CTXN1

Summary

CTXN1 (cortexin 1, HGNC:31108) is a protein-coding gene on chromosome 19p13.2, encoding Cortexin-1 (P60606). May mediate extracellular or intracellular signaling of cortical neurons during forebrain development.

Predicted to be located in membrane.

Source: NCBI Gene 404217 — RefSeq curated summary.

At a glance

• Clinical variants (ClinVar): 11 total
• MANE Select transcript: NM_206833

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:31108
Approved symbol	CTXN1
Name	cortexin 1
Location	19p13.2
Locus type	gene with protein product
Status	Approved
Aliases	FLJ25968
Ensembl gene	ENSG00000178531
Ensembl biotype	protein_coding
OMIM	600135
Entrez	404217

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000318978

RefSeq mRNA: 1 — MANE Select: NM_206833 NM_206833

CCDS: CCDS12191

Canonical transcript exons

ENST00000318978 — 2 exons

Exon	Start	End
ENSE00001278829	7925967	7926135
ENSE00001278838	7924491	7925558

Expression profiles

Bgee: expression breadth ubiquitous, 162 present calls, max score 98.83.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 38.9989 / max 1296.6972, expressed in 1511 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
178921	36.0828	1506
178916	1.0099	469
178917	0.6797	266
178918	0.6240	305
178920	0.5267	256
178919	0.0758	23

Top tissues by expression

243 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
nucleus accumbens	UBERON:0001882	98.83	gold quality
putamen	UBERON:0001874	98.82	gold quality
anterior cingulate cortex	UBERON:0009835	98.58	gold quality
caudate nucleus	UBERON:0001873	98.35	gold quality
amygdala	UBERON:0001876	98.15	gold quality
right uterine tube	UBERON:0001302	97.99	gold quality
cortical plate	UBERON:0005343	97.51	gold quality
Brodmann (1909) area 9	UBERON:0013540	97.51	gold quality
right frontal lobe	UBERON:0002810	97.18	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	95.65	gold quality
hypothalamus	UBERON:0001898	94.81	gold quality
body of uterus	UBERON:0009853	93.54	gold quality
ganglionic eminence	UBERON:0004023	93.25	gold quality
Ammon’s horn	UBERON:0001954	92.41	gold quality
adenohypophysis	UBERON:0002196	92.37	gold quality
forebrain	UBERON:0001890	91.84	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	91.70	gold quality
muscle layer of sigmoid colon	UBERON:0035805	91.61	gold quality
pituitary gland	UBERON:0000007	91.21	gold quality
lower esophagus muscularis layer	UBERON:0035833	91.15	gold quality
lower esophagus	UBERON:0013473	91.05	gold quality
cerebral cortex	UBERON:0000956	90.79	gold quality
temporal lobe	UBERON:0001871	90.79	gold quality
ventricular zone	UBERON:0003053	90.11	gold quality
neocortex	UBERON:0001950	89.91	gold quality
frontal cortex	UBERON:0001870	88.30	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	87.95	gold quality
substantia nigra	UBERON:0002038	87.80	gold quality
brain	UBERON:0000955	87.41	gold quality
left uterine tube	UBERON:0001303	87.09	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-HCAD-38	yes	196.93
E-ANND-3	yes	6.74

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

34 targeting CTXN1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-548AN	99.97	70.91	2817
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-124-3P	99.89	73.74	3043
HSA-MIR-506-3P	99.89	73.55	3057
HSA-MIR-7845-5P	99.88	64.88	771
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-4739	99.84	65.25	1832
HSA-MIR-1321	99.84	65.30	1811
HSA-MIR-4756-5P	99.84	64.98	1809
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-149-3P	99.72	68.22	3963
HSA-MIR-6883-5P	99.69	68.05	3785
HSA-MIR-3202	99.66	67.70	2737
HSA-MIR-6132	99.60	65.83	1554
HSA-MIR-6836-5P	99.60	65.62	1538
HSA-MIR-7106-5P	99.53	67.47	3574
HSA-MIR-486-3P	99.51	66.82	1901
HSA-MIR-1207-5P	99.49	69.11	2983
HSA-MIR-4441	99.49	66.56	3216
HSA-MIR-208A-5P	99.42	70.83	1913
HSA-MIR-208B-5P	99.42	70.83	1952
HSA-MIR-7515	99.31	68.22	1795
HSA-MIR-4763-3P	99.10	67.83	2649
HSA-MIR-6846-5P	98.81	65.86	1121
HSA-MIR-6848-5P	98.81	65.49	1126
HSA-MIR-4755-3P	98.77	65.59	1915
HSA-MIR-3622A-5P	97.43	67.11	356
HSA-MIR-4475	97.36	66.95	761
HSA-MIR-1237-5P	95.38	62.21	451

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
danio_rerio	ctxn1	ENSDARG00000098284
danio_rerio	ctxn1	ENSDARG00000113270
mus_musculus	Ctxn1	ENSMUSG00000048644
rattus_norvegicus	Ctxn1	ENSRNOG00000073687

Paralogs (2): CTXN3 (ENSG00000205279), CTXN2 (ENSG00000233932)

Protein

Protein identifiers

Cortexin-1 — P60606 (reviewed: P60606)

All UniProt accessions (1): P60606

UniProt curated annotations — full annotation on UniProt →

Function. May mediate extracellular or intracellular signaling of cortical neurons during forebrain development.

Subcellular location. Membrane.

Similarity. Belongs to the cortexin family.

RefSeq proteins (1): NP_996664* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR020066	Cortexin	Family

Pfam: PF11057

UniProt features (3 total): chain 1, transmembrane region 1, region of interest 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P60606-F1	70.63	0.22

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 67 (showing top): CAGCTG_AP4_Q5, GTGCCTT_MIR506, DOUGLAS_BMI1_TARGETS_UP, FOXJ2_02, chr19p13, HEB_Q6, WIERENGA_STAT5A_TARGETS_UP, WIERENGA_STAT5A_TARGETS_GROUP1, PASINI_SUZ12_TARGETS_DN, LEE_BMP2_TARGETS_UP, YANG_BCL3_TARGETS_UP, ANDERSEN_CHOLANGIOCARCINOMA_CLASS1, CHARAFE_BREAST_CANCER_LUMINAL_VS_BASAL_UP, ZNF282_TARGET_GENES, MIR548AN

GO Biological Process (0):

GO Molecular Function (0):

GO Cellular Component (1): membrane (GO:0016020)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	1

Protein interactions and networks

STRING

658 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CTXN1	CAGE1	Q8TC20	620
CTXN1	SH2D5	Q6ZV89	501
CTXN1	SULT4A1	Q9BR01	490
CTXN1	FRRS1L	Q9P0K9	474
CTXN1	PROX2	Q3B8N5	437
CTXN1	PDZRN4	Q6ZMN7	436
CTXN1	FN3KRP	Q9HA64	428
CTXN1	DNAJC25	Q9H1X3	420
CTXN1	SYPL1	Q16563	413
CTXN1	OLFML1	Q6UWY5	412
CTXN1	ZMAT4	Q9H898	408
CTXN1	GPR151	Q8TDV0	386
CTXN1	DCTN4	Q9UJW0	385
CTXN1	BCR	P11274	364
CTXN1	NECAB1	Q8N987	351

IntAct

3 interactions, top by confidence:

A	B	Type	Score
CTXN1	ABCC4	psi-mi:“MI:0914”(association)	0.350
TMED2	SMPD2	psi-mi:“MI:0914”(association)	0.350

BioGRID (32): CLCN7 (Affinity Capture-MS), UGCG (Affinity Capture-MS), ANKLE2 (Affinity Capture-MS), NOTCH3 (Affinity Capture-MS), PLEKHH3 (Affinity Capture-MS), PKMYT1 (Affinity Capture-MS), ACVR2A (Affinity Capture-MS), GOLGA2 (Affinity Capture-MS), HEATR3 (Affinity Capture-MS), TOM1L1 (Affinity Capture-MS), ABCC4 (Affinity Capture-MS), ZDHHC13 (Affinity Capture-MS), GRAMD1A (Affinity Capture-MS), STEAP2 (Affinity Capture-MS), STARD3 (Affinity Capture-MS)

ESM2 similar proteins: A0A1B0GST9, A0A1B0GTU2, A0A1B0GV90, A0A590UK83, A2RRL7, A7S641, A8WG88, A9JTJ0, B9X187, K7EJ46, O00168, O08589, O13001, P0C2S0, P15383, P41237, P56513, P60606, P63160, P63161, Q04645, Q04646, Q04679, Q04680, Q0P467, Q28EH9, Q3SZX0, Q3UJ81, Q3URE8, Q3ZBP2, Q4LDR2, Q4R6L9, Q502I1, Q592E4, Q5XF36, Q6AXF6, Q6NWH5, Q6PBK8, Q6Q3F5, Q71RC9

Diamond homologs: A0A1B0GQX3, A0A1B0GST9, A0A1B0GTU2, A0A1B0GV90, P0C2S0, P41237, P60606, Q3URE8, Q4LDR2, Q8K129, Q592E4, Q8BXZ0

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

11 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	10
Likely benign	0
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

193 predictions. Top by Δscore:

Variant	Effect	Δscore
19:7925965:AC:A	donor_gain	1.0000
19:7925966:CC:C	donor_gain	1.0000
19:7925974:TCG:T	donor_gain	0.9900
19:7925965:A:AC	donor_gain	0.9700
19:7925966:C:CC	donor_gain	0.9700
19:7925960:C:A	donor_gain	0.9500
19:7925961:CCTCA:C	donor_loss	0.9500
19:7925962:CTCA:C	donor_loss	0.9500
19:7925963:TCA:T	donor_loss	0.9500
19:7925964:CACCC:C	donor_loss	0.9500
19:7925965:ACCCT:A	donor_loss	0.9500
19:7925976:G:GT	donor_gain	0.9500
19:7925760:A:C	donor_gain	0.9300
19:7925992:G:T	donor_gain	0.9200
19:7925557:CC:C	acceptor_gain	0.9000
19:7925558:CC:C	acceptor_gain	0.9000
19:7925742:C:CT	donor_gain	0.8900
19:7925555:CGCC:C	acceptor_gain	0.8800
19:7925743:C:CT	donor_gain	0.8800
19:7926016:CAGGG:C	donor_gain	0.8800
19:7926017:AGGGA:A	donor_gain	0.8800
19:7925995:C:CT	donor_gain	0.8700
19:7925713:C:CA	donor_gain	0.8600
19:7925559:C:CC	acceptor_gain	0.8400
19:7925714:C:A	donor_gain	0.8400
19:7925556:GCCCT:G	acceptor_loss	0.8300
19:7925558:CCTGC:C	acceptor_loss	0.8300
19:7925559:CTGCG:C	acceptor_loss	0.8300
19:7925560:T:A	acceptor_loss	0.8300
19:7925745:C:CT	donor_gain	0.8300

AlphaMissense

514 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
19:7925344:C:A	W65C	0.996
19:7925344:C:G	W65C	0.996
19:7925308:G:C	F77L	0.994
19:7925308:G:T	F77L	0.994
19:7925310:A:G	F77L	0.994
19:7925309:A:C	F77C	0.993
19:7925384:A:G	I52T	0.990
19:7925372:G:A	P56L	0.988
19:7925346:A:G	W65R	0.985
19:7925346:A:T	W65R	0.985
19:7925370:A:C	Y57D	0.985
19:7925373:G:A	P56S	0.985
19:7925372:G:T	P56H	0.983
19:7925381:A:G	L53P	0.983
19:7925381:A:T	L53Q	0.983
19:7925394:A:G	C49R	0.983
19:7925375:T:C	D55G	0.982
19:7925375:T:A	D55V	0.981
19:7925393:C:T	C49Y	0.981
19:7925402:A:C	M46R	0.980
19:7925430:A:G	C37R	0.980
19:7925370:A:T	Y57N	0.979
19:7925402:A:T	M46K	0.979
19:7925360:A:G	M60T	0.978
19:7925378:A:G	L54P	0.977
19:7925309:A:G	F77S	0.976
19:7925392:G:C	C49W	0.975
19:7925370:A:G	Y57H	0.974
19:7925426:A:C	L38R	0.974
19:7925381:A:C	L53R	0.972

dbSNP variants (sampled 300 via entrez): RS1000049686 (19:7925017 G>A), RS1000101642 (19:7924860 G>A), RS1001272650 (19:7924794 G>C), RS1001281718 (19:7924139 C>G,T), RS1001325037 (19:7924548 A>G), RS1001336384 (19:7924240 G>C), RS1002306758 (19:7925237 G>A,C,T), RS1002322596 (19:7925640 TGCCGCCGCC>T,TGCC,TGCCGCC,TGCCGCCGCCGCC,TGCCGCCGCCGCCGCC,TGCCGCCGCCGCCGCCGCC,TGCCGCCGCCGCCGCCGCCGCC), RS1002359099 (19:7925525 C>G,T), RS1003153415 (19:7927797 C>T), RS1004426765 (19:7927927 C>G,T), RS1006016638 (19:7926282 C>G), RS1006298137 (19:7924779 G>A), RS1006595977 (19:7925032 C>T), RS1007147732 (19:7926073 G>A,T)

Disease associations

OMIM: gene MIM:600135 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

0 associations (top):

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

25 total (human), top 25 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, affects cotreatment, increases abundance	3
Air Pollutants	decreases expression, increases abundance, increases expression	2
Cadmium Chloride	decreases expression, increases abundance	2
aristolochic acid I	decreases expression	1
methyleugenol	increases expression	1
pirinixic acid	affects binding, increases activity, increases expression	1
beta-lapachone	decreases expression	1
sulforaphane	decreases expression	1
cobaltous chloride	decreases expression	1
manganese chloride	decreases expression, increases abundance, affects cotreatment	1
abrine	decreases expression	1
2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine	decreases expression, increases response to substance	1
Acetaminophen	increases expression	1
Arsenic	affects cotreatment, decreases expression, increases abundance	1
Benzo(a)pyrene	increases expression	1
Cadmium	decreases expression, increases abundance	1
Lipopolysaccharides	affects expression, affects response to substance	1
Manganese	affects cotreatment, decreases expression, increases abundance	1
Mustard Gas	increases expression	1
Smoke	increases abundance, increases expression	1
Tobacco Smoke Pollution	decreases expression	1
Valproic Acid	increases methylation	1
Thapsigargin	decreases expression	1
Okadaic Acid	increases expression	1
Particulate Matter	decreases expression, increases abundance	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.