	gold quality
body of pancreas	UBERON:0001150	98.10	gold quality
CA1 field of hippocampus	UBERON:0003881	98.07	gold quality
stromal cell of endometrium	CL:0002255	98.06	gold quality
cortical plate	UBERON:0005343	98.05	gold quality
prefrontal cortex	UBERON:0000451	98.04	gold quality
right uterine tube	UBERON:0001302	98.03	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	98.01	gold quality
granulocyte	CL:0000094	97.97	gold quality
right frontal lobe	UBERON:0002810	97.96	gold quality
body of uterus	UBERON:0009853	97.96	gold quality
endocervix	UBERON:0000458	97.95	gold quality
spleen	UBERON:0002106	97.90	gold quality
Brodmann (1909) area 9	UBERON:0013540	97.89	gold quality
hypothalamus	UBERON:0001898	97.87	gold quality
frontal cortex	UBERON:0001870	97.86	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	97.86	gold quality
superior frontal gyrus	UBERON:0002661	97.85	gold quality
brain	UBERON:0000955	97.84	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	13.70
E-CURD-6	no	257.39

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

10 targets.

Target	Regulation
AGT	Repression
BRCA1	Repression
BRCA2	Repression
CDH1	Repression
CDKN2A	Repression
CLDN7	Repression
KRT18	Unknown
RETN	Repression
UBE2D3	Repression
VDR	Repression

Upstream regulators (CollecTRI, top): CTBP2, DLX4, NRG1, SFPQ, TFAP2A, TP63

miRNA regulators (miRDB)

39 targeting CTBP1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-10401-5P	99.99	65.79	948
HSA-MIR-485-3P	99.98	70.68	1585
HSA-MIR-539-3P	99.98	70.74	1616
HSA-MIR-7152-3P	99.97	67.47	849
HSA-MIR-552-5P	99.93	68.56	1583
HSA-MIR-4760-3P	99.93	70.50	2385
HSA-MIR-6768-5P	99.92	67.36	1942
HSA-MIR-10527-5P	99.91	72.28	3754
HSA-MIR-548AR-3P	99.85	71.26	3889
HSA-MIR-576-5P	99.84	70.46	2582
HSA-MIR-4799-5P	99.82	70.60	2663
HSA-MIR-944	99.82	70.85	3042
HSA-MIR-548AZ-3P	99.82	70.56	3549
HSA-MIR-548BC	99.82	70.61	3524
HSA-MIR-548E-3P	99.82	70.59	3514
HSA-MIR-548F-3P	99.82	70.59	3540
HSA-MIR-548A-3P	99.76	70.58	3524
HSA-MIR-3617-5P	99.75	69.41	1968
HSA-MIR-641	99.75	69.35	1975
HSA-MIR-4719	99.73	72.10	3329
HSA-MIR-1200	99.71	70.42	1838
HSA-MIR-4672	99.50	71.58	2893
HSA-MIR-548G-3P	99.48	68.67	2159
HSA-MIR-3911	99.38	66.95	1087
HSA-MIR-6505-3P	99.34	67.39	1071
HSA-MIR-1206	99.30	69.32	1016
HSA-MIR-4263	99.18	69.25	2236
HSA-MIR-4324	99.04	70.14	1569

Literature-anchored findings (GeneRIF, showing 40)

• CtBP proteins repress transcription in a histone deacetylase dependent or independent manner. (PMID:11864595)
• Interaction with CtBP was shown to be important in the repression of transcription by EBNA3A and in the ability of EBNA3A to immortalize and transform primary cells (PMID:12372828)
• biochemical and crystallographic studies reveal that CtBP, a transcription corepressor, is a functional NAD(+)-regulated dehydrogenase. (PMID:12419229)
• CtBP co-repressor complex mediates coordinated histone modifications (PMID:12700765)
• The corepressor C-terminal-binding protein binds the MLL repression domain. (PMID:12829790)
• Smad6 repressed bone morphogenetic protein-induced Id1 transcription through recruiting transcriptional corepressor C-terminal binding protein (CtBP). (PMID:14645520)
• the interaction of Pnn with the corepressor CtBP1 may modulate repression of E-cadherin transcription by CtBP1 (PMID:15542832)
• AML1-FOG2 and FOG2-AML1 are expressed in myelodysplastic syndrome; results suggest a central role for CtBP in AML1-FOG2 transcriptional repression and implicate coordinated disruption of AML1 and GATA developmental programs in the disease pathogenesis (PMID:15705784)
• Homeodomain-interacting protein kinase-2 (HIPK2) mediates CtBP phosphorylation and degradation in UV-triggered apoptosis. (PMID:15708980)
• results lead to conclusion that, in colon epithelial cells, the expression level of the K18 gene is kept in check by a repression mechanism involving CtBP1, HDAC & BRCA1; mechanism is altered in SW613-S colon carcinoma cells that overexpress the K18 gene (PMID:15831101)
• novel mechanism whereby CtBP1 serves as an energy-sensing repressor of histone acetyltransferase(s) and thus affects general transcription (PMID:15834423)
• CtBP is a potential repressor of hTERT and hTERC (PMID:16036112)
• Based on these results, we propose that CtBP1 mediates repression by blocking histone acetylation by HAT complexes. (PMID:16122695)
• a corepressor complex containing CtIP/CtBP facilitates RBP-Jkappa/SHARP-mediated repression of Notch target genes (PMID:16287852)
• Plays a critical role in the fission step of coat protein I vesicle formation from Golgi membrane. (PMID:16292346)
• In mitotic cells a species of CtBP becomes associated with the centrosomes at the onset of prophase and then throughout mitosis. (PMID:16481748)
• Plays a role in regulating TCF-4 mediated transcription upon its binding with TCF-4 isoforms encoded by alternatively spliced mRNA. (PMID:16547505)
• Data show that hypoxia increases free NADH levels in cancer cells, promoting CtBP recruitment to the E-cadherin promoter. (PMID:16740659)
• HIC1 interaction with the corepressor CtBP depends on a central leucine residue (PMID:16762039)
• Levels of expression of CtBP and p300 are critical for the action of SNAIL and ZEB1, which have a pivotal role in levels of epithelial-mesenchymsal transitionin human colon carcinoma. (PMID:16804902)
• attenuation of BMP signaling by hypoxia is conveyed through a repression of the transcriptional activity of the BMP responsive element (BRE) through mechanisms involving the transcriptional corepressorCtBP-1 and histone deacetylases (PMID:16840720)
• role for APC in regulating degradation of the transcriptional co-repressor C-terminal-binding protein-1 (CtBP1) through a proteasome-dependent process (PMID:17028196)
• 2-keto-4-methylthiobutyrate may be an important regulator of CtBP activity, possibly linking gene repression to the activity of the methionine salvage and spermine synthesis pathways (PMID:17157814)
• The Golgi mitotic checkpoint is controlled by BARS-dependent fission of the Golgi ribbon into separate stacks in G2. (PMID:17431394)
• Mono-ADP-ribosylation of CtBP1/BARS inactivates its repressor function, which leads to the activation of genes that regulate neutral lipid storage. (PMID:17538025)
• CtBP1 might be one of the key transcription factors involved in the induction of MDR1 gene (PMID:17662696)
• provide evidence that CtBP1 functions as a platform for sumoylation of cofactors (PMID:17967884)
• Corepressor Ctbp and PNN/DRS differentially modulate transcription and splicing of the E-cadherin gene. (PMID:18086895)
• PKA 1) induces metabolic changes in the adrenal cortex and 2) phosphorylates CtBP1 and 2 proteins, particularly CtBP1 at T144, resulting in CtBP protein partnering and ACTH-dependent CYP17 transcription (PMID:18184656)
• BCL6 can interact with CtBP in vitro & in vivo. CtBP is recruited by BCL6 to its 5’ regulatory region. CtBP corepression of BCL6 autoregulation may control the GC stage of B cell development. (PMID:18212045)
• Infectious Ad3 macropinocytosis required viral activation of p21-activated kinase 1 (PAK1) and the C-terminal binding protein 1 of E1A (CtBP1), recruited to macropinosomes. (PMID:18323776)
• These results provide an insight into the molecular mechanisms of CtBP1/BARS activation in membrane fissioning, and extend the relevance of CtBP1/BARS-induced fission to human viral infection. (PMID:18354494)
• Identification of a second CTBP1 binding site in adenovirus type 5 EIA conserved region 3 is reported. (PMID:18524818)
• Different from ERbeta, p53 interacts with HDAC1 and CtBP1 and forms an inhibiting transcriptional complex that could compete for binding to Sp1 sites with ERalpha transcriptional complex and inhibit BRCA2 transcription more significantly (PMID:18765668)
• role of SATB1-CtBP1 interaction in the repression and derepression of SATB1 target genes during Wnt signaling in T cells (PMID:19103759)
• CtBP represses Bcl-2-associated X protein (Bax) transcription in glucose-rich media by binding to the E-box region of the Bax promoter (PMID:19136938)
• HDGF functions as a transcriptional repressor of the SMYD1 gene through interaction with the transcriptional corepressor CtBP. (PMID:19162039)
• Estrogen increases transcription in a rapid but transient manner at early estrogen-repressed genes but that this is followed by recruitment of the corepressor CtBP1, a p300-interacting partner that plays an essential role in the repressive process. (PMID:19188451)
• Reduction of CtBP1 expression is correlated with migratory, invasive potential of melanoma cells. (PMID:19216735)
• These findings suggest that, following APC loss, CtBP1 contributes to adenoma initiation as a first step, whereas KRAS activation and beta-catenin nuclear localization promote adenoma progression to carcinomas as a second step. (PMID:19450512)

Cross-species orthologs

9 orthologs

Organism	Symbol	Gene ID
danio_rerio	CTBP1	ENSDARG00000019213
danio_rerio	ctbp1	ENSDARG00000057007
mus_musculus	Ctbp1	ENSMUSG00000037373
rattus_norvegicus	Ctbp1	ENSRNOG00000005428
drosophila_melanogaster	CtBP	FBGN0020496
drosophila_melanogaster	CG9331	FBGN0032889
drosophila_melanogaster	CG31673	FBGN0051673
drosophila_melanogaster	CG31674	FBGN0051674
caenorhabditis_elegans		WBGENE00006424

Paralogs (3): PHGDH (ENSG00000092621), GRHPR (ENSG00000137106), CTBP2 (ENSG00000175029)

Protein

Protein identifiers

C-terminal-binding protein 1 — Q13363 (reviewed: Q13363)

All UniProt accessions (10): Q13363, D6RAX2, E7ESU7, E7EUB3, E9PGB1, H0Y8U5, H0Y8W7, H0Y913, H0Y9M9, X5D8Y5

UniProt curated annotations — full annotation on UniProt →

Function. Corepressor targeting diverse transcription regulators such as GLIS2 or BCL6. Has dehydrogenase activity. Involved in controlling the equilibrium between tubular and stacked structures in the Golgi complex. Functions in brown adipose tissue (BAT) differentiation.

Subunit / interactions. Homo- or heterodimer. Heterodimer with CTBP2. Interacts with PRDM16; the interaction represses white adipose tissue (WAT)-specific genes expression. Interacts with GLIS2, FOXP2, HDAC4, HDAC5, HDAC9 and ZNF217. Interacts with ELK3 (via its PXDLS motif). Interacts with RBBP8 (via its PXDLS motif); the interaction is disrupted by binding to adenovirus E1A. Interacts with FOXP1, HIPK2, PNN, NRIP1, MECOM, ZFHX1B and WIZ. Interacts with ZNF366 (via PXDLS motif). Interaction with SATB1 (non-acetylated form); the interaction stabilizes its attachment to DNA and promotes transcription repression. Interacts with BCL6; the interaction is required for BCL6 transcriptional autoinhibition and inhibition of some BCL6 target genes. Interacts with IKZF4. Interacts with MCRIP1 (unphosphorylated form, via the PXDLS motif); competitively inhibiting CTBP-ZEB1 interaction. Interacts with Bassoon/BSN; this interaction targets and anchors CTBP1 to presynapses. Interacts with SIMC1. (Microbial infection) Interacts with Epstein-Barr virus EBNA3. Interacts with Epstein-Barr virus EBNA6; this interaction leads to gene repression, but also seems to interfere with the repressive function of CtBP pre-bound to DNA, leading to EBNA6 mediated up-regulation of many cellular genes. (Microbial infection) Interacts with adenovirus E1A protein (via its C-terminus); the interaction disrupts the interaction of CTBP1 with RBBP8. (Microbial infection) Interacts with human adenovirus 5 E1A protein; this interaction seems to potentiate viral replication.

Subcellular location. Cytoplasm. Nucleus.

Tissue specificity. Expressed in germinal center B-cells.

Post-translational modifications. The level of phosphorylation appears to be regulated during the cell cycle. Phosphorylation by HIPK2 on Ser-422 induces proteasomal degradation. ADP-ribosylated; when cells are exposed to brefeldin A. Sumoylation on Lys-428 is promoted by the E3 SUMO-protein ligase CBX4.

Disease relevance. Hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome (HADDTS) [MIM:617915] An autosomal dominant disorder characterized by delayed motor development, intellectual disability, failure to thrive, hypotonia, ataxia, and tooth enamel defects. The disease is caused by variants affecting the gene represented in this entry.

Cofactor. NAD is required for efficient interaction with E1A. Cofactor binding induces a conformation change.

Similarity. Belongs to the D-isomer specific 2-hydroxyacid dehydrogenase family.

Isoforms (2)

UniProt ID	Names	Canonical?
Q13363-1	1	yes
Q13363-2	2

RefSeq proteins (10): NP_001012632, NP_001319, NP_001364115, NP_001364116, NP_001364117, NP_001364118, NP_001364119, NP_001364120, NP_001364121, NP_001364122 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR006139	D-isomer_2_OHA_DH_cat_dom	Domain
IPR006140	D-isomer_DH_NAD-bd	Domain
IPR029752	D-isomer_DH_CS1	Conserved_site
IPR029753	D-isomer_DH_CS	Conserved_site
IPR036291	NAD(P)-bd_dom_sf	Homologous_superfamily
IPR043322	CtBP	Family
IPR051638	CTBP_dehydrogenase	Family

Pfam: PF00389, PF02826

UniProt features (81 total): mutagenesis site 20, strand 15, helix 15, turn 8, binding site 7, region of interest 3, site 3, active site 3, modified residue 2, chain 1, cross-link 1, splice variant 1, sequence variant 1, compositionally biased region 1

Structure

Experimental structures (PDB)

11 structures.

PDB	Method	Resolution (Å)
1MX3	X-RAY DIFFRACTION	1.95
4U6S	X-RAY DIFFRACTION	2.1
9WRJ	X-RAY DIFFRACTION	2.2
4U6Q	X-RAY DIFFRACTION	2.3
7KWM	X-RAY DIFFRACTION	2.3
6V8A	X-RAY DIFFRACTION	2.35
4LCE	X-RAY DIFFRACTION	2.38
6CDR	X-RAY DIFFRACTION	2.4
6V89	X-RAY DIFFRACTION	2.45
6CDF	X-RAY DIFFRACTION	2.6
8ARI	ELECTRON MICROSCOPY	3

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q13363-F1	84.08	0.75

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (6): 375–376 (cleavage; by capn1); 387–388 (cleavage; by capn1); 409–410 (cleavage; by capn1 and capn3); 266; 295; 315 (proton donor)

Ligand- & substrate-binding residues (7): 204; 237–243; 264–266; 290; 315–318; 100; 180–185

Post-translational modifications (3): 300, 422, 428

Mutagenesis-validated functional residues (20):

Position	Phenotype
52	loss of interaction with simc1. no effect on its proteolytic processing mediated by capn3.
66	loss of interaction with simc1. reduced proteolytic processing mediated by capn3.
134	strongly reduces e1a binding; when associated with a-138; a-141 and a-150.
138	strongly reduces e1a binding; when associated with a-134; a-141 and a-150.
141–142	strongly reduces e1a binding; when associated with a-163 and a-171.
141	strongly reduces e1a binding; when associated with a-134; a-138 and a-150.
150	strongly reduces e1a binding; when associated with a-134; a-138 and a-141.
163	strongly reduces e1a binding; when associated with a-141; a-142 and a-171.
171	strongly reduces e1a binding; when associated with a-141; a-142 and a-163.
181	strongly reduces e1a binding; when associated with v-183 and a-204.
183	reduced proteolytic processing mediated by capn3; when associated with a-186.
183	strongly reduces e1a binding; when associated with v-181 and a-204.
186	reduced proteolytic processing mediated by capn3; when associated with a-183.
204	strongly reduces e1a binding; when associated with v-181 and v-183.
204	reduced proteolytic processing mediated by capn3.
266	strongly reduces e1a binding; when associated with a-290; a-295 and a-315.
290	strongly reduces e1a binding; when associated with a-266; a-295 and a-315.
295	strongly reduces e1a binding; when associated with a-266; a-290 and a-315.
315	strongly reduces e1a binding; when associated with a-266; a-290 and a-295.
422	abolishes phosphorylation by hipk2 and prevents uv-induced clearance.

Function

Pathways and Gene Ontology

Reactome pathways

5 pathways

ID	Pathway
R-HSA-3769402	Deactivation of the beta-catenin transactivating complex
R-HSA-3899300	SUMOylation of transcription cofactors
R-HSA-4641265	Repression of WNT target genes
R-HSA-5339700	Signaling by TCF7L2 mutants
R-HSA-9764725	Negative Regulation of CDH1 Gene Transcription

MSigDB gene sets: 574 (showing top): GOBP_SYNAPTIC_VESICLE_LOCALIZATION, MORF_MBD4, GOBP_VESICLE_LOCALIZATION, PAL_PRMT5_TARGETS_UP, MORF_SNRP70, MORF_UBE2I, MORF_HDAC1, GOBP_WHITE_FAT_CELL_DIFFERENTIATION, GOBP_VESICLE_MEDIATED_TRANSPORT, GOBP_SYNAPTIC_VESICLE_RECYCLING, PUJANA_CHEK2_PCC_NETWORK, REACTOME_ADHERENS_JUNCTIONS_INTERACTIONS, KEGG_PATHWAYS_IN_CANCER, BLALOCK_ALZHEIMERS_DISEASE_UP, MORF_CTBP1

GO Biological Process (13): negative regulation of transcription by RNA polymerase II (GO:0000122), regulation of transcription by RNA polymerase II (GO:0006357), protein phosphorylation (GO:0006468), Notch signaling pathway (GO:0007219), negative regulation of cell population proliferation (GO:0008285), viral genome replication (GO:0019079), negative regulation of DNA-templated transcription (GO:0045892), synaptic vesicle endocytosis (GO:0048488), white fat cell differentiation (GO:0050872), regulation of cell cycle (GO:0051726), synaptic vesicle clustering (GO:0097091), cell differentiation (GO:0030154), positive regulation of DNA-templated transcription (GO:0045893)

GO Molecular Function (14): transcription coregulator binding (GO:0001221), transcription corepressor binding (GO:0001222), chromatin binding (GO:0003682), transcription coactivator activity (GO:0003713), transcription corepressor activity (GO:0003714), oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616), protein domain specific binding (GO:0019904), identical protein binding (GO:0042802), NAD binding (GO:0051287), RNA polymerase II-specific DNA-binding transcription factor binding (GO:0061629), lncRNA binding (GO:0106222), DNA-binding transcription factor binding (GO:0140297), protein binding (GO:0005515), oxidoreductase activity (GO:0016491)

GO Cellular Component (7): nucleus (GO:0005634), nucleoplasm (GO:0005654), transcription repressor complex (GO:0017053), presynaptic active zone cytoplasmic component (GO:0098831), glutamatergic synapse (GO:0098978), GABA-ergic synapse (GO:0098982), cytoplasm (GO:0005737)

Reactome top-level categories

Rollup of top-5 pathways:

Category	Pathways
TCF dependent signaling in response to WNT	1
SUMO E3 ligases SUMOylate target proteins	1
Degradation of beta-catenin by the destruction complex	1
Signaling by WNT in cancer	1
Regulation of CDH1 Gene Transcription	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
regulation of DNA-templated transcription	3
transcription by RNA polymerase II	2
negative regulation of DNA-templated transcription	2
DNA-templated transcription	2
transcription factor binding	2
binding	2
transcription coregulator activity	2
protein binding	2
cellular anatomical structure	2
synapse	2
regulation of transcription by RNA polymerase II	1
phosphorylation	1
protein modification process	1
cell surface receptor signaling pathway	1
cell population proliferation	1
regulation of cell population proliferation	1
negative regulation of cellular process	1
viral process	1
viral life cycle	1
negative regulation of RNA biosynthetic process	1
synaptic vesicle recycling	1
presynaptic endocytosis	1
fat cell differentiation	1
cell cycle	1
regulation of cellular process	1
synaptic vesicle localization	1
synaptic vesicle cycle	1
cellular developmental process	1
positive regulation of RNA biosynthetic process	1
transcription coregulator binding	1
positive regulation of DNA-templated transcription	1
oxidoreductase activity, acting on CH-OH group of donors	1
adenyl nucleotide binding	1
DNA-binding transcription factor binding	1
RNA binding	1
catalytic activity	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
transcription regulator complex	1
presynaptic active zone	1

Protein interactions and networks

STRING

4058 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CTBP1	RCOR1	Q9UKL0	996
CTBP1	HDAC1	Q13547	995
CTBP1	RBBP8	Q99708	994
CTBP1	KDM1A	O60341	993
CTBP1	ZEB1	P37275	992
CTBP1	HDAC2	Q92769	990
CTBP1	KLF3	P57682	988
CTBP1	ZNF217	O75362	983
CTBP1	CTBP2	P56545	974
CTBP1	HIC1	Q14526	960
CTBP1	KLF8	O95600	950
CTBP1	HNF4A	P41235	936
CTBP1	PRDM16	Q9HAZ2	928
CTBP1	PHF21A	Q96BD5	916
CTBP1	LCOR	Q96JN0	888

IntAct

309 interactions, top by confidence:

A	B	Type	Score
CTBP2	CTBP1	psi-mi:“MI:0915”(physical association)	0.920
CTBP1	LCOR	psi-mi:“MI:0915”(physical association)	0.890
ZNF516	CTBP1	psi-mi:“MI:0915”(physical association)	0.880
LCOR	CTBP2	psi-mi:“MI:0914”(association)	0.880
S100B	S100A4	psi-mi:“MI:0914”(association)	0.870
CTBP1	ZEB2	psi-mi:“MI:0914”(association)	0.800
CTBP1	KDM1A	psi-mi:“MI:0914”(association)	0.790
ZBTB18	CTBP2	psi-mi:“MI:0914”(association)	0.790
CTBP1	CTBP1	psi-mi:“MI:0915”(physical association)	0.750
CTBP1	ZBTB18	psi-mi:“MI:0915”(physical association)	0.740
ZBTB18	CTBP1	psi-mi:“MI:0915”(physical association)	0.740
HDAC1	ZNF609	psi-mi:“MI:0914”(association)	0.730
THAP11	CTBP1	psi-mi:“MI:0915”(physical association)	0.720
CTBP1	THAP11	psi-mi:“MI:0915”(physical association)	0.720
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
CBX4	CTBP1	psi-mi:“MI:0915”(physical association)	0.700

BioGRID (811): CTBP1 (Two-hybrid), CTBP1 (Two-hybrid), CTBP2 (Two-hybrid), HOXB5 (Two-hybrid), PRKAA1 (Two-hybrid), MAPK9 (Two-hybrid), TGIF1 (Two-hybrid), NOL4 (Two-hybrid), IKZF1 (Two-hybrid), KLF12 (Two-hybrid), CEP68 (Two-hybrid), PLCB1 (Two-hybrid), BCAS3 (Two-hybrid), TSHZ3 (Two-hybrid), DMRTB1 (Two-hybrid)

ESM2 similar proteins: A0A0M3R8G1, A0A0M4FLW6, A2X208, A2Y8U6, A9YWR6, B8ALI0, B8AT51, B8BDK8, B9FMX4, D3GE74, G2WS43, O35099, O65718, O80946, O88712, P24846, P24847, Q0DWQ1, Q0JAW2, Q13363, Q29397, Q2V4F9, Q43847, Q4R4X3, Q5R4L9, Q5VQ09, Q5ZBH5, Q658H5, Q6H7M7, Q6ZHE5, Q7L0J3, Q8H8V7, Q8RXR2, Q8VYP9, Q8W4D4, Q9FNB5, Q9FZ06, Q9LFG8, Q9LPC6, Q9M2V5

Diamond homologs: A0A348AXY0, A1RYE4, A4TGN1, A5A6P1, A5GFY8, A6TFG7, A7FPA2, A9R4G6, B1JH01, B1L765, B2K7F1, B2VCD1, B5XMZ4, B6YWH0, C0CMQ8, C5A1V0, D2RJU7, G9EZR6, J7SHB8, O04130, O08651, O27051, O29445, O33116, O43175, O46036, O49485, O58320, O83080, O88712, O94574, P0A545, P17584, P26297, P26298, P30799, P30901, P35136, P43885, P44501

SIGNOR signaling

20 interactions.

A	Effect	B	Mechanism
PAK1	“down-regulates activity”	CTBP1	phosphorylation
HIPK2	down-regulates	CTBP1	phosphorylation
CTBP1	up-regulates	BHLHE41	binding
MAPK8	down-regulates	CTBP1	phosphorylation
PRKAA1	down-regulates	CTBP1	phosphorylation
AMPK	down-regulates	CTBP1	phosphorylation
CTBP1	“up-regulates activity”	ZEB2	binding
SNAI1	“up-regulates activity”	CTBP1
CTBP1	“down-regulates quantity by repression”	CLDN7	“transcriptional regulation”
CTBP1	“down-regulates quantity by repression”	UBE2D3	“transcriptional regulation”
CTBP1	“down-regulates quantity by repression”	VDR	“transcriptional regulation”
BCORL1	“up-regulates activity”	CTBP1	binding
CTBP1	“down-regulates quantity by repression”	BRCA1	“transcriptional regulation”
CTBP1	“down-regulates quantity by repression”	CDKN2A	“transcriptional regulation”
CTBP1	“down-regulates quantity by repression”	CDH1	“transcriptional regulation”
TBL1Y	“down-regulates quantity by destabilization”	CTBP1	binding
MCRIP1	“down-regulates activity”	CTBP1	binding
ZEB2	“up-regulates activity”	CTBP1	binding
AKT1	“down-regulates quantity”	CTBP1	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 167 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
RUNX1 interacts with co-factors whose precise effect on RUNX1 targets is not known	6	16.2×	9e-04
Assembly and cell surface presentation of NMDA receptors	5	11.4×	6e-03
Neurexins and neuroligins	6	10.6×	3e-03
Negative Regulation of CDH1 Gene Transcription	8	8.7×	9e-04
Regulation of TP53 Activity through Phosphorylation	7	7.4×	4e-03
Estrogen-dependent gene expression	8	5.5×	7e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

360 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	1
Uncertain significance	142
Likely benign	170
Benign	13

Top pathogenic / likely-pathogenic (3)

Variant ID	HGVS	Classification
1459277	NC_000004.11:g.(?493125)(2065854_?)del	Pathogenic
225758	NM_001012614.2(CTBP1):c.991C>T (p.Arg331Trp)	Pathogenic
981895	NM_001012614.2(CTBP1):c.125_127del (p.Phe42del)	Likely pathogenic

SpliceAI

2690 predictions. Top by Δscore:

Variant	Effect	Δscore
4:1212907:GCTCA:G	donor_loss	1.0000
4:1212908:CTCAC:C	donor_loss	1.0000
4:1212909:TCAC:T	donor_loss	1.0000
4:1212910:CACCT:C	donor_loss	1.0000
4:1212911:A:C	donor_loss	1.0000
4:1213031:C:CC	acceptor_gain	1.0000
4:1213038:A:C	acceptor_gain	1.0000
4:1213041:C:CT	acceptor_gain	1.0000
4:1213473:CCCA:C	donor_loss	1.0000
4:1213474:CCAC:C	donor_loss	1.0000
4:1213475:CACC:C	donor_loss	1.0000
4:1213477:C:CG	donor_loss	1.0000
4:1213604:AG:A	acceptor_gain	1.0000
4:1213606:C:CC	acceptor_gain	1.0000
4:1214472:ATCTA:A	acceptor_loss	1.0000
4:1214473:TC:T	acceptor_loss	1.0000
4:1214474:CTAGA:C	acceptor_loss	1.0000
4:1215987:GCAC:G	donor_loss	1.0000
4:1215990:CCTG:C	donor_gain	1.0000
4:1225563:ATGCC:A	acceptor_loss	1.0000
4:1225564:TGC:T	acceptor_gain	1.0000
4:1225564:TGCCT:T	acceptor_loss	1.0000
4:1225565:GCCTG:G	acceptor_loss	1.0000
4:1225567:C:CA	acceptor_loss	1.0000
4:1225567:C:CC	acceptor_gain	1.0000
4:1225568:T:G	acceptor_loss	1.0000
4:1228194:CCTA:C	donor_loss	1.0000
4:1228195:CTACC:C	donor_loss	1.0000
4:1228196:TA:T	donor_loss	1.0000
4:1228197:ACCT:A	donor_loss	1.0000

AlphaMissense

2783 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
4:1212996:G:C	N352K	1.000
4:1212996:G:T	N352K	1.000
4:1213000:A:T	V351D	1.000
4:1213539:G:C	S320R	1.000
4:1213539:G:T	S320R	1.000
4:1213541:T:G	S320R	1.000
4:1214447:G:C	N263K	1.000
4:1214447:G:T	N263K	1.000
4:1216076:A:G	L226P	1.000
4:1216197:C:A	G186W	1.000
4:1225365:C:T	G181E	1.000
4:1225374:C:T	G178D	1.000
4:1225553:G:C	C118W	1.000
4:1225557:A:T	V117D	1.000
4:1228210:G:T	A110D	1.000
4:1228264:A:T	L92H	1.000
4:1228282:A:G	L86P	1.000
4:1228321:G:T	A73D	1.000
4:1228324:C:T	G72E	1.000
4:1228325:C:A	G72W	1.000
4:1228325:C:G	G72R	1.000
4:1228325:C:T	G72R	1.000
4:1228330:G:T	A70D	1.000
4:1228331:C:G	A70P	1.000
4:1238191:G:C	H63D	1.000
4:1238193:A:C	I62S	1.000
4:1238193:A:G	I62T	1.000
4:1238193:A:T	I62N	1.000
4:1238211:G:T	A56E	1.000
4:1238216:G:C	C54W	1.000

dbSNP variants (sampled 300 via entrez): RS1000002227 (4:1229655 T>G), RS1000012449 (4:1245257 T>A), RS1000076552 (4:1219318 C>T), RS1000085722 (4:1245520 G>A,C), RS1000175775 (4:1223976 G>A), RS1000229421 (4:1224129 T>C), RS1000248071 (4:1249984 C>G,T), RS1000365735 (4:1248860 ACCCGCCCCGC>A,ACCCGC,ACCCGCCCCGCCCCGC,ACCCGCCCCGCCCCGCCCCGC), RS1000443883 (4:1222225 C>T), RS1000454929 (4:1214542 G>T), RS1000500109 (4:1242133 G>A), RS1000510397 (4:1220904 C>G), RS1000589665 (4:1230523 G>A), RS1000652196 (4:1238624 G>A,T), RS1000670571 (4:1217683 C>A,T)

Disease associations

OMIM: gene MIM:602618 | disease phenotypes: MIM:194190, MIM:617915

GenCC curated gene-disease

Disease	Classification	Inheritance
hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome	Strong	Autosomal dominant

Mondo (4): Wolf-Hirschhorn syndrome (MONDO:0008684), hypotonia, ataxia, developmental delay, and tooth enamel defect syndrome (MONDO:0060666), microcephaly (MONDO:0001149), intellectual disability (MONDO:0001071)

Orphanet (2): Wolf-Hirschhorn syndrome (Orphanet:280), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

155 total (30 of 155 shown, HPO-id order):

HPO	Term
HP:0000006	Autosomal dominant inheritance
HP:0000028	Cryptorchidism
HP:0000047	Hypospadias
HP:0000077	Abnormality of the kidney
HP:0000078	Abnormality of the genital system
HP:0000079	Abnormality of the urinary system
HP:0000119	Abnormality of the genitourinary system
HP:0000151	Aplasia of the uterus
HP:0000153	Abnormality of the mouth
HP:0000159	Abnormal lip morphology
HP:0000175	Cleft palate
HP:0000188	Short upper lip
HP:0000202	Orofacial cleft
HP:0000204	Cleft upper lip
HP:0000218	High palate
HP:0000238	Hydrocephalus
HP:0000252	Microcephaly
HP:0000268	Dolichocephaly
HP:0000278	Retrognathia
HP:0000286	Epicanthus
HP:0000288	Abnormality of the philtrum
HP:0000316	Hypertelorism
HP:0000322	Short philtrum
HP:0000347	Micrognathia
HP:0000348	High forehead
HP:0000358	Posteriorly rotated ears
HP:0000365	Hearing impairment
HP:0000377	Abnormal pinna morphology
HP:0000384	Preauricular skin tag
HP:0000389	Chronic otitis media

GWAS associations

2 associations (top):

Study	Trait	p-value
GCST008833_15	Type 2 diabetes	8.000000e-12
GCST010118_33	Type 2 diabetes	9.000000e-42

MeSH disease descriptors (3)

Descriptor	Name	Tree numbers
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D008831	Microcephaly	C05.660.207.620; C10.500.507.400.500; C16.131.621.207.620; C16.131.666.507.400.500
D054877	Wolf-Hirschhorn Syndrome	C16.131.077.944; C16.131.260.985; C16.320.180.985

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

PubChem BioAssay actives

9 with measured affinity, of 10 total; 2 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
(2Z)-2-hydroxyimino-3-phenylpropanoic acid	1801145: CtBP2 ITC from Article 10.1021/cb500820b: “Structure-guided design of a high affinity inhibitor to human CtBP.”	kd	0.3700	uM
Nadide	1802396: Equilibrium Dialysis from Article 10.1074/jbc.M113.493569: “Nicotinamide adenine dinucleotide-induced multimerization of the co-repressor CtBP1 relies on a switching tryptophan.”	kd	0.3900	uM

CTD chemical–gene interactions

59 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Cadmium	increases abundance, increases expression, decreases expression	3
Ozone	affects cotreatment, increases oxidation, increases abundance, affects expression	3
Cadmium Chloride	decreases expression, increases abundance, increases expression	3
bisphenol A	decreases expression, increases expression	2
sodium arsenite	increases abundance, increases expression	2
methacrylaldehyde	increases oxidation, increases abundance, affects cotreatment	2
Acrolein	affects cotreatment, increases oxidation, increases abundance	2
Air Pollutants	increases oxidation, affects expression, affects cotreatment, increases abundance	2
Arsenic	increases abundance, increases expression, affects methylation	2
Estradiol	decreases expression, affects cotreatment	2
Valproic Acid	decreases expression	2
TAK-243	decreases sumoylation	1
alpha-pinene	affects cotreatment, increases oxidation, increases abundance	1
trichostatin A	affects expression	1
arsenite	decreases expression	1
mono-(2-ethylhexyl)phthalate	increases methylation, increases abundance	1
11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid	affects methylation, increases abundance	1
cobaltous chloride	decreases expression	1
pyrrolidine dithiocarbamic acid	affects cotreatment, decreases expression, decreases reaction	1
perfluorooctanoic acid	decreases expression	1
4-aminophenylarsenoxide	affects binding, decreases reaction	1
beta-methylcholine	affects expression	1
di-n-butylphosphoric acid	affects expression	1
perfluorooctane sulfonic acid	decreases expression	1
CGP 52608	affects binding, increases reaction	1
perfluoro-n-nonanoic acid	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
perfluorohexanesulfonic acid	decreases expression	1
bisphenol S	decreases methylation	1
LDN 193189	affects cotreatment, increases expression	1

Cellosaurus cell lines

10 cell lines: 10 embryonic stem cell

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A0T5	SEES3-1V human CTBP1, clone1	Embryonic stem cell	Male
CVCL_A0T6	SEES3-1V human CTBP1, clone2	Embryonic stem cell	Male
CVCL_A0T7	SEES3-1V human CTBP1, clone3	Embryonic stem cell	Male
CVCL_C7FL	UKERe008-A-4	Embryonic stem cell	Female
CVCL_C7FM	UKERe008-A-5	Embryonic stem cell	Female
CVCL_C7FN	UKERe008-A-6	Embryonic stem cell	Female
CVCL_C7FP	UKERe008-A-7	Embryonic stem cell	Female
CVCL_C7FQ	UKERe008-A-8	Embryonic stem cell	Female
CVCL_C7FR	UKERe008-A-9	Embryonic stem cell	Female
CVCL_C9GZ	WAe009-A-98	Embryonic stem cell	Female

Clinical trials (associated diseases)

212 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT05273320	PHASE1	COMPLETED	Clinical Trial of Nabilone for Aggression in Adults With Intellectual and Developmental Disabilities
NCT05301361	PHASE1	ENROLLING_BY_INVITATION	Sensitivity of the NIH Toolbox to Stimulant Treatment in Intellectual Disabilities
NCT06016764	PHASE1	COMPLETED	Use of MRI and cTBS for Catatonia in Autism
NCT06586827	PHASE1	COMPLETED	Impact of Competency-Based Training and Technical Assistance Employment Outcomes of Individuals With ID/DD
NCT07531940	PHASE1	NOT_YET_RECRUITING	Escalating Doses of Memantine in Down Syndrome (MEDS-123)
NCT01793168	Not specified	RECRUITING	Rare Disease Patient Registry & Natural History Study - Coordination of Rare Diseases at Sanford
NCT05518188	PHASE1/PHASE2	RECRUITING	Melpida: Recombinant Adeno-associated Virus (serotype 9) Encoding a Codon Optimized Human AP4M1 Transgene (hAP4M1opt)
NCT00001639	Not specified	COMPLETED	Evaluation of Patients With Unresolved Chromosome Abnormalities
NCT01151462	Not specified	WITHDRAWN	Postnatal HCMV Infection in Very Preterm Infants. Implications, Morbidity, Growth and Neurodevelopmental Outcomes.
NCT01565005	Not specified	COMPLETED	Microcephaly Genetic Deficiency in Neural Progenitors
NCT02510170	Not specified	COMPLETED	Fetal and Maternal Head Circumference During Pregnancy in Israeli Population
NCT02741882	Not specified	COMPLETED	Zika and Microcephaly: Case-control Study
NCT02943304	Not specified	COMPLETED	Neurodevelopment Outcome of Newborns Exposed to Zika Virus (ZIKV) in Utero
NCT03255369	Not specified	UNKNOWN	Vertical Exposure to Zika Virus and Its Consequences for Child Neurodevelopment (ZIKVIRUSIFF)
NCT03325946	Not specified	RECRUITING	The FBRI VTC Neuromotor Research Clinic
NCT03330600	Not specified	COMPLETED	Efficacy of Aquatic Physiotherapy in Children With Microcephaly by Zika Virus Congenital Syndrome
NCT03548779	Not specified	COMPLETED	North Carolina Genomic Evaluation by Next-generation Exome Sequencing, 2
NCT03651687	Not specified	COMPLETED	Guangzhou Surveillance and Clinical Study in Microcephaly (GSCSM)
NCT03922594	Not specified	TERMINATED	Surveillance of Zika-related Microcephaly in Sub-Saharan Africa and Asia
NCT04816175	Not specified	COMPLETED	Intensive Therapy for Children With Microcephaly, Hyperkinetic Movements, or Global Developmental Delay
NCT05322980	Not specified	COMPLETED	Summary of Infants Weighing 500 Grams or Less
NCT06019182	Not specified	RECRUITING	MEHMO Natural History and Biomarkers
NCT06566066	Not specified	RECRUITING	Register for Patients With Thyroid Hormone Resistance.
NCT03479476	PHASE2/PHASE3	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome
NCT02616796	PHASE1/PHASE2	COMPLETED	Effects of Social Gaze Training on Brain and Behavior in Fragile X Syndrome
NCT06860672	EARLY_PHASE1	RECRUITING	Clinical Trial of the Dual Vector Base Editor for the Treatment of the CHD3-R1025W Mutation
NCT00597948	Not specified	COMPLETED	Healthy Lifestyles for People With Intellectual Disabilities
NCT01087320	Not specified	RECRUITING	Genome Medical Sequencing for Gene Discovery
NCT01652963	Not specified	UNKNOWN	Picture-based Computerised Assessment and Training of Cognitive Behaviour Therapy Skills
NCT01695395	Not specified	COMPLETED	Mental Health Care Provision for Adults With Intellectual Disability and a Mental Disorder
NCT01867554	Not specified	COMPLETED	Research and Characterization of New Genes Involved in Intellectual Disability