CYB5R3

Summary

CYB5R3 (cytochrome b5 reductase 3, HGNC:2873) is a protein-coding gene on chromosome 22q13.2, encoding NADH-cytochrome b5 reductase 3 (P00387). Catalyzes the reduction of two molecules of cytochrome b5 using NADH as the electron donor.

This gene encodes cytochrome b5 reductase, which includes a membrane-bound form in somatic cells (anchored in the endoplasmic reticulum, mitochondrial and other membranes) and a soluble form in erythrocytes. The membrane-bound form exists mainly on the cytoplasmic side of the endoplasmic reticulum and functions in desaturation and elongation of fatty acids, in cholesterol biosynthesis, and in drug metabolism. The erythrocyte form is located in a soluble fraction of circulating erythrocytes and is involved in methemoglobin reduction. The membrane-bound form has both membrane-binding and catalytic domains, while the soluble form has only the catalytic domain. Alternate splicing results in multiple transcript variants. Mutations in this gene cause methemoglobinemias.

Source: NCBI Gene 1727 — RefSeq curated summary.

At a glance

• Gene–disease (curated): methemoglobinemia due to deficiency of methemoglobin reductase (Definitive, ClinGen) — +2 more curated relationships
• GWAS associations: 1
• Clinical variants (ClinVar): 297 total — 23 pathogenic, 10 likely-pathogenic
• Phenotypes (HPO): 36
• Druggable target: yes
• MANE Select transcript: NM_000398

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2873
Approved symbol	CYB5R3
Name	cytochrome b5 reductase 3
Location	22q13.2
Locus type	gene with protein product
Status	Approved
Aliases	B5R
Ensembl gene	ENSG00000100243
Ensembl biotype	protein_coding
OMIM	613213
Entrez	1727

Gene structure

Transcript identifiers

Ensembl transcripts: 40 — 21 protein_coding, 11 retained_intron, 7 nonsense_mediated_decay, 1 protein_coding_CDS_not_defined

ENST00000352397, ENST00000361740, ENST00000402438, ENST00000407332, ENST00000407623, ENST00000438270, ENST00000466276, ENST00000470741, ENST00000684963, ENST00000685184, ENST00000686129, ENST00000686523, ENST00000687183, ENST00000687198, ENST00000688004, ENST00000688117, ENST00000688244, ENST00000689001, ENST00000689195, ENST00000689239, ENST00000689795, ENST00000690835, ENST00000690993, ENST00000691295, ENST00000691918, ENST00000692152, ENST00000692344, ENST00000693157, ENST00000693363, ENST00000693367, ENST00000693639, ENST00000693646, ENST00000693716, ENST00000897014, ENST00000897015, ENST00000897016, ENST00000897017, ENST00000897018, ENST00000897019, ENST00000966833

RefSeq mRNA: 5 — MANE Select: NM_000398 NM_000398, NM_001129819, NM_001171660, NM_001171661, NM_007326

CCDS: CCDS14040, CCDS33658, CCDS54535

Canonical transcript exons

ENST00000352397 — 9 exons

Exon	Start	End
ENSE00000656632	42631378	42631450
ENSE00001892790	42649295	42649392
ENSE00002307931	42617840	42619945
ENSE00003199477	42630882	42630988
ENSE00003467953	42628152	42628281
ENSE00003489064	42636715	42636846
ENSE00003594846	42627605	42627688
ENSE00003611593	42623789	42623888
ENSE00003635480	42627304	42627389

Expression profiles

Bgee: expression breadth ubiquitous, 294 present calls, max score 99.54.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 124.6718 / max 728.0471, expressed in 1824 samples.

FANTOM5 promoters (20 alternative TSS)

Promoter ID	TPM avg	Samples expressed
194465	102.8864	1822
194449	3.5743	1364
194447	3.4235	1369
194461	2.4182	327
194455	2.1230	1189
194458	2.1008	1176
194454	1.6922	1013
194466	1.0598	749
194464	1.0084	193
194453	0.8175	476

Top tissues by expression

295 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
right coronary artery	UBERON:0001625	99.54	gold quality
descending thoracic aorta	UBERON:0002345	99.54	gold quality
thoracic aorta	UBERON:0001515	99.50	gold quality
ascending aorta	UBERON:0001496	99.49	gold quality
saphenous vein	UBERON:0007318	99.48	gold quality
urethra	UBERON:0000057	99.46	gold quality
aorta	UBERON:0000947	99.44	gold quality
olfactory bulb	UBERON:0002264	99.44	gold quality
popliteal artery	UBERON:0002250	99.40	gold quality
tibial artery	UBERON:0007610	99.40	gold quality
skin of hip	UBERON:0001554	99.37	gold quality
coronary artery	UBERON:0001621	99.35	gold quality
left coronary artery	UBERON:0001626	99.33	gold quality
synovial joint	UBERON:0002217	99.33	gold quality
vena cava	UBERON:0004087	99.30	gold quality
stromal cell of endometrium	CL:0002255	99.22	gold quality
dorsal root ganglion	UBERON:0000044	99.21	gold quality
subcutaneous adipose tissue	UBERON:0002190	99.21	gold quality
pancreatic ductal cell	CL:0002079	99.19	gold quality
adipose tissue	UBERON:0001013	99.19	gold quality
layer of synovial tissue	UBERON:0007616	99.18	gold quality
right adrenal gland	UBERON:0001233	99.17	gold quality
apex of heart	UBERON:0002098	99.17	gold quality
nipple	UBERON:0002030	99.16	gold quality
seminal vesicle	UBERON:0000998	99.14	gold quality
cardia of stomach	UBERON:0001162	99.13	gold quality
right adrenal gland cortex	UBERON:0035827	99.13	gold quality
connective tissue	UBERON:0002384	99.11	gold quality
right atrium auricular region	UBERON:0006631	99.11	gold quality
adrenal cortex	UBERON:0001235	99.10	gold quality

Single-cell (SCXA)

Detected in 10 experiment(s), a significant marker in 8.

Experiment	Marker?	Max mean expression
E-GEOD-135922	yes	37.28
E-HCAD-1	yes	32.21
E-MTAB-8410	yes	11.82
E-MTAB-10042	yes	7.76
E-CURD-88	yes	7.38
E-MTAB-6678	yes	7.37
E-MTAB-7249	yes	4.82
E-MTAB-10137	no	4.54
E-CURD-112	no	3.52
E-ANND-3	no	0.00

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

69 targeting CYB5R3, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-6867-5P	100.00	82.21	3464
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-4283	100.00	66.42	2097
HSA-MIR-4533	100.00	69.48	2758
HSA-MIR-371B-5P	99.99	75.34	4759
HSA-MIR-373-5P	99.98	75.36	4753
HSA-MIR-616-5P	99.98	75.58	4775
HSA-MIR-6780A-5P	99.88	66.69	2776
HSA-MIR-4492	99.87	68.25	3611
HSA-MIR-4447	99.85	67.81	2900
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-6842-5P	99.80	67.54	1587
HSA-MIR-7110-5P	99.80	67.84	1712
HSA-MIR-1273H-5P	99.77	66.32	2471
HSA-MIR-4766-5P	99.75	69.23	2662
HSA-MIR-30B-3P	99.70	65.76	2325
HSA-MIR-3689A-3P	99.70	65.73	2306
HSA-MIR-3689B-3P	99.70	65.71	2311
HSA-MIR-3689C	99.70	65.71	2311
HSA-MIR-6779-5P	99.70	65.76	2363
HSA-MIR-1827	99.63	68.57	3265
HSA-MIR-3975	99.62	65.97	697
HSA-MIR-6752-5P	99.59	67.32	1243
HSA-MIR-762	99.58	66.61	1994
HSA-MIR-4472	99.56	66.08	1478
HSA-MIR-7106-5P	99.53	67.47	3574
HSA-MIR-4498	99.47	67.42	2360
HSA-MIR-6837-5P	99.25	65.47	1632

Literature-anchored findings (GeneRIF, showing 31)

• It was shown that Yakut patients have none of three missence mutations, Arg57Gln, Leu72Pro, and Val105Met, described in case of this disease in the neighboring populations, Chinese and Japanese, inhabiting the territories south of Yakutia (PMID:12884529)
• A decrease of the activity of membrane-bound NADH-methemoglobin reductase and a change of physical state of the lipid bilayer of membranes under oxidative stress were found in erythrocytes in vivo and in vitro. (PMID:15039026)
• Amino acid substitution results in congsenital methemoglobinemia. (PMID:15297856)
• crystal structure of cytochrome b(5) reductase (PMID:15502298)
• Recessive congenital methaemoglobinaemia observed in a Lebanese subject with a novel mutation in NADH-cytochrome b5 reductase gene. (PMID:15813912)
• A novel intronic mutation at 22163 caused markedly reduced mRNA (7% of normal) resulting in type II methemoglobinemia. (PMID:15921385)
• Dia1 is required for the formation of the actin coat around endosomes downstream of RhoB, connecting membrane trafficking with the regulation of actin dynamics. (PMID:15944396)
• DIA1 and IQGAP1 interact in cell migration and phagocytic cup formation. (PMID:17620407)
• report of the clinical and molecular characteristics of 6 new patients with recessive hereditary methemoglobinemia due to cytochrome b5 reductase deficiency; two new mutations of DIA1, c. 82 C>T(Gln27STOP) and c. 136 C>T(Arg45Trp), were found (PMID:18343696)
• The decline in the activities of G6PD and b5Rm would indicate a decrease in the antioxidant response associated with RBC aging. (PMID:19811411)
• novel cSNPs associated with significantly altered protein expression and/or hydroxylamine reduction activities, but only minimally impact overall observed phenotypic variability (PMID:19997042)
• Dia1 is localized to the perinuclear endoplasmic reticulum in an RNA-zipcode-independent manner in fibroblasts. (PMID:21266463)
• novel allelic mutation identified at codon 235 is in helix 5; first report of mental retardation because of the novel mutation, along with a second mutation in the NADH-b5R gene in an Indian family with recessive congenital methemoglobinemia Type II (PMID:21328435)
• CYB5R3 gene of three probands with type I methemoglobinemia and their relatives were sequenced revealing several putative causative mutations; in one subject multiple mutations were present (PMID:21349748)
• Dapsone-associated methemoglobinemia in a patient with slow NAT2*5B haplotype and impaired cytochrome b5 reductase activity (PMID:21422237)
• We conclude that Cytochrome b(5)and cytochrome b(5) reductase catalyze the reduction of arylhydroxylamines in breast tissue. (PMID:21447608)
• A comprehensive overview of the study of structure and function of human cytochrome b5 reductase. (PMID:23113554)
• Novel large deletion c.22-1320_633+1224del in the CYB5R3 gene from patients with hereditary methemoglobinemia (PMID:23297489)
• Data indicate that mitochondrial amidoxime reducing components 1 and 2 together with the electron transport proteins NADH-cytochrome b5 reductase (CYB5R) and cytochrome b5 (CYB5) catalyze the reduction of N-hydroxylated compounds such as amidoximes. (PMID:23703616)
• Population frequency and age of c.806C > T mutation in CYB5R3 gene as cause of recessive congenital methemoglobinemia in Yakutia. (PMID:23866629)
• NADH-CYB5R deficiency causes two forms of recessive congenital methemoglobinemia with cyanosis. (PMID:24266649)
• The results unveil a potential mechanism of action by which CYB5R3 deficiency contributes to the pathophysiological underpinnings of neurological disorders in RHM patients. (PMID:24450884)
• Variants in CYB5A and CYB5R3 should be considered in the evaluation of breast cancer risk in African American women. (PMID:25225034)
• Genetic variation in CYB5R3 is associated with methemoglobin levels in preterm infants receiving nitric oxide therapy. (PMID:25521918)
• CYB5R3 promotes colonization and metastasis formation and is a prognostic marker of disease-free and overall survival in estrogen receptor-negative breast cancer. (PMID:26351264)
• Data suggest that cytochrome b5 (CYB5) and cytochrome b5 reductase 3 (CYB5R3) can reduce human cytoglobin (CYGB) and zebrafish cytoglobins at rates up to 250-fold higher than those reported for the known physiological substrates, hemoglobin and myoglobin; the three proteins (CYB5+CYB5R3+CYGB) appear to constitute a metabolon involved in generation of nitric oxide. (PMID:28671819)
• study indicated that novel homozygous mutation p.Arg192Cys in CYB5R3 gene present in eight cases and the possibility of high prevalence of heterozygous in Indian population causing Type I recessive congenital methemoglobinemia. (PMID:29482478)
• Mutation update: Variants of the CYB5R3 gene in recessive congenital methemoglobinemia. (PMID:31898843)
• The CYB5R3(c) (.350C>G) and G6PD A alleles modify severity of anemia in malaria and sickle cell disease. (PMID:32697331)
• Three novel mutations in CYB5R3 gene causing NADH-cytochrome b5 reductase enzyme deficiency leads to recessive congenital methaemoglobinemia. (PMID:35064402)
• CYB5R3 T117S Genetic Mutation Is Associated With Major Adverse Cardiovascular and Cerebrovascular Events in Black Adults. (PMID:38353123)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	cyb5r3	ENSDARG00000005891
mus_musculus	Cyb5r3	ENSMUSG00000018042
rattus_norvegicus	Cyb5r3	ENSRNOG00000009592
drosophila_melanogaster	CG5946	FBGN0036211
caenorhabditis_elegans		WBGENE00020267
caenorhabditis_elegans		WBGENE00020268

Paralogs (5): CYB5R4 (ENSG00000065615), OXNAD1 (ENSG00000154814), CYB5R1 (ENSG00000159348), CYB5R2 (ENSG00000166394), CYB5RL (ENSG00000215883)

Protein

Protein identifiers

NADH-cytochrome b5 reductase 3 — P00387 (reviewed: P00387)

Alternative names: Diaphorase-1

All UniProt accessions (16): P00387, A0A8I5KNV1, A0A8I5KPU0, A0A8I5KR71, A0A8I5KTF9, A0A8I5KUA5, A0A8I5KVD2, A0A8I5KW26, A0A8I5KXI5, A0A8I5KYU1, A0A8I5QKL2, A0A8I5QKT9, A0A8I5QKX1, A0A8J8YWN6, A0A8J8Z3C6, B1AHF3

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the reduction of two molecules of cytochrome b5 using NADH as the electron donor.

Subunit / interactions. Component of a complex composed of cytochrome b5, NADH-cytochrome b5 reductase (CYB5R3) and MTARC2. Interacts with MTLN; the interaction is required to maintain cellular lipid composition and leads to stimulation of mitochondrial respiratory complex I activity.

Subcellular location. Endoplasmic reticulum membrane. Mitochondrion outer membrane Cytoplasm.

Tissue specificity. Expressed at late stages of erythroid maturation.

Disease relevance. Methemoglobinemia CYB5R3-related (METHB-CYB5R3) [MIM:250800] A form of methemoglobinemia, a hematologic disease characterized by the presence of excessive amounts of methemoglobin in blood cells, resulting in decreased oxygen carrying capacity of the blood, cyanosis and hypoxia. There are two types of methemoglobinemia CYB5R3-related. In type 1, the defect affects the soluble form of the enzyme, is restricted to red blood cells, and causes well-tolerated methemoglobinemia. In type 2, the defect affects both the soluble and microsomal forms of the enzyme and is thus generalized, affecting red cells, leukocytes and all body tissues. Type 2 methemoglobinemia is associated with mental deficiency and other neurologic symptoms. The disease is caused by variants affecting the gene represented in this entry.

Polymorphism. Ser-117 seems to only be found in persons of African origin. The allele frequency is 0.23 in African Americans. It was not found in Caucasians, Asians, Indo-Aryans, or Arabs. There seems to be no effect on the enzyme activity.

Similarity. Belongs to the flavoprotein pyridine nucleotide cytochrome reductase family.

Isoforms (3)

UniProt ID	Names	Canonical?
P00387-1	1, M	yes
P00387-2	2, S
P00387-3	3

RefSeq proteins (5): NP_000389, NP_001123291, NP_001165131, NP_001165132, NP_015565 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001433	OxRdtase_FAD/NAD-bd	Domain
IPR001709	Flavoprot_Pyr_Nucl_cyt_Rdtase	Domain
IPR001834	CBR-like	Family
IPR008333	Cbr1-like_FAD-bd_dom	Domain
IPR017927	FAD-bd_FR_type	Domain
IPR017938	Riboflavin_synthase-like_b-brl	Homologous_superfamily
IPR039261	FNR_nucleotide-bd	Homologous_superfamily

Pfam: PF00175, PF00970

Enzyme classification (BRENDA):

• EC 1.6.2.2 — cytochrome-b5 reductase (BRENDA: 34 organisms, 101 substrates, 111 inhibitors, 300 Km, 221 kcat entries)

Substrate kinetics (BRENDA)

23 substrates with measured Km, best-characterized 15. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
NADH	0.0002–3.32	94
FERRICYANIDE	0.0006–4.35	72
FERRICYTOCHROME B5	—	66
CYTOCHROME B5	0.0011–0.042	19
NADPH	0.001–7.69	17
FERROCYTOCHROME B5	0.001–0.107	6
FERRICYTOCHOME B5	0.01–0.013	4
FERRICYTOCHROME C	0.0003–0.007	3
OXIDIZED 2,6-DICHLOROPHENOLINDOPHENOL	0.328–0.83	2
1,4-NAPHTHOQUINONE	0.0098	1
2-HYDROXYESTRADIOL	0.0026	1
2-METHYL-1,4-NAPHTHOQUINONE	0.077	1
9,10-PHENANTHRENEQUINONE	0.0057	1
AQUACOBALAMIN	0.0419	1
BENZAMIDOXIME	0.63	1

Catalyzed reactions (Rhea), 1 shown:

• 2 Fe(III)-[cytochrome b5] + NADH = 2 Fe(II)-[cytochrome b5] + NAD(+) + H(+) (RHEA:46680)

UniProt features (83 total): strand 18, sequence variant 14, mutagenesis site 12, binding site 10, helix 10, sequence conflict 9, modified residue 3, splice variant 2, initiator methionine 1, chain 1, lipid moiety-binding region 1, domain 1, turn 1

Structure

Experimental structures (PDB)

5 structures.

PDB	Method	Resolution (Å)
1UMK	X-RAY DIFFRACTION	1.75
7TNV	X-RAY DIFFRACTION	1.93
7TSW	X-RAY DIFFRACTION	2.4
7W3O	X-RAY DIFFRACTION	2.46
7THG	X-RAY DIFFRACTION	2.9

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P00387-F1	93.90	0.89

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (10): 127; 128; 185; 92; 93; 94; 109; 111; 114; 126

Post-translational modifications (4): 42, 43, 120, 2

Mutagenesis-validated functional residues (12):

Position	Phenotype
128	decreased nadh-cytochrome b5 reductase activity, highly increases km for nadh and decreases kcat.
204	no effect on nadh-cytochrome b5 reductase activity.
274	loss of 30% of nadh-cytochrome b5 reductase activity.
274	loss of 80% of nadh-cytochrome b5 reductase activity.
274	no effect on nadh-cytochrome b5 reductase activity.
284	no effect on nadh-cytochrome b5 reductase activity.
298	no effect on nadh-cytochrome b5 reductase activity.
299–301	no effect on protein stability and nadh-cytochrome b5 reductase activity.
299	decreases protein stability and slightly decreases nadh-cytochrome b5 reductase activity.
299	no effect on protein stability and nadh-cytochrome b5 reductase activity.
301	decreases protein stability and slightly decreases nadh-cytochrome b5 reductase activity.
301	no effect on protein stability and nadh-cytochrome b5 reductase activity.

Function

Pathways and Gene Ontology

Reactome pathways

9 pathways

ID	Pathway
R-HSA-196836	Vitamin C (ascorbate) metabolism
R-HSA-211945	Phase I - Functionalization of compounds
R-HSA-6798695	Neutrophil degranulation
R-HSA-1430728	Metabolism
R-HSA-168249	Innate Immune System
R-HSA-168256	Immune System
R-HSA-196849	Metabolism of water-soluble vitamins and cofactors
R-HSA-196854	Metabolism of vitamins and cofactors
R-HSA-211859	Biological oxidations

MSigDB gene sets: 268 (showing top): MODULE_93, REACTOME_BIOLOGICAL_OXIDATIONS, REACTOME_INNATE_IMMUNE_SYSTEM, GOBP_CIRCULATORY_SYSTEM_PROCESS, GOCC_SECRETORY_GRANULE, HSIAO_HOUSEKEEPING_GENES, MCBRYAN_PUBERTAL_TGFB1_TARGETS_UP, GOBP_SMALL_MOLECULE_BIOSYNTHETIC_PROCESS, MILI_PSEUDOPODIA_HAPTOTAXIS_UP, GOBP_REACTIVE_NITROGEN_SPECIES_METABOLIC_PROCESS, MCBRYAN_PUBERTAL_BREAST_3_4WK_UP, GOBP_STEROID_BIOSYNTHETIC_PROCESS, GOCC_MITOCHONDRIAL_ENVELOPE, GOBP_LIPID_METABOLIC_PROCESS, SANSOM_APC_TARGETS_DN

GO Biological Process (8): cholesterol biosynthetic process (GO:0006695), nitric oxide biosynthetic process (GO:0006809), blood circulation (GO:0008015), lipid metabolic process (GO:0006629), steroid biosynthetic process (GO:0006694), steroid metabolic process (GO:0008202), cholesterol metabolic process (GO:0008203), sterol biosynthetic process (GO:0016126)

GO Molecular Function (6): cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128), FAD binding (GO:0071949), cytochrome-b5 reductase activity, acting on NADH (GO:0090524), protein binding (GO:0005515), oxidoreductase activity (GO:0016491), nitrite reductase (NO-forming) activity (GO:0050421)

GO Cellular Component (18): extracellular region (GO:0005576), cytoplasm (GO:0005737), mitochondrion (GO:0005739), mitochondrial outer membrane (GO:0005741), endoplasmic reticulum (GO:0005783), endoplasmic reticulum membrane (GO:0005789), lipid droplet (GO:0005811), cytosol (GO:0005829), hemoglobin complex (GO:0005833), membrane (GO:0016020), mitochondrial membrane (GO:0031966), perinuclear theca (GO:0033011), azurophil granule lumen (GO:0035578), sperm midpiece (GO:0097225), sperm principal piece (GO:0097228), sperm head-tail coupling apparatus (GO:0120212), sperm glycocalyx (GO:0120238), nitric-oxide synthase complex (GO:1903958)

Reactome top-level categories

Rollup of top-6 pathways:

Category	Pathways
Metabolism	2
Metabolism of water-soluble vitamins and cofactors	1
Biological oxidations	1
Innate Immune System	1
Immune System	1
Metabolism of vitamins and cofactors	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	7
cytoplasm	3
sterol metabolic process	2
intracellular membrane-bounded organelle	2
organelle membrane	2
sperm flagellum	2
cholesterol metabolic process	1
sterol biosynthetic process	1
secondary alcohol biosynthetic process	1
biosynthetic process	1
nitric oxide metabolic process	1
circulatory system process	1
primary metabolic process	1
steroid metabolic process	1
lipid biosynthetic process	1
lipid metabolic process	1
secondary alcohol metabolic process	1
steroid biosynthetic process	1
oxidoreductase activity, acting on NAD(P)H, heme protein as acceptor	1
flavin adenine dinucleotide binding	1
cytochrome-b5 reductase activity, acting on NAD(P)H	1
binding	1
catalytic activity	1
oxidoreductase activity, acting on other nitrogenous compounds as donors, cytochrome as acceptor	1
nitrite reductase activity	1
intracellular anatomical structure	1
mitochondrial membrane	1
organelle outer membrane	1
endomembrane system	1
nuclear outer membrane-endoplasmic reticulum membrane network	1
endoplasmic reticulum subcompartment	1
intracellular membraneless organelle	1
cytosol	1
protein-containing complex	1
mitochondrion	1
mitochondrial envelope	1
cytoskeleton	1
perinuclear region of cytoplasm	1
vacuolar lumen	1
secretory granule lumen	1

Protein interactions and networks

STRING

2012 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
CYB5R3	CYB5A	P00167	999
CYB5R3	CYB5B	O43169	993
CYB5R3	SCD	O00767	810
CYB5R3	CYP51A1	Q16850	777
CYB5R3	ARSA	P15289	774
CYB5R3	POR	P16435	663
CYB5R3	ACKR5	O15218	652
CYB5R3	HBA1	P01922	641
CYB5R3	NOS3	P29474	530
CYB5R3	SUOX	P51687	504
CYB5R3	HBB	P02023	476
CYB5R3	TK2	O00142	465
CYB5R3	DHODH	Q02127	462
CYB5R3	MCAT	Q8IVS2	452
CYB5R3	CYCS	P00001	452

IntAct

288 interactions, top by confidence:

A	B	Type	Score
CYB5R3	STOM	psi-mi:“MI:0915”(physical association)	0.670
CYB5R3	FUNDC2	psi-mi:“MI:0915”(physical association)	0.670
CANX	CYB5R3	psi-mi:“MI:0915”(physical association)	0.560
TMEM14C	CYB5R3	psi-mi:“MI:0915”(physical association)	0.560
CYB5R3	AQP6	psi-mi:“MI:0915”(physical association)	0.560
CYB5R3	ELOVL4	psi-mi:“MI:0915”(physical association)	0.560
ADAM33	CYB5R3	psi-mi:“MI:0915”(physical association)	0.560
CDIPT	CYB5R3	psi-mi:“MI:0915”(physical association)	0.560
CYB5R3	SLC10A6	psi-mi:“MI:0915”(physical association)	0.560
VAMP1	CYB5R3	psi-mi:“MI:0915”(physical association)	0.560
CYB5R3	TMEM51	psi-mi:“MI:0915”(physical association)	0.560
CYB5R3	HSD17B13	psi-mi:“MI:0915”(physical association)	0.560
ZDHHC15	CYB5R3	psi-mi:“MI:0915”(physical association)	0.560
	CYB5R3	psi-mi:“MI:0915”(physical association)	0.560
CYB5R3	CERS4	psi-mi:“MI:0915”(physical association)	0.560
CYB5R3	FAM210B	psi-mi:“MI:0915”(physical association)	0.560
CYB5R3	AIG1	psi-mi:“MI:0915”(physical association)	0.560
CYB5R3	LAPTM5	psi-mi:“MI:0915”(physical association)	0.560
CYB5R3	TMEM115	psi-mi:“MI:0915”(physical association)	0.560
CYB5R3	CSGALNACT2	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (415): CYB5R3 (Affinity Capture-RNA), CYB5R3 (Affinity Capture-RNA), CYB5R3 (Affinity Capture-RNA), CYB5R3 (Affinity Capture-MS), CYB5R3 (Affinity Capture-MS), CYB5R3 (Affinity Capture-MS), CYB5R3 (Affinity Capture-MS), CYB5R3 (Affinity Capture-MS), CYB5R3 (Affinity Capture-MS), CYB5R3 (Affinity Capture-MS), ATP5F1 (Co-fractionation), CYB5R3 (Co-fractionation), CYB5R3 (Synthetic Growth Defect), CYB5R3 (Proximity Label-MS), CYB5R3 (Proximity Label-MS)

ESM2 similar proteins: A1C7E9, A1DHW1, A2QCV4, A3GF86, A4QR21, A4R935, A5DQ25, A5DQE4, A5E7U2, A6R2K7, A6ZVM6, A7THS1, A7TNL7, B0CQN7, O74557, P00387, P07514, P0CP14, P0CP15, P20070, P37040, P38626, P83291, Q0CY37, Q0P487, Q0UEY4, Q0X0E5, Q1DWN4, Q27597, Q2UFN3, Q4PGW7, Q4X0B5, Q54NC1, Q59P03, Q5AZB4, Q5BJ68, Q5PQA4, Q6BQ54, Q6BUX2, Q6CA86

Diamond homologs: A0A286R227, A1C7E9, A1DHW1, A2QCV4, A3GF86, A3LT66, A4QR21, A4R935, A5DQ25, A5E7U2, A6R2K7, A6ZVM6, A7TNL7, B0CQN7, O74557, P00387, P07514, P07850, P08509, P08619, P0CP14, P0CP15, P11035, P11605, P11832, P16081, P17569, P17570, P17571, P20070, P22945, P23312, P27783, P27967, P27968, P27969, P36841, P36842, P36858, P36859

SIGNOR signaling

0 interactions.

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 102 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

GO biological processes:

GO term	Partners	Fold	FDR
mitochondrial electron transport, NADH to ubiquinone	5	19.7×	3e-03
proton motive force-driven mitochondrial ATP synthesis	5	14.5×	8e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

297 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	23
Likely pathogenic	10
Uncertain significance	115
Likely benign	68
Benign	46

Top pathogenic / likely-pathogenic (30)

Variant ID	HGVS	Classification
1458058	NM_000398.7(CYB5R3):c.706del (p.Trp236fs)	Pathogenic
1694454	NM_000398.7(CYB5R3):c.708G>A (p.Trp236Ter)	Pathogenic
234	NM_000398.7(CYB5R3):c.382T>C (p.Ser128Pro)	Pathogenic
236	NM_000398.7(CYB5R3):c.446T>C (p.Leu149Pro)	Pathogenic
238	NM_000398.7(CYB5R3):c.734-1G>T	Pathogenic
239	NM_000398.7(CYB5R3):c.463+8G>C	Pathogenic
240	NM_000398.7(CYB5R3):c.655C>T (p.Arg219Ter)	Pathogenic
241	NM_000398.7(CYB5R3):c.610T>C (p.Cys204Arg)	Pathogenic
242	NM_000398.7(CYB5R3):c.817_819del (p.Met273del)	Pathogenic
2423026	NC_000022.10:g.(?43015779)(43015971_?)del	Pathogenic
2423027	NC_000022.10:g.(?43015779)(43024307_?)del	Pathogenic
243	NM_000398.7(CYB5R3):c.895_897del (p.Phe299del)	Pathogenic
247	NM_000398.7(CYB5R3):c.229C>T (p.Gln77Ter)	Pathogenic
248	NM_000398.7(CYB5R3):c.478C>T (p.Arg160Ter)	Pathogenic
249	NM_000398.7(CYB5R3):c.611G>A (p.Cys204Tyr)	Pathogenic
3624442	NM_000398.7(CYB5R3):c.403C>T (p.Gln135Ter)	Pathogenic
4291975	NM_000398.7(CYB5R3):c.244_245del (p.Ser82fs)	Pathogenic
431812	NM_000398.7(CYB5R3):c.250C>T (p.Arg84Ter)	Pathogenic
4531856	NM_000398.7(CYB5R3):c.226G>A (p.Gly76Ser)	Pathogenic
4531857	NM_000398.7(CYB5R3):c.173G>C (p.Arg58Pro)	Pathogenic
801428	NM_000398.7(CYB5R3):c.226+2T>C	Pathogenic
827632	NM_000398.7(CYB5R3):c.103A>C (p.Thr35Pro)	Pathogenic
827633	NM_000398.7(CYB5R3):c.190C>G (p.Leu64Val)	Pathogenic
1174130	NM_000398.7(CYB5R3):c.830dup (p.Pro278fs)	Likely pathogenic
1502415	NM_000398.7(CYB5R3):c.547+1G>A	Likely pathogenic
235	NM_000398.7(CYB5R3):c.173G>A (p.Arg58Gln)	Likely pathogenic
2430191	NM_000398.7(CYB5R3):c.274C>T (p.Arg92Trp)	Likely pathogenic
251	NM_000398.7(CYB5R3):c.763GAG[1] (p.Glu256del)	Likely pathogenic
2664646	NM_000398.7(CYB5R3):c.508A>G (p.Arg170Gly)	Likely pathogenic
3906148	NC_000022.11:g.42631838_42638363delins[GTAATCCCAGCAA;42592521_42635366inv;AAGAGTGGGTGGATCACCTGAGGTCAGGAGTGCTAAAC]	Likely pathogenic

SpliceAI

2089 predictions. Top by Δscore:

Variant	Effect	Δscore
22:42619941:CCAGG:C	acceptor_gain	1.0000
22:42619942:CAGG:C	acceptor_gain	1.0000
22:42619942:CAGGC:C	acceptor_gain	1.0000
22:42619944:GGC:G	acceptor_loss	1.0000
22:42619945:GC:G	acceptor_loss	1.0000
22:42619946:C:CC	acceptor_gain	1.0000
22:42619946:C:T	acceptor_loss	1.0000
22:42623785:TCACC:T	donor_loss	1.0000
22:42623786:CACCT:C	donor_loss	1.0000
22:42623787:A:AC	donor_gain	1.0000
22:42623788:C:CC	donor_gain	1.0000
22:42623788:CCTT:C	donor_gain	1.0000
22:42623885:CGGT:C	acceptor_gain	1.0000
22:42623886:GGT:G	acceptor_gain	1.0000
22:42623889:C:CC	acceptor_gain	1.0000
22:42623890:T:A	acceptor_loss	1.0000
22:42628195:A:AC	donor_gain	1.0000
22:42628283:T:G	acceptor_loss	1.0000
22:42630878:T:TA	donor_gain	1.0000
22:42630878:TCACC:T	donor_loss	1.0000
22:42630879:CACCT:C	donor_loss	1.0000
22:42630880:ACCT:A	donor_loss	1.0000
22:42630881:CCTT:C	donor_loss	1.0000
22:42630884:TGATG:T	donor_gain	1.0000
22:42630984:CTGGC:C	acceptor_gain	1.0000
22:42630985:TGGC:T	acceptor_gain	1.0000
22:42630987:GC:G	acceptor_gain	1.0000
22:42630987:GCCT:G	acceptor_loss	1.0000
22:42630988:CC:C	acceptor_gain	1.0000
22:42630988:CCT:C	acceptor_loss	1.0000

AlphaMissense

1980 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
22:42628232:G:A	S128F	0.996
22:42630892:A:G	L108P	0.995
22:42628185:C:G	G144R	0.994
22:42628187:C:G	R143P	0.994
22:42628252:A:C	F121L	0.994
22:42628252:A:T	F121L	0.994
22:42628254:A:G	F121L	0.994
22:42630882:C:A	K111N	0.994
22:42630882:C:G	K111N	0.994
22:42619776:G:C	F301L	0.993
22:42619776:G:T	F301L	0.993
22:42619778:A:G	F301L	0.993
22:42631419:A:G	F62S	0.993
22:42631422:C:G	R61P	0.993
22:42628184:C:T	G144D	0.992
22:42630928:G:T	P96H	0.992
22:42627320:A:G	L206P	0.991
22:42631425:A:G	F60S	0.991
22:42631431:C:G	R58P	0.991
22:42619859:A:G	C274R	0.990
22:42627311:G:T	A209D	0.990
22:42627389:C:T	G183D	0.990
22:42627616:G:T	A179E	0.990
22:42628175:C:T	G147E	0.990
22:42631386:A:G	L73P	0.990
22:42628232:G:T	S128Y	0.989
22:42630935:A:G	Y94H	0.989
22:42630973:A:G	L81P	0.989
22:42630988:C:T	G76D	0.989
22:42619827:G:C	C284W	0.988

dbSNP variants (sampled 300 via entrez): RS1000045604 (22:42644305 G>A,T), RS1000182000 (22:42622199 C>A,T), RS1000267007 (22:42629168 T>C), RS1000331267 (22:42634613 A>C,G), RS1000376010 (22:42635958 T>A), RS1000388107 (22:42650737 C>A,G,T), RS1000458762 (22:42650562 G>T), RS1000476358 (22:42626497 T>A), RS1000506509 (22:42645520 G>A,C), RS1000720378 (22:42640095 A>G), RS1000722480 (22:42635023 G>A), RS1000743071 (22:42649401 G>A,T), RS1000773019 (22:42640348 C>A,T), RS1000862138 (22:42617638 G>A,C), RS1000869830 (22:42622247 A>G)

Disease associations

OMIM: gene MIM:613213 | disease phenotypes: MIM:250800, MIM:117000

GenCC curated gene-disease

Disease	Classification	Inheritance
methemoglobinemia	Definitive	Autosomal recessive
methemoglobinemia due to deficiency of methemoglobin reductase	Strong	Autosomal recessive
hereditary methemoglobinemia	Supportive	Autosomal recessive

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
methemoglobinemia due to deficiency of methemoglobin reductase	Definitive	AR

Mondo (5): methemoglobinemia due to deficiency of methemoglobin reductase (MONDO:0009606), central core myopathy (MONDO:0007294), hereditary methemoglobinemia (MONDO:0018963), intellectual disability (MONDO:0001071), methemoglobinemia (MONDO:0001117)

Orphanet (3): Autosomal recessive methemoglobinemia (Orphanet:621), Central core disease (Orphanet:597), NON RARE IN EUROPE: Unexplained intellectual disability (Orphanet:319658)

HPO phenotypes

36 total (30 of 36 shown, HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000252	Microcephaly
HP:0000486	Strabismus
HP:0000565	Esotropia
HP:0000592	Blue sclerae
HP:0000707	Abnormality of the nervous system
HP:0000961	Cyanosis
HP:0001249	Intellectual disability
HP:0001250	Seizure
HP:0001257	Spasticity
HP:0001263	Global developmental delay
HP:0001272	Cerebellar atrophy
HP:0001276	Hypertonia
HP:0001337	Tremor
HP:0001510	Growth delay
HP:0001518	Small for gestational age
HP:0001597	Abnormal nail morphology
HP:0001901	Polycythemia
HP:0002179	Opisthotonus
HP:0002283	Global brain atrophy
HP:0002305	Athetosis
HP:0002315	Headache
HP:0002451	Limb dystonia
HP:0002510	Spastic tetraplegia
HP:0002875	Exertional dyspnea
HP:0006808	Cerebral hypomyelination
HP:0006913	Frontal cortical atrophy
HP:0007112	Temporal cortical atrophy
HP:0010864	Severe intellectual disability
HP:0011344	Severe global developmental delay

GWAS associations

1 associations (top):

Study	Trait	p-value
GCST005023_31	Initial pursuit acceleration	8.000000e-10

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0008434	initial pursuit acceleration

MeSH disease descriptors (4)

Descriptor	Name	Tree numbers
D008607	Intellectual Disability	C10.597.606.360; C23.888.592.604.646; F01.700.687; F03.625.539
D008708	Methemoglobinemia	C15.378.619
D020512	Myopathy, Central Core	C05.651.575.300; C10.668.491.550.300
C580280	Congenital Methemoglobinemia (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL2146 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB variants

4 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs7284807	CYB5R3		0.00	0
rs8190370	CYB5R3		0.00	0
rs76458556	CYB5R3		0.00	0
rs77499608	CYB5R3		0.00	0

CTD chemical–gene interactions

62 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	affects expression, decreases expression, increases expression	3
sodium arsenite	affects expression, increases expression	3
Valproic Acid	affects cotreatment, increases expression, affects expression, increases methylation	3
Benzo(a)pyrene	affects methylation, increases methylation	2
NAD	affects binding, affects cotreatment, increases reduction	2
Tetrachlorodibenzodioxin	increases expression	2
Particulate Matter	affects cotreatment, increases abundance, increases expression, decreases expression	2
aristolochic acid I	decreases expression	1
bisphenol F	affects cotreatment, increases expression	1
2,4,6-tribromophenol	decreases expression	1
N(4)-hydroxycytidine	affects cotreatment, increases reduction	1
decabromobiphenyl ether	decreases expression	1
beta-lapachone	increases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
N(4)-hydroxycytosine	increases reduction, affects cotreatment	1
ochratoxin A	decreases expression	1
ciglitazone	affects binding, increases expression	1
benzamidoxime	affects cotreatment, increases reduction	1
sulfamethoxazole hydroxylamine	affects cotreatment, increases reduction	1
CGP 52608	affects binding, increases reaction	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
nutlin 3	affects cotreatment, increases secretion	1
ICG 001	increases expression	1
bisphenol B	increases expression	1
abrine	decreases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	decreases expression	1
pentabrominated diphenyl ether 100	decreases expression	1
hexabrominated diphenyl ether 153	decreases expression	1
LDN 193189	affects cotreatment, increases expression	1
(+)-JQ1 compound	increases expression	1

ChEMBL screening assays

18 unique, capped per target: 18 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL4482745	Binding	Inhibition of N-terminal His6-tagged human Cyb5R3 expressed in Escherichia coli SoluBL21 assessed as reduction in NADH-ferricyanide reductase activity at 500 uM pre-incubated for 15 mins before addition of NADH and potassium ferricyanide by	Targeting cyb5r3

Cellosaurus cell lines

3 cell lines: 3 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_D1M6	Abcam K-562 CYB5R3 KO	Cancer cell line	Female
CVCL_D2IR	Abcam Raji CYB5R3 KO	Cancer cell line	Male
CVCL_UQ38	Abcam Jurkat CYB5R3 KO	Cancer cell line	Male

Clinical trials (associated diseases)

208 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT05657860	PHASE4	COMPLETED	Guanfacine Extended Release for the Reduction of Aggression and Self-injurious Behavior Associated With Prader-Willi Syndrome
NCT05744479	PHASE4	RECRUITING	Metformin for Antipsychotic-induced Weight Gain in Adults With Intellectual Disability
NCT06107829	PHASE4	WITHDRAWN	Valbenazine Treatment of Tardive Dyskinesia in Adults With Intellectual/Developmental Disabilities
NCT06997198	PHASE4	NOT_YET_RECRUITING	Deutetrabenazine Treatment for Tardive Dyskinesia in Intellectual/Developmental Disabilities
NCT02270736	PHASE3	COMPLETED	Clinical Study to Investigate the Efficacy and Safety of NT 201 Compared to Placebo in the Treatment of Chronic Troublesome Drooling Associated With Neurological Disorders and/or Intellectual Disability
NCT02304302	PHASE2	COMPLETED	Down Syndrome Memantine Follow-up Study
NCT03862950	PHASE2	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome (Met)
NCT04529226	PHASE2	UNKNOWN	Study to Compare Clozapine vs Treatment as Usual in People With Intellectual Disability & Treatment-resistant Psychosis
NCT04821856	PHASE2	COMPLETED	Evaluation of the Effectiveness of Cannabidiol in Treating Severe Behavioural Problems in Children and Adolescents With Intellectual Disability
NCT02478281	PHASE1	COMPLETED	Safety, Tolerability, and Pharmacokinetic Study of Methylene Blue Following a 1 mg/kg Intravenous Dose in Healthy Adults
NCT02493283	PHASE1	COMPLETED	Pharmacokinetics and Distribution of Dapsone in Leucocytes After Single-dose and Multiple-dose Administration
NCT05273320	PHASE1	COMPLETED	Clinical Trial of Nabilone for Aggression in Adults With Intellectual and Developmental Disabilities
NCT05301361	PHASE1	ENROLLING_BY_INVITATION	Sensitivity of the NIH Toolbox to Stimulant Treatment in Intellectual Disabilities
NCT06016764	PHASE1	COMPLETED	Use of MRI and cTBS for Catatonia in Autism
NCT06586827	PHASE1	COMPLETED	Impact of Competency-Based Training and Technical Assistance Employment Outcomes of Individuals With ID/DD
NCT07531940	PHASE1	NOT_YET_RECRUITING	Escalating Doses of Memantine in Down Syndrome (MEDS-123)
NCT00993694	Not specified	COMPLETED	Methemoglobinemia in Young Patients With Hematologic Cancer or Aplastic Anemia Treated With Dapsone
NCT01402869	Not specified	COMPLETED	Methemoglobin Levels in Generally Anesthetized Pediatric Dental Patients Receiving Local Anesthetics
NCT01766999	Not specified	COMPLETED	Methemoglobinemia After Liposuction - Diagnostic by Pulse Oximetry and Blood Gas Analysis.
NCT03542760	Not specified	COMPLETED	Acquired Methemoglobinemia Observational Registry
NCT06309641	Not specified	COMPLETED	Methemoglobinemia Following Intravenous Iron Treatment
NCT06958822	Not specified	COMPLETED	Ferric Carboxymaltose Methemoglobinemia Study
NCT00272883	Not specified	RECRUITING	Molecular and Genetic Studies of Congenital Myopathies
NCT06157268	Not specified	RECRUITING	The Natural History and Muscle Fatigability of Patients With Congenital Myopathies.
NCT06791369	Not specified	NOT_YET_RECRUITING	The Prevalence of RYR1-related Disease
NCT03479476	PHASE2/PHASE3	COMPLETED	A Trial of Metformin in Individuals With Fragile X Syndrome
NCT02616796	PHASE1/PHASE2	COMPLETED	Effects of Social Gaze Training on Brain and Behavior in Fragile X Syndrome
NCT06860672	EARLY_PHASE1	RECRUITING	Clinical Trial of the Dual Vector Base Editor for the Treatment of the CHD3-R1025W Mutation
NCT00597948	Not specified	COMPLETED	Healthy Lifestyles for People With Intellectual Disabilities
NCT01087320	Not specified	RECRUITING	Genome Medical Sequencing for Gene Discovery
NCT01652963	Not specified	UNKNOWN	Picture-based Computerised Assessment and Training of Cognitive Behaviour Therapy Skills
NCT01695395	Not specified	COMPLETED	Mental Health Care Provision for Adults With Intellectual Disability and a Mental Disorder
NCT01867554	Not specified	COMPLETED	Research and Characterization of New Genes Involved in Intellectual Disability
NCT01915381	Not specified	COMPLETED	Improving Adherence Healthy Lifestyle With a Smartphone Application Based on Adults With Intellectual Disabilities
NCT01988623	Not specified	COMPLETED	Pivotal Response Treatment for Individuals With Intellectual Disabilities
NCT02099773	Not specified	COMPLETED	Support Staff-client Interactions With Augmentative and Alternative Communication
NCT02136849	Not specified	COMPLETED	Inter-regional Project of the Great Western Exploration Approach for Exome Molecular Causes Severe Intellectual Disability Isolated or Syndromic
NCT02225041	Not specified	COMPLETED	Sedation Strategy and Cognitive Outcome After Critical Illness in Early Childhood
NCT02414438	Not specified	COMPLETED	Establishing the Clinical Utility of First StepDx PLUS and NextStepDx PLUS Study
NCT02451761	Not specified	COMPLETED	Apparently Balanced Chromosomal Translocation/ Next-generation Sequencing/ Intellectual Disability