CTR9

Summary

CTR9 (CTR9 component of Paf1/RNA polymerase II complex, HGNC:16850) is a protein-coding gene on chromosome 11p15.4, encoding RNA polymerase-associated protein CTR9 homolog (Q6PD62). Component of the PAF1 complex (PAF1C) which has multiple functions during transcription by RNA polymerase II and is implicated in regulation of development and maintenance of embryonic stem cell pluripotency. It is a common-essential gene (DepMap: required in 92.6% of cancer cell lines).

The protein encoded by this gene is a component of the PAF1 complex, which associates with RNA polymerase II and functions in transcriptional regulation and elongation. This complex also plays a role in the modification of histones.

Source: NCBI Gene 9646 — RefSeq curated summary.

At a glance

• Gene–disease (curated): CTR9-related neurodevelopmental disorder (Moderate, ClinGen) — +1 more curated relationship
• GWAS associations: 2
• Clinical variants (ClinVar): 783 total — 1 pathogenic, 13 likely-pathogenic (top 4% of genes corpus-wide)
• Regional missense constraint (gnomAD): 3 of 9 regions constrained (≈9% of expected missense variation)
• GTEx eGene: eQTL in 8 tissues, sQTL in 5 (q < 0.05)
• Phenotypes (HPO): 27
• ChEMBL bioactivity: 1 clinical-phase molecule tested; no curated mechanism-of-action drug
• Cancer dependency (DepMap): dependent in 92.6% of screened cell lines (common-essential)
• Constraint (gnomAD): pLI 1.00 (loss-of-function intolerant), LOEUF 0.37 (moderately constrained)
• MANE Select transcript: NM_014633
• Interaction hub: 2,014 STRING partners (top 7% of genes corpus-wide)
• Notable: 783 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:16850
Approved symbol	CTR9
Name	CTR9 component of Paf1/RNA polymerase II complex
Location	11p15.4
Locus type	gene with protein product
Status	Approved
Aliases	KIAA0155, TSBP, p150TSP
Ensembl gene	ENSG00000198730
Ensembl biotype	protein_coding
OMIM	609366
Entrez	9646

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 5 nonsense_mediated_decay, 4 protein_coding, 3 retained_intron

MANE Select: ENST00000361367

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 1, TSL 2: 2, TSL 4: 1, TSL 5: 2

ENST00000361367, ENST00000524523, ENST00000526874, ENST00000529355, ENST00000529898, ENST00000532365, ENST00000715696, ENST00001046253, ENST00001046254, ENST00001046255, ENST00001046256, ENST00001111686

RefSeq mRNA: 2 — MANE Select: NM_014633 NM_001346279, NM_014633

CCDS: CCDS7805

Canonical transcript exons

ENST00000361367 — 25 exons

Exon	Start	End
ENSE00000702613	10752672	10752770
ENSE00000702616	10754958	10755197
ENSE00000702618	10755678	10755795
ENSE00000702620	10756749	10756838
ENSE00000702622	10760173	10760321
ENSE00000702623	10761947	10762054
ENSE00000702624	10763431	10763538
ENSE00000702625	10763643	10763879
ENSE00000702628	10764112	10764201
ENSE00000702630	10764308	10764436
ENSE00000702632	10764548	10764731
ENSE00000702633	10766402	10766490
ENSE00000702639	10768343	10768491
ENSE00000702642	10770210	10770326
ENSE00000702644	10770487	10770632
ENSE00000702646	10771545	10771616
ENSE00000702649	10772520	10772655
ENSE00000702652	10774012	10774169
ENSE00000702653	10775207	10775303
ENSE00000702656	10775521	10775633
ENSE00003651921	10767806	10767991
ENSE00003653935	10773127	10773273
ENSE00003687098	10768074	10768161
ENSE00004027619	10751246	10751457
ENSE00004790016	10778679	10779746

Expression profiles

Bgee: expression breadth ubiquitous, 292 present calls, max score 96.64.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 35.1333 / max 291.2185, expressed in 1818 samples.

Highest expression (Bgee): corpus epididymis, epithelium of nasopharynx, palpebral conjunctiva, bronchial epithelial cell, germinal epithelium of ovary.

Genetic regulation across tissues (GTEx eQTL / sQTL)

CTR9 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 8 tissues and its splicing (sQTL) in 5 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

13 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Testis	sqtl	7.1e-39	+0.76	11:10792066:T:G
Testis	eqtl	3.5e-14	+0.18	11:10792066:T:G
Lung	eqtl	5.6e-03	+0.25	11:10602626:AGACAGGATATTTATAGGGTT:A
Esophagus Mucosa	sqtl	6.7e-03	+1.11	11:11161638:G:T
Esophagus Mucosa	eqtl	1.6e-02	+0.10	11:10409393:G:C
Brain Putamen basal ganglia	eqtl	1.8e-02	-0.85	11:11514891:A:G
Brain Frontal Cortex BA9	eqtl	2.0e-02	-0.92	11:11645391:G:C
Small Intestine Terminal Ileum	sqtl	2.4e-02	-3.01	11:11034274:A:T
Cells Cultured fibroblasts	eqtl	2.4e-02	+0.06	11:10372466:G:A
Pancreas	eqtl	2.4e-02	+0.23	11:11624588:T:G
Brain Cerebellar Hemisphere	sqtl	2.8e-02	-3.64	11:10766780:T:C
Spleen	eqtl	3.0e-02	+0.23	11:11097681:T:C
Nerve Tibial	sqtl	3.3e-02	+0.25	11:10792066:T:G

FANTOM5 promoters

5 alternative TSS:

Promoter ID	TPM avg	Samples expressed
113070	24.7011	1811
113071	7.4430	1682
113068	2.3491	1111
113072	0.3881	203
113069	0.2522	106

Top tissues by expression

showing 100 of 295 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
corpus epididymis	UBERON:0004359	96.64	gold quality
epithelium of nasopharynx	UBERON:0001951	96.27	gold quality
palpebral conjunctiva	UBERON:0001812	93.04	gold quality
bronchial epithelial cell	CL:0002328	92.82	gold quality
germinal epithelium of ovary	UBERON:0001304	92.70	gold quality
pigmented layer of retina	UBERON:0001782	92.68	gold quality
caput epididymis	UBERON:0004358	92.60	gold quality
oral cavity	UBERON:0000167	92.40	gold quality
jejunal mucosa	UBERON:0000399	92.37	gold quality
cauda epididymis	UBERON:0004360	92.35	gold quality
parietal pleura	UBERON:0002400	92.32	gold quality
islet of Langerhans	UBERON:0000006	92.30	gold quality
choroid plexus epithelium	UBERON:0003911	92.13	gold quality
endometrium	UBERON:0001295	92.09	gold quality
upper leg skin	UBERON:0004262	92.01	gold quality
ventricular zone	UBERON:0003053	92.00	gold quality
seminal vesicle	UBERON:0000998	91.73	gold quality
pleura	UBERON:0000977	91.48	gold quality
esophagus squamous epithelium	UBERON:0006920	91.44	gold quality
biceps brachii	UBERON:0001507	91.36	gold quality
epithelium of bronchus	UBERON:0002031	91.21	gold quality
sural nerve	UBERON:0015488	91.21	gold quality
bronchus	UBERON:0002185	91.11	gold quality
squamous epithelium	UBERON:0006914	91.06	gold quality
jejunum	UBERON:0002115	91.04	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	91.01	gold quality
gingiva	UBERON:0001828	91.00	gold quality
ganglionic eminence	UBERON:0004023	90.99	gold quality
lower lobe of lung	UBERON:0008949	90.91	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	90.89	gold quality
mammary duct	UBERON:0001765	90.89	gold quality
colonic mucosa	UBERON:0000317	90.87	gold quality
mucosa of sigmoid colon	UBERON:0004993	90.81	gold quality
blood vessel layer	UBERON:0004797	90.79	gold quality
skin of hip	UBERON:0001554	90.71	gold quality
gingival epithelium	UBERON:0001949	90.61	gold quality
placenta	UBERON:0001987	90.47	gold quality
leukocyte	CL:0000738	90.36	gold quality
monocyte	CL:0000576	90.31	gold quality
mononuclear cell	CL:0000842	90.28	gold quality
visceral pleura	UBERON:0002401	90.28	gold quality
vermiform appendix	UBERON:0001154	90.26	gold quality
epithelium of mammary gland	UBERON:0003244	90.26	gold quality
secondary oocyte	CL:0000655	90.22	gold quality
pharyngeal mucosa	UBERON:0000355	90.21	gold quality
calcaneal tendon	UBERON:0003701	90.18	gold quality
caecum	UBERON:0001153	90.10	gold quality
tibia	UBERON:0000979	90.08	gold quality
superficial temporal artery	UBERON:0001614	90.03	gold quality
lymph node	UBERON:0000029	89.98	gold quality
tonsil	UBERON:0002372	89.98	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	89.89	gold quality
adrenal tissue	UBERON:0018303	89.89	gold quality
uterus	UBERON:0000995	89.86	gold quality
cortical plate	UBERON:0005343	89.77	gold quality
renal medulla	UBERON:0000362	89.72	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	89.67	gold quality
nasal cavity epithelium	UBERON:0005384	89.60	gold quality
amniotic fluid	UBERON:0000173	89.58	gold quality
urethra	UBERON:0000057	89.52	gold quality
stromal cell of endometrium	CL:0002255	89.51	gold quality
superior surface of tongue	UBERON:0007371	89.51	gold quality
thoracic mammary gland	UBERON:0005200	89.43	gold quality
bone marrow	UBERON:0002371	89.36	gold quality
mucosa of paranasal sinus	UBERON:0005030	89.30	gold quality
mammary gland	UBERON:0001911	89.28	gold quality
trigeminal ganglion	UBERON:0001675	89.25	gold quality
penis	UBERON:0000989	89.24	gold quality
cervix squamous epithelium	UBERON:0006922	89.24	gold quality
liver	UBERON:0002107	89.13	gold quality
colonic epithelium	UBERON:0000397	89.06	gold quality
adrenal gland	UBERON:0002369	88.90	gold quality
nasal cavity mucosa	UBERON:0001826	88.86	gold quality
urinary bladder	UBERON:0001255	88.76	gold quality
female reproductive system	UBERON:0000474	88.75	gold quality
myocardium	UBERON:0002349	88.74	gold quality
uterine cervix	UBERON:0000002	88.71	gold quality
epithelium of esophagus	UBERON:0001976	88.69	gold quality
cervix epithelium	UBERON:0004801	88.69	gold quality
right adrenal gland	UBERON:0001233	88.66	gold quality
rectum	UBERON:0001052	88.65	gold quality
embryo	UBERON:0000922	88.64	gold quality
left adrenal gland	UBERON:0001234	88.59	gold quality
right adrenal gland cortex	UBERON:0035827	88.55	gold quality
metanephros	UBERON:0000081	88.52	gold quality
myometrium	UBERON:0001296	88.36	gold quality
testis	UBERON:0000473	88.35	gold quality
adrenal cortex	UBERON:0001235	88.33	gold quality
blood	UBERON:0000178	88.32	gold quality
pancreas	UBERON:0001264	88.30	gold quality
renal glomerulus	UBERON:0000074	88.28	gold quality
nephron tubule	UBERON:0001231	88.26	gold quality
synovial joint	UBERON:0002217	88.25	gold quality
mammalian vulva	UBERON:0000997	88.15	gold quality
parotid gland	UBERON:0001831	88.14	gold quality
left adrenal gland cortex	UBERON:0035825	88.12	gold quality
heart right ventricle	UBERON:0002080	88.09	gold quality
kidney epithelium	UBERON:0004819	88.07	gold quality
bone marrow cell	CL:0002092	88.05	gold quality
trabecular bone tissue	UBERON:0002483	88.04	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	no	0.00

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 80 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Epididymis	tissue	45.3	medium
Caudate putamen	tissue	31.4
Parathyroid gland	tissue	28.3	not detected
Thymus	tissue	28.2
Substantia nigra	tissue	27.8
Retina	tissue	27.0
Testis	tissue	25.3	high
Thalamus	tissue	25.3
Superior colliculi	tissue	25.2
Putamen	tissue	24.9
Choroid plexus	tissue	24.7
Lymph node	tissue	24.6	medium
Pons	tissue	24.6
Tonsil	tissue	24.3	high
Liver	tissue	23.6	not detected
Midbrain	tissue	23.5
Frontal cortex	tissue	23.1
Bone marrow	tissue	22.4	high
Thyroid gland	tissue	21.7	medium
Hippocampal formation	tissue	21.3
Spleen	tissue	21.2	medium
Hypothalamus	tissue	21.1
Kidney	tissue	21.0	medium
Endometrium 1	tissue	20.8	low
Medulla oblongata	tissue	20.8
Basal ganglia	tissue	20.6	medium
Urinary bladder	tissue	20.4	medium
Spinal cord	tissue	20.3
Septum	tissue	20.3
Ventral forebrain	tissue	19.9
Appendix	tissue	19.8	medium
Cerebral cortex	tissue	19.7	medium
Somatosensory cortex	tissue	19.7
Adrenal gland	tissue	19.4	medium
Periaqueductal gray	tissue	19.2
Prefrontal cortex	tissue	19.0
Ovary	tissue	19.0	low
Placenta	tissue	19.0	medium
Entorhinal cortex	tissue	18.8
Occipital cortex	tissue	18.8
Cervix	tissue	18.7	medium
Locus coeruleus	tissue	18.6
Motor cortex	tissue	18.4
Cerebellum	tissue	18.3	medium
Skin 1	tissue	18.1	medium
Temporal cortex	tissue	18.1
Breast	tissue	17.6	medium
Salivary gland	tissue	17.3	medium
Retrosplenial and cingulate cortex	tissue	17.2
Rectum	tissue	17.0	medium
Amygdala	tissue	17.0
Nucleus accumbens	tissue	17.0
Postcentral gyrus	tissue	16.9
Olfactory bulb	tissue	16.8
Skeletal muscle	tissue	16.7	low
Esophagus	tissue	16.5	medium
Prostate	tissue	16.5	not detected
Retrosplenial cortex	tissue	16.4
Stomach 1	tissue	16.3	medium
Lung	tissue	16.2	medium

Brain sub-regions (HPA Brain Atlas): detected in 192; highest nTPM — Median raphe nucleus (21.9), Dorsal hippocampus (21.3), Subiculum (21.0), Ventral hippocampus (20.6), Ventral spinal cord (20.3).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): GLI2

miRNA regulators (miRDB)

Targeting CTR9 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 68 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-LET-7A-3P	100.00	74.03	3932
HSA-LET-7B-3P	100.00	74.08	3913
HSA-LET-7F-1-3P	100.00	74.02	3928
HSA-MIR-98-3P	100.00	74.08	3907
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-340-5P	100.00	72.50	4437
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-126-5P	100.00	72.71	3180
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-186-5P	99.99	70.83	3707
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593
HSA-MIR-1185-2-3P	99.98	71.04	2593
HSA-MIR-3692-3P	99.98	70.27	2139
HSA-MIR-4789-5P	99.98	70.76	2721
HSA-MIR-4803	99.98	71.99	3117
HSA-MIR-590-3P	99.96	74.34	6478
HSA-MIR-3658	99.96	73.87	4379
HSA-MIR-767-5P	99.95	70.85	993
HSA-MIR-23A-3P	99.95	74.24	3163
HSA-MIR-23B-3P	99.95	74.24	3163
HSA-MIR-23C	99.95	73.92	3192
HSA-MIR-381-3P	99.93	71.87	2854
HSA-MIR-300	99.92	71.76	2856
HSA-MIR-3671	99.90	73.04	3897
HSA-MIR-4694-3P	99.79	69.53	2640
HSA-MIR-4766-5P	99.75	69.23	2662
HSA-MIR-12129	99.72	67.45	1311

Functional genomics

gnomAD constraint: pLI 1, LOEUF 0.368, missense Z 4.78 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000361367 splits into 9 regions with different missense tolerance; 3 are missense-constrained (≈9% of the expected missense variation). Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
11:10,751,413–10,752,740	14 / 48.7	0.29	yes (p 6.7e-07)
11:10,752,741–10,755,188	67 / 106.9	0.63	no
11:10,755,189–10,755,711	0 / 16.1	0.00	yes (p 5.9e-05)
11:10,755,712–10,761,998	110 / 149.5	0.74	no
11:10,761,999–10,763,649	16 / 67.4	0.24	yes (p 3.7e-10)
11:10,763,650–10,764,701	133 / 244.1	0.54	no
11:10,764,702–10,770,234	87 / 235.7	0.37	no
11:10,770,235–10,772,610	106 / 157.8	0.67	no
11:10,772,611–10,779,102	384 / 398.4	0.96	no
DepMap (CRISPR cell-line fitness): dependent in 92.6% of screened cell lines, common-essential.

Most-dependent cell lines (DepMap gene-effect, lower = stronger; ≤ −0.5 shown): HPAF-II (-2.044), EOL-1 (-1.853), S-117 (-1.754), HEL (-1.707), JURL-MK1 (-1.619), NCI-N87 (-1.612), SNU-182 (-1.583), HT-1197 (-1.582), KLE (-1.57), DB (-1.556), CAL-78 (-1.532), TUHR10TKB (-1.507), SUP-M2 (-1.478), F-36P (-1.474), Detroit 562 (-1.456).

Literature-anchored findings (GeneRIF, showing 16)

• CTR9 participates in the transcription of IL-6-responsive genes through the regulation of DNA association of STAT3 and modification of histone methylation (PMID:17911113)
• MLL interacts directly with the polymerase associated factor complex (PAFc) via Paf1 and CTR9. PAFc augments MLL and MLL-AF9 mediated transcriptional activation of Hoxa9 and their interaction is essential for leukemogenesis. (PMID:20541477)
• CTR9, a component of PAF complex, controls elongation block at the c-Fos locus via signal-dependent regulation of chromatin-bound NELF dissociation. (PMID:23593388)
• CTR9 is a PAF1 complex gene whose germline mutations predispose to Wilms tumour (PMID:25099282)
• Ctr9, formerly identified as a nuclei protein, interacts with the dopamine transporter in the cytoplasmic compartment. (PMID:26048990)
• Ctr9, a key subunit of hPAFc, is a central regulator of estrogen signaling that drives ERalpha(+) breast tumorigenesis (PMID:26494790)
• Our data demonstrated that Ctr9, independent of other PAFc subunits, controls ERalpha-target gene expression by regulating global chromatin occupancies of ERalpha and RNAPII. (PMID:27829357)
• A novel CTR9 germline variant, located in a consensus splice acceptor site, was found to segregate with Wilms tumor in the family. (PMID:29292210)
• Study reports 2.53 A atomic structures of both the human PAF1/CTR9 and yeast Paf1/Ctr9 heterodimers. Results clearly reveal that the heterodimer of PAF1/CTR9 or Paf1/Ctr9 is the core component of evolutionarily conserved multifunctional polymerase-associated factor 1 complex (Paf1C) and is important for human PAF1C or yeast Paf1C assembly, yeast viability, and Paf1C-mediated histone modifications. (PMID:30228257)
• CTR9-mediated JAK2/STAT3 pathway promotes the proliferation, migration, and invasion of human glioma cells. (PMID:34369006)
• Transcriptional regulator CTR9 promotes hepatocellular carcinoma progression and metastasis via increasing PEG10 transcriptional activity. (PMID:34876700)
• MicroRNA-17-3p is upregulated in psoriasis and regulates keratinocyte hyperproliferation and pro-inflammatory cytokine secretion by targeting CTR9. (PMID:35016493)
• The transcriptional elongation factor CTR9 demarcates PRC2-mediated H3K27me3 domains by altering PRC2 subtype equilibrium. (PMID:35137163)
• Heterozygous variants in CTR9, which encodes a major component of the PAF1 complex, are associated with a neurodevelopmental disorder. (PMID:35499524)
• CTR9 drives osteochondral lineage differentiation of human mesenchymal stem cells via epigenetic regulation of BMP-2 signaling. (PMID:36383652)
• Inherited blood cancer predisposition through altered transcription elongation. (PMID:38218188)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	ctr9	ENSDARG00000009170
mus_musculus	Ctr9	ENSMUSG00000005609
rattus_norvegicus	Ctr9	ENSRNOG00000017195
drosophila_melanogaster	Ctr9	FBGN0035205
caenorhabditis_elegans		WBGENE00007184

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:109345) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 4 distinct phenotype terms.

Mouse phenotype (MP)	Records
increased circulating alanine transaminase level	1
preweaning lethality, complete penetrance	1
embryonic lethality prior to organogenesis	1
prenatal lethality prior to heart atrial septation	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Xenopus tropicalis	Q6DEU9	94.8%	Diamond
Xenopus laevis	Q4QR29	94.6%	Diamond
Arabidopsis thaliana	B5X0I6	35.8%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
MIR4485	ncRNA	100616263
IRAG1	protein-coding	10335
LYVE1	protein-coding	10894
EIF4G2	protein-coding	1982
RNF141	protein-coding	50862
SNORD97	snoRNA	692223
ZBED5	protein-coding	58486
ZBED5-AS1	ncRNA	729013
IRAG1-AS1	ncRNA	100129827

Protein

Protein identifiers

RNA polymerase-associated protein CTR9 homolog — Q6PD62 (reviewed: Q6PD62)

Alternative names: SH2 domain-binding protein 1

All UniProt accessions (3): Q6PD62, A0A2R8Y3S3, H0YCE8

UniProt curated annotations — full annotation on UniProt →

Function. Component of the PAF1 complex (PAF1C) which has multiple functions during transcription by RNA polymerase II and is implicated in regulation of development and maintenance of embryonic stem cell pluripotency. PAF1C associates with RNA polymerase II through interaction with POLR2A CTD non-phosphorylated and ‘Ser-2’- and ‘Ser-5’-phosphorylated forms and is involved in transcriptional elongation, acting both independently and synergistically with TCEA1 and in cooperation with the DSIF complex and HTATSF1. PAF1C is required for transcription of Hox and Wnt target genes. PAF1C is involved in hematopoiesis and stimulates transcriptional activity of KMT2A/MLL1; it promotes leukemogenesis through association with KMT2A/MLL1-rearranged oncoproteins, such as KMT2A/MLL1-MLLT3/AF9 and KMT2A/MLL1-MLLT1/ENL. PAF1C is involved in histone modifications such as ubiquitination of histone H2B and methylation on histone H3 ‘Lys-4’ (H3K4me3). PAF1C recruits the RNF20/40 E3 ubiquitin-protein ligase complex and the E2 enzyme UBE2A or UBE2B to chromatin which mediate monoubiquitination of ‘Lys-120’ of histone H2B (H2BK120ub1); UB2A/B-mediated H2B ubiquitination is proposed to be coupled to transcription. PAF1C is involved in mRNA 3’ end formation probably through association with cleavage and poly(A) factors. In case of infection by influenza A strain H3N2, PAF1C associates with viral NS1 protein, thereby regulating gene transcription. Required for mono- and trimethylation on histone H3 ‘Lys-4’ (H3K4me3) and dimethylation on histone H3 ‘Lys-79’ (H3K4me3). Required for Hox gene transcription. Required for the trimethylation of histone H3 ‘Lys-4’ (H3K4me3) on genes involved in stem cell pluripotency; this function is synergistic with CXXC1 indicative for an involvement of the SET1 complex. Involved in transcriptional regulation of IL6-responsive genes and in JAK-STAT pathway; may regulate DNA-association of STAT3.

Subunit / interactions. Component of the PAF1 complex, which consists of CDC73, PAF1, LEO1, CTR9, RTF1 and SKIC8. The PAF1 complex interacts with PHF5A. Interacts with KMT2A/MLL1. Interacts with STAT3. Interacts with SETD5. Interacts with ERCC6. (Microbial infection) The PAF1 complex interacts with Zika virus French Polynesia 10087PF/2013 non-structural protein 5/NS5. The interaction with viral NS5 proteins may reduce the antiviral immune response by inhibiting the recruitment of the PAF1 complex to interferon-stimulated genes, thus preventing their transcription. (Microbial infection) The PAF1 complex interacts with Dengue virus DENV2 16681 non-structural protein 5/NS5. The PAF1 complex interacts with Dengue virus DENV4 Dominica/814669/1981 non-structural protein 5/NS5. The interaction with viral NS5 proteins may reduce the antiviral immune response by inhibiting the recruitment of the PAF1 complex to interferon-stimulated genes, thus preventing their transcription.

Subcellular location. Nucleus speckle.

Tissue specificity. Widely expressed.

RefSeq proteins (2): NP_001333208, NP_055448* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR011990	TPR-like_helical_dom_sf	Homologous_superfamily
IPR019734	TPR_rpt	Repeat
IPR031101

Pfam: PF13181, PF13374, PF14559

UniProt features (100 total): helix 44, repeat 16, modified residue 15, compositionally biased region 9, strand 8, turn 6, chain 1, region of interest 1

Structure

Experimental structures (PDB)

21 structures by resolution:

PDB	Title	Method	Resolution (Å)
9HVQ	Structure of the transcribing Pol II-DSIF-PAF-SPT6-RECQL5 complex	ELECTRON MICROSCOPY	2
9MLC	Pol II-DSIF-SPT6-PAF1c-TFIIS-IWS1-ELOF1-LEDGF-nucleosome activated elongation complex …	ELECTRON MICROSCOPY	2.4
5ZYQ	The Structure of Human PAF1/CTR9 complex	X-RAY DIFFRACTION	2.53
7OOP	Pol II-CSB-CSA-DDB1-UVSSA-PAF-SPT6 (Structure 3)	ELECTRON MICROSCOPY	2.9
9EGX	RNA polymerase II-DSIF-SPT6-PAF1c-TFIIS-IWS1-hexasome, bp +27	ELECTRON MICROSCOPY	2.9
9EGY	RNA polymerase II-DSIF-SPT6-PAF1c-TFIIS-IWS1-nucleosome, bp +27	ELECTRON MICROSCOPY	2.9
9EGZ	RNA polymerase II-DSIF-SPT6-PAF1c-TFIIS-IWS1-SETD2-nucleosome, bp +27	ELECTRON MICROSCOPY	2.9
7OPC	Pol II-CSB-CRL4CSA-UVSSA-SPT6-PAF (Structure 4)	ELECTRON MICROSCOPY	3
7OPD	Pol II-CSB-CRL4CSA-UVSSA-SPT6-PAF (Structure 5)	ELECTRON MICROSCOPY	3
7UNC	Pol II-DSIF-SPT6-PAF1c-TFIIS complex with rewrapped nucleosome	ELECTRON MICROSCOPY	3
7UND	Pol II-DSIF-SPT6-PAF1c-TFIIS-nucleosome complex (stalled at +38)	ELECTRON MICROSCOPY	3
6GMH	Structure of activated transcription complex Pol II-DSIF-PAF-SPT6	ELECTRON MICROSCOPY	3.1
6TED	Structure of complete, activated transcription complex Pol II-DSIF-PAF-SPT6 uncovers …	ELECTRON MICROSCOPY	3.1
9EH1	RNA polymerase II-DSIF-SPT6-PAF1c-TFIIS-IWS1-SETD2-nucleosome, 20 bp upstream	ELECTRON MICROSCOPY	3.1
9EH2	RNA polymerase II-DSIF-SPT6-PAF1c-TFIIS-IWS1-SETD2-FACT nucleosome upstream	ELECTRON MICROSCOPY	3.1
8A3Y	Structure of mammalian Pol II-DSIF-SPT6-PAF1-TFIIS-hexasome elongation complex	ELECTRON MICROSCOPY	3.3
9EH0	RNA polymerase II-DSIF-SPT6-PAF1c-TFIIS-IWS1-SETD2-nucleosome, 30 bp upstream	ELECTRON MICROSCOPY	3.6
9RTT	Activated Elongation Complex with IWS1 and ELOF1	ELECTRON MICROSCOPY	4.01
9S3G	State 1 MAP3 RNA Pol II activated elongation complex with SETD2 and upstream hexasome	ELECTRON MICROSCOPY	6.4
9S0U	State 3 MAP 3 RNA Pol II activated elongation complex with SETD2 bound to distal upstream …	ELECTRON MICROSCOPY	6.72
9RZE	State 2 MAP 3 RNA Pol II activated elongation complex with SETD2 bound to proximal …	ELECTRON MICROSCOPY	8.53

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q6PD62-F1	76.62	0.43

Human Protein Atlas

Protein class: Predicted intracellular proteins, Essential proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): nucleoplasm

Antibody reliability (HPA): IH supported · IF enhanced

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (15)

Type	Positions
Phosphothreonine	925
Phosphoserine	932, 941, 943, 970, 1020, 1021, 1039, 1041, 1043, 1081, 1085, 1087, 1097, 1102

Function

Pathways and Gene Ontology

Reactome pathways

6 curated (TAS) of 12; 1 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

12 pathways:

ID	Pathway	Evidence
R-HSA-9920588	Dengue virus activates/modulates innate and adaptive immune responses ⚕	curated
R-HSA-9943411	CHD1 and CHD2 subfamily	curated
R-HSA-8866654	E3 ubiquitin ligases ubiquitinate target proteins	curated
R-HSA-112382	Formation of RNA Pol II elongation complex	curated
R-HSA-674695	RNA Polymerase II Pre-transcription Events	curated
R-HSA-75955	RNA Polymerase II Transcription Elongation	curated
R-HSA-74160	Gene expression (Transcription)	—
R-HSA-392499	Metabolism of proteins	—
R-HSA-597592	Post-translational protein modification	—
R-HSA-8852135	Protein ubiquitination	—
R-HSA-73857	RNA Polymerase II Transcription	—
R-HSA-9938024	Somatic hypermutation of immunoglobulin genes	electronic

MSigDB gene sets: 288 (showing top): GOBP_MYELOID_CELL_DIFFERENTIATION, GOBP_EMBRYO_DEVELOPMENT_ENDING_IN_BIRTH_OR_EGG_HATCHING, GOBP_RESPONSE_TO_PEPTIDE, GOBP_CELLULAR_RESPONSE_TO_LIPID, GOBP_FORMATION_OF_PRIMARY_GERM_LAYER, GOBP_CELLULAR_RESPONSE_TO_BIOTIC_STIMULUS, CGGAARNGGCNG_UNKNOWN, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_UP, GOBP_GROWTH, GOBP_BLASTOCYST_FORMATION, GOBP_CELL_SURFACE_RECEPTOR_SIGNALING_PATHWAY_VIA_JAK_STAT, ACTGCAG_MIR173P, GOBP_CELLULAR_RESPONSE_TO_OXYGEN_CONTAINING_COMPOUND, SP1_Q2_01

GO Biological Process (13): negative regulation of transcription by RNA polymerase II (GO:0000122), endodermal cell fate commitment (GO:0001711), chromatin organization (GO:0006325), transcription elongation by RNA polymerase II (GO:0006368), cell surface receptor signaling pathway via JAK-STAT (GO:0007259), Wnt signaling pathway (GO:0016055), stem cell population maintenance (GO:0019827), negative regulation of myeloid cell differentiation (GO:0045638), positive regulation of transcription by RNA polymerase II (GO:0045944), interleukin-6-mediated signaling pathway (GO:0070102), cellular response to lipopolysaccharide (GO:0071222), regulation of DNA-templated transcription (GO:0006355), regulation of transcription by RNA polymerase II (GO:0006357)

GO Molecular Function (3): RNA polymerase II complex binding (GO:0000993), SH2 domain binding (GO:0042169), protein binding (GO:0005515)

GO Cellular Component (5): euchromatin (GO:0000791), nucleus (GO:0005634), nucleoplasm (GO:0005654), Cdc73/Paf1 complex (GO:0016593), nuclear speck (GO:0016607)

Reactome top-level categories

9 top-level categories:

Category	Pathways
RNA Polymerase II Transcription	2
RNA Polymerase II Transcription Elongation	1
Protein ubiquitination	1
Dengue Virus-Host Interactions	1
Affinity selection of immunoglobulins	1
CHD chromatin remodelers	1
Metabolism of proteins	1
Gene expression (Transcription)	1
Post-translational protein modification	1

GO top-level categories

35 GO namespaces:

Category	Terms
transcription by RNA polymerase II	4
regulation of transcription by RNA polymerase II	2
negative regulation of DNA-templated transcription	1
endodermal cell differentiation	1
cell fate commitment involved in formation of primary germ layer	1
cellular component organization	1
DNA-templated transcription elongation	1
cell surface receptor signaling pathway via STAT	1
cell surface receptor signaling pathway	1
multicellular organismal process	1
maintenance of cell number	1
myeloid cell differentiation	1
negative regulation of cell differentiation	1
regulation of myeloid cell differentiation	1
positive regulation of DNA-templated transcription	1
cytokine-mediated signaling pathway	1
cellular response to interleukin-6	1
response to lipopolysaccharide	1
cellular response to molecule of bacterial origin	1
cellular response to lipid	1
cellular response to oxygen-containing compound	1
DNA-templated transcription	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
regulation of DNA-templated transcription	1
RNA polymerase core enzyme binding	1
protein domain specific binding	1
binding	1
chromatin	1
intracellular membrane-bounded organelle	1
nuclear lumen	1
cellular anatomical structure	1
transcription elongation factor complex	1
RNA polymerase II, holoenzyme	1
nuclear ribonucleoprotein granule	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 7 of 21 annotations. The rest are phylogenetic / computational / electronic (IEA).

7 experimentally-supported GO terms:

GO term	NS	Evidence
negative regulation of myeloid cell differentiation	BP	direct assay
positive regulation of transcription by RNA polymerase II	BP	direct assay
stem cell population maintenance	BP	direct assay
transcription elongation by RNA polymerase II	BP	direct assay
Cdc73/Paf1 complex	CC	direct assay
nucleoplasm	CC	direct assay
nucleus	CC	direct assay

Protein interactions and networks

STRING

showing 15 of 2,014 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CTR9	LEO1	Q8WVC0	989
CTR9	CDC73	Q6P1J9	976
CTR9	RTF1	Q92541	908
CTR9	POLR2A	P24928	857
CTR9	SKIC8	Q9GZS3	848
CTR9	PAF1	Q8N7H5	784
CTR9	SUPT5H	O00267	725
CTR9	SUPT6H	Q7KZ85	673
CTR9	JAG2	Q9Y219	669
CTR9	SUPT4H1	P63272	636
CTR9	SUPT16H	Q9Y5B9	633
CTR9	RNF20	Q5VTR2	591
CTR9	TCEA2	Q15560	580
CTR9	TCEA1	P23193	580
CTR9	TCEA3	O75764	560

IntAct

Human interaction partners of CTR9 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

19 partners by confidence:

Partner	Interaction type	MIscore	Records
CDC73	association	0.940	18
PAF1	association	0.910	9
SKIC8	physical association	0.850	2
LEO1	association	0.790	2
KMT2A	association	0.580	3
EHMT2	physical association	0.400	1
SETDB1	physical association	0.400	1
CNTNAP2	physical association	0.370	1
SMAD9	physical association	0.370	1
POLR2B	association	0.350	1
RCCD1	association	0.350	1
SUGP1	association	0.350	1
UBE2E1	association	0.350	1
PTPN11	proximity	0.270	1
STAT3	colocalization	0.270	1
ARHGAP26	physical association	0.000	1
DISC1	physical association	0.000	1
ELOA	physical association	0.000	1
HUNK	physical association	0.000	1

BioGRID (365 interactions; top human partners by supporting records): CDC73 (Affinity Capture-MS; 21 records), PAF1 (Co-fractionation; 19 records), LEO1 (Co-fractionation; 14 records), WDR61 (Co-fractionation; 8 records), RTF1 (Co-fractionation; 6 records), TCEB3 (Affinity Capture-MS; 5 records), KMT2A (Positive Genetic; 4 records), MYC (Affinity Capture-Western; 4 records), HIST1H1C (Affinity Capture-MS; 3 records), MBIP (Affinity Capture-MS; 3 records), PTPN11 (Proximity Label-MS; 3 records), PTPN6 (Affinity Capture-MS; 3 records), SIAH1 (Two-hybrid; 3 records), SUPT5H (Co-fractionation; 3 records), TCEB2 (Affinity Capture-MS; 3 records)

SIGNOR signaling

1 signaling interactions:

A	Effect	B	Mechanism
CTR9	“form complex”	PAF1C	binding

Protein complexes (CORUM) (1)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

1 complexes by size:

Complex	Subunits	Members
Paf complex	5	SKIC8, CDC73, CTR9, LEO1, PAF1

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 19 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Formation of RNA Pol II elongation complex	6	72.6×	1e-08
RNA Polymerase II Transcription Elongation	6	72.6×	1e-08
E3 ubiquitin ligases ubiquitinate target proteins	5	60.5×	8e-07
RNA Polymerase II Pre-transcription Events	6	51.6×	8e-08

GO biological processes:

GO term	Partners	Fold	FDR
transcription elongation by RNA polymerase II	5	116.7×	1e-07

Disease & clinical

Genetic variants

Variant evidence for CTR9: 783 ClinVar records (14 pathogenic / likely pathogenic); 2 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

783 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	13
Uncertain significance	379
Likely benign	291
Benign	53

Top pathogenic / likely-pathogenic (14)

Showing all 14 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
1173024	NM_014633.5(CTR9):c.1364A>G (p.Asn455Ser)	Likely pathogenic	criteria provided, multiple submitters, no conflicts	2
4531690	NM_014633.5(CTR9):c.46-1G>T	Pathogenic	criteria provided, single submitter	1
1173018	NM_014633.5(CTR9):c.43G>A (p.Glu15Lys)	Likely pathogenic	criteria provided, single submitter	1
1173019	NM_014633.5(CTR9):c.109G>C (p.Glu37Gln)	Likely pathogenic	criteria provided, single submitter	1
1173021	NM_014633.5(CTR9):c.1405G>A (p.Glu469Lys)	Likely pathogenic	criteria provided, single submitter	1
1173022	NM_014633.5(CTR9):c.254G>A (p.Cys85Tyr)	Likely pathogenic	criteria provided, single submitter	1
1173023	NM_014633.5(CTR9):c.76G>C (p.Glu26Gln)	Likely pathogenic	criteria provided, single submitter	1
1173027	NM_014633.5(CTR9):c.2633G>A (p.Arg878Gln)	Likely pathogenic	criteria provided, single submitter	1
2575015	NM_014633.5(CTR9):c.110A>G (p.Glu37Gly)	Likely pathogenic	criteria provided, single submitter	1
2576938	NM_014633.5(CTR9):c.85G>C (p.Glu29Gln)	Likely pathogenic	criteria provided, single submitter	1
3078716	NM_014633.5(CTR9):c.44A>G (p.Glu15Gly)	Likely pathogenic	criteria provided, single submitter	1
3078720	NM_014633.5(CTR9):c.56T>A (p.Leu19His)	Likely pathogenic	criteria provided, single submitter	1
4008093	NM_014633.5(CTR9):c.98T>C (p.Ile33Thr)	Likely pathogenic	criteria provided, single submitter	1
4814031	NM_014633.5(CTR9):c.2801A>G (p.Lys934Arg)	Likely pathogenic	no assertion criteria provided	1

Per-variant reference — Sugi Variant

Explore CTR9’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 28 predictions of 1,421):

Position(s)	Effect	Δscore	Sites
11:10752670–10752671	acceptor_loss	1.0000	2
11:10752771–10752772	donor_loss	1.0000	5
11:10754950	acceptor_gain	1.0000
11:10754955	acceptor_gain	1.0000
11:10754956–10754957	acceptor_loss	1.0000	3
11:10756736–10756740	acceptor_gain	1.0000	3
11:10756748	acceptor_loss	1.0000
11:10756839–10756840	donor_loss	1.0000	2
11:10762055–10762056	donor_loss	1.0000	5
11:10763429–10763430	acceptor_loss	1.0000	5

AlphaMissense

4,433 missense substitutions predicted likely pathogenic (of 7,759 scored), across 885 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M125	9	0.991	0.999
M83	9	0.986	1.000
M703	9	0.986	0.999
H130	8	1.000	1.000
D87	8	0.999	1.000
D121	8	0.999	1.000
D411	8	0.999	1.000
H575	8	0.999	1.000
D819	8	0.998	0.999
H278	8	0.997	1.000
D600	8	0.996	0.999
H827	8	0.996	1.000
N456	8	0.995	1.000
N686	8	0.995	1.000
H689	8	0.995	1.000
F154	8	0.992	1.000
F279	8	0.992	1.000
D552	8	0.992	0.999
F670	8	0.992	1.000
H317	8	0.989	1.000

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

5 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	1.86e-07
Kidney Renal Clear Cell Carcinoma (validation)	favorable	0.000273
Glioblastoma Multiforme (validation)	unfavorable	0.000317
Kidney Chromophobe (TCGA)	unfavorable	0.00032
Ovary Serous Cystadenocarcinoma (validation)	unfavorable	0.000915

Disease associations

OMIM: gene MIM:609366 | disease phenotypes:

GenCC curated gene-disease

2 curated gene-disease records:

Disease	Classification	Inheritance	Records
childhood kidney Wilms tumor	Moderate	Autosomal dominant
CTR9-related neurodevelopmental disorder	Moderate	Autosomal dominant

ClinGen Gene-Disease Validity

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

1 validity classifications:

Disease	Classification	Inheritance
CTR9-related neurodevelopmental disorder	Moderate	AD

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (7 panels, 7 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

7 panels:

Panel	Rating
Childhood solid tumours	green
DDG2P	green
Embryonal tumour of possible germline origin	green
Hypotonic infant	green
Intellectual disability	green
Leukodystrophy, childhood onset	green
Paediatric disorders	green

Mondo (3): CTR9-related neurodevelopmental disorder (MONDO:1040006), neurodevelopmental disorder (MONDO:0700092), childhood kidney Wilms tumor (MONDO:0024676)

HPO phenotypes

27 phenotypes (HPO-id order):

HPO	Term
HP:0000028	Cryptorchidism
HP:0000047	Hypospadias
HP:0000085	Horseshoe kidney
HP:0000086	Ectopic kidney
HP:0000526	Aniridia
HP:0000822	Hypertension
HP:0001528	Hemihypertrophy
HP:0001824	Weight loss
HP:0001901	Polycythemia
HP:0001903	Anemia
HP:0001945	Fever
HP:0002027	Abdominal pain
HP:0002094	Dyspnea
HP:0002664	Neoplasm
HP:0002667	Nephroblastoma
HP:0002716	Lymphadenopathy
HP:0002896	Neoplasm of the liver
HP:0002907	Microscopic hematuria
HP:0003072	Hypercalcemia
HP:0005580	Duplication of renal pelvis
HP:0008330	Reduced von Willebrand factor activity
HP:0012587	Macroscopic hematuria
HP:0012871	Varicocele
HP:0031105	Abnormal uterus morphology
HP:0031500	Abdominal mass
HP:0033834	Malaise
HP:0100526	Neoplasm of the lung

GWAS associations

2 associations:

Study	Trait	p-value
GCST003986_15	Migraine	2e-9
GCST012033_15	Sleep (1/3-day periodicity)	4e-8

MeSH disease descriptors

1 disease descriptors:

Descriptor	Name	Tree numbers
D065886	Neurodevelopmental Disorders	F03.625

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5724759 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 1,601 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

1 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL1232461	MOLIBRESIB	2	1,601

PharmGKB: 1 entry (CPIC guideline: no)

ChEMBL bioactivities

3 potent at pChembl≥5 of 3 total, top 3 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
7.66	Kd	22	nM	MOLIBRESIB
5.24	Kd	5719	nM	CHEMBL3752910
5.24	ED50	5719	nM	CHEMBL3752910

PubChem BioAssay actives

2 with measured affinity, of 9 total; 2 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
2-[(4S)-6-(4-chlorophenyl)-8-methoxy-1-methyl-4H-[1,2,4]triazolo[4,3-a][1,4]benzodiazepin-4-yl]-N-ethylacetamide	2179166: Binding affinity against CTR9 (unknown origin) assessed as apparent dissociation constant incubated for 1 hr by colloidal coomassie staining based LC-MS/MS analysis	kd	0.0220	uM
4-methyl-3-[(1-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2148173: Binding affinity to human CTR9 incubated for 45 mins by Kinobead based pull down assay	kd	5.7186	uM

CTD chemical–gene interactions

35 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Air Pollutants	decreases expression, affects expression, increases abundance, increases expression	3
(+)-JQ1 compound	increases expression	2
Resveratrol	affects cotreatment, increases expression	2
Air Pollutants, Occupational	affects expression, decreases expression, increases abundance, increases expression	2
Ozone	increases abundance, increases expression, affects expression	2
FR900359	increases phosphorylation	1
triphenyl phosphate	affects expression	1
2,3-bis(3’-hydroxybenzyl)butyrolactone	affects cotreatment, increases expression	1
di-n-butylphosphoric acid	affects expression	1
CGP 52608	increases reaction, affects binding	1
ICG 001	decreases expression	1
Arsenic	affects methylation	1
Vehicle Emissions	increases abundance, increases expression	1
Cannabidiol	increases expression	1
Cisplatin	increases expression	1
Coumestrol	affects cotreatment, increases expression	1
Dimethyl Sulfoxide	decreases expression	1
Estradiol	increases expression	1
Hydrogen Peroxide	affects expression	1
Ivermectin	decreases expression	1
Lead	affects expression	1
Nickel	decreases expression	1
Plant Extracts	affects cotreatment, increases expression	1
Ribonucleotides	affects binding	1
Rotenone	decreases expression	1
Smoke	decreases expression	1
Thiram	increases expression	1
Tobacco Smoke Pollution	increases expression	1
Urethane	increases expression	1
Valproic Acid	affects expression	1

ChEMBL screening assays

8 unique, capped per target: 8 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5651215	Binding	Binding affinity to human CTR9 incubated for 45 mins by Kinobead based pull down assay	NVP-BHG712: Effects of Regioisomers on the Affinity and Selectivity toward the EPHrin Family. — *ChemMedChem*

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 353 trials:

NCT	Phase	Status	Title
NCT00336531	Phase 4	COMPLETED	Efficacy of Prophylactic Itraconazole in High-Dose Chemotherapy and Autologous Hematopoietic Stem Cell Transplantation
NCT04586348	Phase 4	UNKNOWN	Prenatal Iodine Supplementation and Early Childhood Neurodevelopment
NCT04873115	Phase 4	UNKNOWN	Double-blind, Placebo-controlled, Randomized Clinical Trial Comparing the Efficacy and Safety of Sialanar Plus orAl rehabiLitation Against Placebo Plus Oral Rehabilitation for chIldren and Adolescents With seVere Sialorrhoea and Neurodisabilties,
NCT00744250	Phase 4	TERMINATED	Intraduodenal Aspiration Study to Assess the Bioavailability of Oral Pancrecarb® Compared to Placebo Control
NCT01100606	Phase 4	COMPLETED	A Study to Evaluate the Mode of Administration and Safety of EUR-1008 (APT-1008) in Infants 1 to 12 Months of Age
NCT01131507	Phase 4	COMPLETED	PR-018: An Open-Label, Safety Extension of Study PR-011
NCT01327703	Phase 4	COMPLETED	Control of Steatorrhea in Participants With Cystic Fibrosis and Exocrine Pancreatic Insufficiency
NCT01430234	Phase 4	COMPLETED	Enzyme Suppletion in Exocrine Pancreatic Dysfunction
NCT02823964	Phase 4	COMPLETED	EASY: Extended Access to Sollpura Over Years
NCT03859869	Phase 4	TERMINATED	A Study of Creon (Pancrelipase) in Resected and Non-resected Pancreatic Cancer Participants With Exocrine Pancreatic Insufficiency (EPI)
NCT04315311	Phase 4	WITHDRAWN	Study Of Effects Of Oral CREON Capsules In Adult Participants With Exocrine Pancreatic Insufficiency Not Due To Cystic Fibrosis, Chronic Pancreatitis, Pancreatectomy, Or Pancreatic Cancer
NCT06477159	Phase 4	RECRUITING	Pancreatic Enzyme Replacement Therapy for Acute Pancreatitis-Associated Exocrine Pancreatic Insufficiency
NCT07285863	Phase 4	RECRUITING	A Study Of Effect Of Secretin For In Injection (Chirostim) On Pancreatic Fluid Composition In Healthy Subjects
NCT07418593	Phase 4	RECRUITING	Malabsorption Blood Test (MBT) to Determine Exocrine Pancreatic Function and Related Quality of Life in Chronic Pancreatitis
NCT07632768	Phase 4	COMPLETED	Safety of Stopping Pancreatic Enzyme Replacement Therapy in Children With Improved Pancreatic Function After Highly Effective Modulator Therapy
NCT00352534	Phase 3	COMPLETED	Vincristine, Dactinomycin, and Doxorubicin With or Without Radiation Therapy or Observation Only in Treating Younger Patients Who Are Undergoing Surgery for Newly Diagnosed Stage I, Stage II, or Stage III Wilms’ Tumor
NCT00379340	Phase 3	COMPLETED	Combination Chemotherapy With or Without Radiation Therapy in Treating Young Patients With Newly Diagnosed Stage III or Stage IV Wilms’ Tumor
NCT00945009	Phase 3	COMPLETED	Combination Chemotherapy and Surgery in Treating Young Patients With Wilms Tumor
NCT02559102	Phase 3	COMPLETED	Dexmedetomidine Sedation Versus General Anaesthesia for Inguinal Hernia Surgery in Infants
NCT02757079	Phase 3	COMPLETED	Study of the Efficacy and Safety of NPC-15 for Sleep Disorders of Children With Neurodevelopmental Disorders
NCT06915480	Phase 3	RECRUITING	Reducing Missed Appointments
NCT07377032	Phase 3	RECRUITING	TAP-GRIN: Interventional Study on Patients With GRIN-related Neurodevelopmental Disorders
NCT00297167	Phase 3	COMPLETED	Study to Evaluate the Safety and Efficacy of EUR-1008 (APT-1008) Pancreatic Enzyme Product in Participants With Cystic Fibrosis and Exocrine Pancreatic Insufficiency
NCT00408317	Phase 3	COMPLETED	Safety and Efficacy Study of ULTRASE® MT20 in Participants With Cystic Fibrosis (CF) and Exocrine Pancreatic Insufficiency (PI)
NCT00449878	Phase 3	COMPLETED	Liprotamase Efficacy Trial in Patients With Cystic Fibrosis-Related Exocrine Pancreatic Insufficiency
NCT00449904	Phase 3	COMPLETED	Open-Label Phase III Long-Term Safety Trial of Liprotamase
NCT00500084	Phase 3	TERMINATED	Phase III ALTU-135 CP Safety Trial
NCT00559364	Phase 3	COMPLETED	Safety and Efficacy Study of Viokase® 16 for the Correction of Steatorrhea
NCT00662675	Phase 3	COMPLETED	A Study of the Efficacy and Tolerability of Pancrelipase Microtablet (MT) Capsules for the Treatment of Cystic Fibrosis-dependent Exocrine Pancreatic Insufficiency
NCT00788593	Phase 3	COMPLETED	A Randomized, Double-Blind, Dose Response-Control, Crossover Study to Evaluate the Safety and Efficacy of Two Doses of EUR-1008 (APT-1008) in Chronic Pancreatitis (CP) Participants With Exocrine Pancreatic Insufficiency (EPI)
NCT00981214	Phase 3	COMPLETED	Study of Pancreatic Enzyme Product in Pediatric Participants With Cystic Fibrosis and Exocrine Pancreatic Insufficiency
NCT02279498	Phase 3	COMPLETED	SOLUTION: Study of Oral Liprotamase Unit-Matched Therapy Of Non-Porcine Origin in Patients With Cystic Fibrosis
NCT02734810	Phase 3	COMPLETED	SIMPLICITY: Studying Impacts on Malabsorption With Liprotamase in Cystic Fibrosis
NCT03051490	Phase 3	UNKNOWN	RESULT: Reliable, Emergent Solution Using Liprotamase Treatment
NCT06691893	Phase 3	RECRUITING	Evaluating the Efficacy of RELiZORB in Managing Exocrine Pancreatic Insufficiency in Tube-fed Pancreatitis Patients
NCT07697352	Phase 3	NOT_YET_RECRUITING	Comparative Study to Evaluate Microbial Versus Porcine Pancreatic Enzyme Therapy in Chronic Pancreatitis
NCT00141765	Phase 2	COMPLETED	Study of High-Dose Chemotherapy With Bone Marrow or Stem Cell Transplant for Rare Poor-Prognosis Cancers
NCT00187031	Phase 2	COMPLETED	A Phase II Study of Topotecan in Children With Recurrent Wilms Tumor
NCT01095926	Phase 2	COMPLETED	Pharmacokinetic Study of Doxorubicin in Children With Cancer
NCT02452554	Phase 2	COMPLETED	Lorvotuzumab Mertansine in Treating Younger Patients With Relapsed or Refractory Wilms Tumor, Rhabdomyosarcoma, Neuroblastoma, Pleuropulmonary Blastoma, Malignant Peripheral Nerve Sheath Tumor, or Synovial Sarcoma
NCT02624388	Phase 2	TERMINATED	Study of Genistein in Pediatric Oncology Patients (UVA-Gen001)
NCT02689336	Phase 2	WITHDRAWN	Erlotinib in Combination With Temozolomide in Treating Relapsed/Recurrent/Refractory Pediatric Solid Tumors
NCT02867592	Phase 2	ACTIVE_NOT_RECRUITING	Cabozantinib-S-Malate in Treating Younger Patients With Recurrent, Refractory, or Newly Diagnosed Sarcomas, Wilms Tumor, or Other Rare Tumors
NCT03155620	Phase 2	ACTIVE_NOT_RECRUITING	Targeted Therapy Directed by Genetic Testing in Treating Pediatric Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphomas, or Histiocytic Disorders (The Pediatric MATCH Screening Trial)
NCT03210714	Phase 2	ACTIVE_NOT_RECRUITING	Erdafitinib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With FGFR Mutations (A Pediatric MATCH Treatment Trial)
NCT03213652	Phase 2	ACTIVE_NOT_RECRUITING	Ensartinib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With ALK or ROS1 Genomic Alterations (A Pediatric MATCH Treatment Trial)
NCT03213665	Phase 2	COMPLETED	Tazemetostat in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With EZH2, SMARCB1, or SMARCA4 Gene Mutations (A Pediatric MATCH Treatment Trial)
NCT03213678	Phase 2	COMPLETED	Samotolisib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With TSC or PI3K/MTOR Mutations (A Pediatric MATCH Treatment Trial)
NCT03213704	Phase 2	ACTIVE_NOT_RECRUITING	Larotrectinib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With NTRK Fusions (A Pediatric MATCH Treatment Trial)
NCT03220035	Phase 2	COMPLETED	Vemurafenib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With BRAF V600 Mutations (A Pediatric MATCH Treatment Trial)
NCT03233204	Phase 2	COMPLETED	Olaparib in Treating Patients With Relapsed or Refractory Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With Defects in DNA Damage Repair Genes (A Pediatric MATCH Treatment Trial)
NCT03526250	Phase 2	COMPLETED	Palbociclib in Treating Patients With Relapsed or Refractory Rb Positive Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With Activating Alterations in Cell Cycle Genes (A Pediatric MATCH Treatment Trial)
NCT03698994	Phase 2	ACTIVE_NOT_RECRUITING	Ulixertinib in Treating Patients With Advanced Solid Tumors, Non-Hodgkin Lymphoma, or Histiocytic Disorders With MAPK Pathway Mutations (A Pediatric MATCH Treatment Trial)
NCT04195555	Phase 2	ACTIVE_NOT_RECRUITING	Ivosidenib in Treating Patients With Advanced Solid Tumors, Lymphoma, or Histiocytic Disorders With IDH1 Mutations (A Pediatric MATCH Treatment Trial)
NCT04284774	Phase 2	ACTIVE_NOT_RECRUITING	Tipifarnib for the Treatment of Advanced Solid Tumors, Lymphoma, or Histiocytic Disorders With HRAS Gene Alterations, a Pediatric MATCH Treatment Trial
NCT04320888	Phase 2	ACTIVE_NOT_RECRUITING	Selpercatinib for the Treatment of Advanced Solid Tumors, Lymphomas, or Histiocytic Disorders With Activating RET Gene Alterations, a Pediatric MATCH Treatment Trial
NCT04322318	Phase 2	RECRUITING	A Study of Combination Chemotherapy for Patients With Newly Diagnosed DAWT and Relapsed FHWT
NCT04616560	Phase 2	RECRUITING	Trastuzumab Deruxtecan (DS-8201a) for the Treatment of Recurrent or Refractory Osteosarcoma, Wilms Tumor, and Desmoplastic Small Round Cell Tumor
NCT04791228	Phase 2	WITHDRAWN	A Pilot Study of Thermodox and MR-HIFU for Treatment of Relapsed Solid Tumors
NCT04968990	Phase 2	RECRUITING	Treatment of Newly Diagnosed Patient’s With Wilm’s Tumor Requiring Abdominal Radiation Delivered With Proton Beam Irradiation

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for CTR9 across ~30M SureChEMBL compounds — explore on Sugi Predict.