DACT2

Summary

DACT2 (dishevelled binding antagonist of beta catenin 2, HGNC:21231) is a protein-coding gene on chromosome 6q27, encoding Dapper homolog 2 (Q5SW24). Involved in regulation of intracellular signaling pathways during development.

Predicted to enable several functions, including beta-catenin binding activity; delta-catenin binding activity; and protein kinase C binding activity. Predicted to be involved in several processes, including epithelial cell morphogenesis; inner medullary collecting duct development; and negative regulation of nodal signaling pathway. Predicted to act upstream of or within hematopoietic progenitor cell differentiation. Predicted to be active in cytoplasm.

Source: NCBI Gene 168002 — automated summary from GO annotations (Alliance of Genome Resources).

At a glance

• GWAS associations: 4
• Clinical variants (ClinVar): 178 total — 3 pathogenic
• GTEx eGene: eQTL in 26 tissues, sQTL in 1 (q < 0.05)
• Constraint (gnomAD): pLI 0.00 (LoF-tolerant), LOEUF 1.47 (unconstrained)
• MANE Select transcript: NM_214462
• Notable: 178 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:21231
Approved symbol	DACT2
Name	dishevelled binding antagonist of beta catenin 2
Location	6q27
Locus type	gene with protein product
Status	Approved
Aliases	bA503C24.7, DAPPER2
Ensembl gene	ENSG00000164488
Ensembl biotype	protein_coding
OMIM	608966
Entrez	168002

Gene structure

Transcript identifiers

Ensembl transcripts: 5 — 5 protein_coding

MANE Select: ENST00000366795

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 3, TSL 2: 1

ENST00000366795, ENST00000366796, ENST00000607983, ENST00000610183, ENST00001140441

RefSeq mRNA: 3 — MANE Select: NM_214462 NM_001286350, NM_001286351, NM_214462

CCDS: CCDS47519, CCDS69241, CCDS75554

Canonical transcript exons

ENST00000366795 — 4 exons

Exon	Start	End
ENSE00001084726	168310168	168310446
ENSE00001356933	168311152	168311284
ENSE00001356939	168319388	168319777
ENSE00001442635	168306904	168309098

Expression profiles

Bgee: expression breadth ubiquitous, 149 present calls, max score 89.05.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.2754 / max 45.0437, expressed in 123 samples.

Highest expression (Bgee): placenta, male germ line stem cell (sensu Vertebrata) in testis, putamen, nucleus accumbens, caudate nucleus.

Genetic regulation across tissues (GTEx eQTL / sQTL)

DACT2 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 26 tissues and its splicing (sQTL) in 1 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 27 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Pancreas	eqtl	1.2e-55	-1.08	6:168322866:T:C
Liver	eqtl	5.9e-19	-0.72	6:168320006:A:AG
Testis	eqtl	1.1e-18	-0.50	6:168325930:C:G
Skin Sun Exposed Lower leg	eqtl	1.2e-10	+0.23	6:168329434:C:T
Esophagus Mucosa	eqtl	5.0e-10	+0.44	6:168216489:G:A
Esophagus Muscularis	eqtl	8.0e-10	-0.30	6:168320541:G:A
Brain Cortex	eqtl	3.7e-09	-0.56	6:168328272:C:G
Artery Aorta	eqtl	4.5e-08	+0.35	6:168326094:G:A
Skin Not Sun Exposed Suprapubic	eqtl	2.4e-06	+0.20	6:168332312:A:G
Skin Sun Exposed Lower leg	sqtl	1.6e-05	-0.29	6:168319244:C:T
Adrenal Gland	eqtl	1.9e-05	-0.37	6:168326094:G:A
Nerve Tibial	eqtl	3.7e-05	-0.20	6:168162975:T:TGGCACCATCTCAGCTCACTGCAAC
Brain Cerebellar Hemisphere	eqtl	5.2e-04	-0.23	6:168145907:A:C
Brain Frontal Cortex BA9	eqtl	5.9e-04	-0.40	6:168325930:C:G
Thyroid	eqtl	8.2e-04	+0.37	6:168199770:G:T
Brain Anterior cingulate cortex BA24	eqtl	1.2e-03	-0.40	6:168326094:G:A
Colon Sigmoid	eqtl	1.3e-03	-0.28	6:168169079:C:T
Esophagus Gastroesophageal Junction	eqtl	3.1e-03	+0.26	6:168328877:T:C
Brain Hypothalamus	eqtl	3.1e-03	-0.36	6:168348202:C:G
Brain Hippocampus	eqtl	4.2e-03	-0.39	6:168351662:C:T

FANTOM5 promoters

3 alternative TSS:

Promoter ID	TPM avg	Samples expressed
76735	0.1983	89
76737	0.0581	24
76736	0.0190	7

Top tissues by expression

showing 100 of 240 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
placenta	UBERON:0001987	89.05	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	84.76	gold quality
putamen	UBERON:0001874	82.69	gold quality
nucleus accumbens	UBERON:0001882	81.86	gold quality
caudate nucleus	UBERON:0001873	81.60	gold quality
apex of heart	UBERON:0002098	78.14	gold quality
decidua	UBERON:0002450	74.56	gold quality
minor salivary gland	UBERON:0001830	72.01	gold quality
skin of leg	UBERON:0001511	71.74	gold quality
skin of abdomen	UBERON:0001416	71.19	gold quality
mouth mucosa	UBERON:0003729	70.75	gold quality
zone of skin	UBERON:0000014	70.38	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	70.17	gold quality
saliva-secreting gland	UBERON:0001044	70.04	gold quality
cartilage tissue	UBERON:0002418	69.84	silver quality
right adrenal gland cortex	UBERON:0035827	68.99	gold quality
right atrium auricular region	UBERON:0006631	68.54	gold quality
right lobe of liver	UBERON:0001114	68.47	gold quality
cardiac atrium	UBERON:0002081	68.36	gold quality
prostate gland	UBERON:0002367	66.92	gold quality
mucosa of transverse colon	UBERON:0004991	66.34	gold quality
oocyte	CL:0000023	66.07	gold quality
body of pancreas	UBERON:0001150	64.27	gold quality
mammary duct	UBERON:0001765	64.22	gold quality
endometrium	UBERON:0001295	64.17	gold quality
layer of synovial tissue	UBERON:0007616	63.98	silver quality
adult mammalian kidney	UBERON:0000082	63.90	gold quality
nipple	UBERON:0002030	63.85	gold quality
lower esophagus mucosa	UBERON:0035834	63.80	gold quality
skin of hip	UBERON:0001554	63.42	silver quality
pancreas	UBERON:0001264	62.81	gold quality
liver	UBERON:0002107	62.77	gold quality
myocardium	UBERON:0002349	62.49	gold quality
synovial joint	UBERON:0002217	62.44	gold quality
right hemisphere of cerebellum	UBERON:0014890	62.38	gold quality
amniotic fluid	UBERON:0000173	62.30	gold quality
adrenal cortex	UBERON:0001235	62.25	gold quality
upper leg skin	UBERON:0004262	62.17	gold quality
cortical plate	UBERON:0005343	62.15	gold quality
prefrontal cortex	UBERON:0000451	62.14	gold quality
forebrain	UBERON:0001890	62.06	gold quality
saphenous vein	UBERON:0007318	61.81	gold quality
pericardium	UBERON:0002407	61.68	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	61.60	gold quality
spinal cord	UBERON:0002240	61.57	gold quality
islet of Langerhans	UBERON:0000006	61.53	gold quality
sperm	CL:0000019	61.52	gold quality
brain	UBERON:0000955	61.39	gold quality
thymus	UBERON:0002370	61.31	gold quality
vena cava	UBERON:0004087	61.27	gold quality
colonic epithelium	UBERON:0000397	61.22	silver quality
epithelium of nasopharynx	UBERON:0001951	61.19	gold quality
inferior vagus X ganglion	UBERON:0005363	61.18	gold quality
kidney	UBERON:0002113	61.16	gold quality
cardia of stomach	UBERON:0001162	61.14	gold quality
pons	UBERON:0000988	61.07	gold quality
trigeminal ganglion	UBERON:0001675	61.05	gold quality
superior surface of tongue	UBERON:0007371	61.05	gold quality
trachea	UBERON:0003126	61.02	gold quality
pylorus	UBERON:0001166	60.99	gold quality
medulla oblongata	UBERON:0001896	60.95	gold quality
dorsal root ganglion	UBERON:0000044	60.94	gold quality
substantia nigra	UBERON:0002038	60.91	gold quality
midbrain	UBERON:0001891	60.90	gold quality
cerebellar vermis	UBERON:0004720	60.89	gold quality
ventral tegmental area	UBERON:0002691	60.88	gold quality
tongue	UBERON:0001723	60.84	gold quality
superior vestibular nucleus	UBERON:0007227	60.82	gold quality
penis	UBERON:0000989	60.80	gold quality
right adrenal gland	UBERON:0001233	60.76	gold quality
lateral globus pallidus	UBERON:0002476	60.73	gold quality
renal medulla	UBERON:0000362	60.71	gold quality
substantia nigra pars compacta	UBERON:0001965	60.69	gold quality
body of tongue	UBERON:0011876	60.69	gold quality
metanephros cortex	UBERON:0010533	60.68	gold quality
pharyngeal mucosa	UBERON:0000355	60.67	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	60.64	gold quality
left adrenal gland cortex	UBERON:0035825	60.52	gold quality
right frontal lobe	UBERON:0002810	60.48	gold quality
subthalamic nucleus	UBERON:0001906	60.43	gold quality
peritoneum	UBERON:0002358	60.36	gold quality
omental fat pad	UBERON:0010414	60.36	gold quality
cerebellum	UBERON:0002037	60.24	gold quality
cerebellar cortex	UBERON:0002129	60.18	gold quality
urethra	UBERON:0000057	60.11	gold quality
cerebellar hemisphere	UBERON:0002245	60.01	gold quality
esophagus mucosa	UBERON:0002469	59.86	gold quality
left adrenal gland	UBERON:0001234	59.46	gold quality
adipose tissue of abdominal region	UBERON:0007808	59.40	gold quality
frontal cortex	UBERON:0001870	59.36	gold quality
uterus	UBERON:0000995	59.31	gold quality
dorsal plus ventral thalamus	UBERON:0001897	59.30	gold quality
hypothalamus	UBERON:0001898	59.01	gold quality
amygdala	UBERON:0001876	58.98	gold quality
heart	UBERON:0000948	58.95	gold quality
Ammon’s horn	UBERON:0001954	58.88	gold quality
neocortex	UBERON:0001950	58.11	gold quality
right uterine tube	UBERON:0001302	57.77	gold quality
Brodmann (1909) area 9	UBERON:0013540	57.65	gold quality
occipital lobe	UBERON:0002021	57.52	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-7008	yes	120.37
E-ANND-3	yes	4.73

HPA expression

RNA tissue specificity: Tissue enhanced

showing 60 of 77 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Frontal cortex	tissue	88.2
Caudate putamen	tissue	40.1
Nucleus accumbens	tissue	35.3
Cerebral cortex	tissue	26.4	medium
Somatosensory cortex	tissue	26.4
Occipital cortex	tissue	24.3
Motor cortex	tissue	21.2
Basal ganglia	tissue	21.1	medium
Hippocampal formation	tissue	21.0
Entorhinal cortex	tissue	21.0
Prefrontal cortex	tissue	20.5
Temporal cortex	tissue	20.3
Retrosplenial and cingulate cortex	tissue	19.0
Insular cortex	tissue	18.5
Putamen	tissue	18.1
Retrosplenial cortex	tissue	15.4
Placenta	tissue	12.1	high
Ventral forebrain	tissue	10.3
Retina	tissue	5.4
Skin 1	tissue	4.2	medium
Prostate	tissue	4.2	high
Septum	tissue	4.1
Salivary gland	tissue	3.9	medium
Endometrium 1	tissue	2.6	medium
Hippocampus	tissue	2.6	medium
Locus coeruleus	tissue	2.4
Amygdala	tissue	2.3
Medulla oblongata	tissue	2.1
Superior colliculi	tissue	1.9
Postcentral gyrus	tissue	1.9
Midbrain	tissue	1.8
Thymus	tissue	1.8
Substantia nigra	tissue	1.7
Spinal cord	tissue	1.7
Cervix	tissue	1.6	medium
Pons	tissue	1.6
Fallopian tube	tissue	1.6	medium
Thalamus	tissue	1.5
Hypothalamus	tissue	1.5
Lung	tissue	1.5	medium
Liver	tissue	1.5	high
Kidney	tissue	1.5	medium
Periaqueductal gray	tissue	1.5
Olfactory bulb	tissue	1.5
Heart muscle	tissue	1.3	medium
Corpus callosum	tissue	1.3
Vagina	tissue	1.1	low
Colon	tissue	0.8	low
Pancreas	tissue	0.8	medium
Testis	tissue	0.7	medium
Choroid plexus	tissue	0.7
Duodenum	tissue	0.7	low
Pituitary gland	tissue	0.6
Adipose tissue	tissue	0.6	low
Adrenal gland	tissue	0.6	medium
Small intestine	tissue	0.5	low
Tonsil	tissue	0.5	low
Stomach 1	tissue	0.4	low
Seminal vesicle	tissue	0.4	low
Urinary bladder	tissue	0.4	low

Brain sub-regions (HPA Brain Atlas): detected in 192; highest nTPM — Caudate nucleus (37.2), Nucleus basalis of Meynert (21.3), Nuclei of the trapezoid body (7.9), Ventral periolivary nuclei (7.5), Lateral lemniscal nuclei (7.4).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): NKX2-5, PITX2

miRNA regulators (miRDB)

Targeting DACT2 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

19 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-4267	99.96	66.53	2368
HSA-MIR-6857-5P	99.87	65.32	985
HSA-MIR-609	99.82	64.26	505
HSA-MIR-4668-5P	99.79	70.58	3782
HSA-MIR-3150A-3P	99.76	64.44	1640
HSA-MIR-6763-5P	99.76	64.68	1767
HSA-MIR-4261	99.59	70.30	3415
HSA-MIR-7106-5P	99.53	67.47	3574
HSA-MIR-671-5P	99.52	67.11	1277
HSA-MIR-5584-5P	99.49	68.22	2814
HSA-MIR-147B-5P	99.45	70.62	2432
HSA-MIR-6873-5P	98.45	66.14	1417
HSA-MIR-1262	98.17	66.52	757
HSA-MIR-4701-3P	98.17	66.25	788
HSA-MIR-6736-5P	98.17	66.43	760
HSA-MIR-4652-5P	96.46	64.22	553
HSA-MIR-6741-5P	93.86	63.06	437
HSA-MIR-4749-5P	92.16	62.26	179

Functional genomics

gnomAD constraint: pLI 4.67e-05, LOEUF 1.47, missense Z -0.1 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD RMC): no regional variation along ENST00000366795 — one region, missense o/e 0.99.

Literature-anchored findings (GeneRIF, showing 21)

• Nuclear beta-catenin was more frequently expressed in non-polypoid growth low grade colorectal neoplasms than in polypoid growth neoplasms. (PMID:18370954)
• Epigenetic regulation of DACT2 is a key component of the Wnt signalling pathway in human lung cancer. (PMID:22806826)
• Hypermethylation of Dact1 gene is associated with transitional cell carcinomas. (PMID:23244112)
• DACT2 suppresses hepatocellular carcinoma by inhibiting Wnt signaling in human hepatocellular carcinoma cells. (PMID:23449122)
• Reduced expression of DACT2 due to methylation-mediated gene silencing promotes hepatocellular carcinoma progression (PMID:23496880)
• Loss of DACT2 expression is associated with esophageal squamous cell carcinoma. (PMID:23803417)
• DACT2 acts as a functional tumor suppressor in colon cancer through inhibiting Wnt/beta-catenin signaling. Its methylation at early stages of colon carcinogenesis is an independent prognostic factor. (PMID:25023701)
• DACT2 suppresses papillary thyroid cancer proliferation and metastasis by inhibiting Wnt signaling. (PMID:25375359)
• This study demonstrated that Genes overexpressed in Pilomyxoid Astrocytoma vs. Pilocytic Astrocytoma, ranked according to fold-change, included developmental genes H19, DACT2,COL2A1; COL1A1 and IMP3. (PMID:25521223)
• There was no statistical difference between groups concerning DACT1 and DACT2 either in promoter hypermethylation or transcript levels. Age was associated with DACT2 promoter hypermethylation, especially over 56 years old. (PMID:25524937)
• DACT2 is frequently methylated in human esophageal cancer and its expression is regulated by promoter region methylation. DACT2 suppresses esophageal cancer growth by inhibiting Wnt signaling. (PMID:26919254)
• The rate of methylation of ZIC1, ZIC4, HHIP, and DACT2 in tumors was very high, while methylation of CXXC4 was low to moderate in OSCC and LSCC. (PMID:27553089)
• Results demonstrate that DACT2 functions as a tumor suppressor for breast cancer but was frequently disrupted epigenetically in this cancer. (PMID:27708215)
• The simultaneous methylation of DACT1 and DACT2 may play important roles in progression of ESCC and may serve as prognostic methylation biomarkers for ESCC patients. (PMID:28077137)
• DACT2 suppresses breast cancer cell growth both in vitro and in vivo. (PMID:28607412)
• Our findings provide a novel DACT2 demethylating stimulator to verify and expand previously established link between DACT2 and colorectal cancer (CRC), suggesting DACT2 demethylation is strongly correlated with CRC prognosis. (PMID:29199082)
• An association was found of DACT2 promoter methylation with advanced tumor stages. This gene has been suggested as a potential biomarker, however, more investigation is required to validate this function. (PMID:29745077)
• Studies suggested that DACT2 expression in nasopharyngeal carcinoma cells is restored by TET1 which demethylates its promotor region. (PMID:30075814)
• Results demonstrate that DACT2 is frequently inactivated epigenetically by CpG methylation in nasopharyngeal carcinoma (NPC), while it inhibits NPC cell proliferation and metastasis via suppressing beta-catenin/Cdc25c signaling. These findings suggest that DACT2 promoter methylation is a potential epigenetic biomarker for the detection of NPC. (PMID:30359298)
• Comparative exome sequencing reveals novel candidate genes for retinitis pigmentosa. (PMID:32454406)
• Different expression of DACT1, DACT2, and CYCLIN D1 genes in human colorectal cancer tissues and its association with clinicopathological characteristics. (PMID:37610179)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	dact2	ENSDARG00000056986
mus_musculus	Dact2	ENSMUSG00000048826
rattus_norvegicus	Dact2	ENSRNOG00000022921

Paralogs (2): DACT1 (ENSG00000165617), DACT3 (ENSG00000197380)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:1920347) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 9 distinct phenotype terms.

Mouse phenotype (MP)	Records
abnormal coat/ hair morphology	1
abnormal spleen morphology	1
abnormal skin morphology	1
increased mean corpuscular volume	1
enhanced wound healing	1
preweaning lethality, incomplete penetrance	1
abnormal skin coloration	1
abnormal eye anterior chamber depth	1
increased keratinocyte migration	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Xenopus tropicalis	Q66KC9	93.2%	Diamond
Xenopus laevis	Q8QG92	93.2%	Diamond

Protein

Protein identifiers

Dapper homolog 2 — Q5SW24 (reviewed: Q5SW24)

Alternative names: Dapper antagonist of catenin 2

All UniProt accessions (1): Q5SW24

UniProt curated annotations — full annotation on UniProt →

Function. Involved in regulation of intracellular signaling pathways during development. Negatively regulates the Nodal signaling pathway, possibly by promoting the lysosomal degradation of Nodal receptors, such as TGFBR1. May be involved in control of the morphogenetic behavior of kidney ureteric bud cells by keeping cells epithelial and restraining their mesenchymal character. May play an inhibitory role in the re-epithelialization of skin wounds by attenuating TGF-beta signaling.

Subunit / interactions. Can form homodimers and heterodimers with DACT1 or DACT3. Interacts with CSNK1D, PKA catalytic subunit, PKC-type kinase, CSNK2B, DVL1, DVL2, DVL3, VANGL1, VANGL2, TGFBR1, CTNNB1, CTNND2, CTNND1, LEF1, TCF7, TCF7L1 and HDAC1.

Domain organisation. The C-terminal PDZ-binding motif may mediate interaction with the PDZ domains of DSH (Dishevelled) family proteins.

Similarity. Belongs to the dapper family.

Isoforms (4)

UniProt ID	Names	Canonical?
Q5SW24-1	1	yes
Q5SW24-2	2
Q5SW24-3	3
Q5SW24-4	4

RefSeq proteins (3): NP_001273279, NP_001273280, NP_999627* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR024843	Dapper	Family

Pfam: PF15268

UniProt features (19 total): region of interest 4, compositionally biased region 4, splice variant 4, sequence variant 2, sequence conflict 2, chain 1, coiled-coil region 1, short sequence motif 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q5SW24-F1	50.81	0.04

Human Protein Atlas

Protein class: Predicted intracellular proteins

Protein evidence: Evidence at protein level

Antibody reliability (HPA): IH approved

Function

Pathways and Gene Ontology

Reactome pathways

0 curated (TAS) of 0; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

MSigDB gene sets: 78 (showing top): GOBP_HEMATOPOIETIC_PROGENITOR_CELL_DIFFERENTIATION, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_EPITHELIAL_CELL_DEVELOPMENT, GOBP_REGULATION_OF_TRANSMEMBRANE_RECEPTOR_PROTEIN_SERINE_THREONINE_KINASE_SIGNALING_PATHWAY, GOBP_ACTIVIN_RECEPTOR_SIGNALING_PATHWAY, GOBP_EPITHELIAL_CELL_MORPHOGENESIS, chr6q27, GOBP_COLLECTING_DUCT_DEVELOPMENT, GOBP_SKIN_DEVELOPMENT, GOBP_NEGATIVE_REGULATION_OF_TRANSMEMBRANE_RECEPTOR_PROTEIN_SERINE_THREONINE_KINASE_SIGNALING_PATHWAY, GOBP_REGULATION_OF_ACTIVIN_RECEPTOR_SIGNALING_PATHWAY, GOBP_NEGATIVE_REGULATION_OF_CELL_ADHESION, GOMF_BETA_CATENIN_BINDING, GOMF_PROTEIN_KINASE_C_BINDING, ER_Q6_02

GO Biological Process (5): epithelial cell morphogenesis (GO:0003382), negative regulation of cell adhesion (GO:0007162), skin development (GO:0043588), inner medullary collecting duct development (GO:0072061), negative regulation of nodal signaling pathway (GO:1900108)

GO Molecular Function (6): protein kinase C binding (GO:0005080), beta-catenin binding (GO:0008013), transcription factor binding (GO:0008134), protein kinase A binding (GO:0051018), delta-catenin binding (GO:0070097), protein binding (GO:0005515)

GO Cellular Component (1): cytoplasm (GO:0005737)

GO top-level categories

15 GO namespaces:

Category	Terms
protein binding	4
cell morphogenesis	1
epithelial cell development	1
cell adhesion	1
regulation of cell adhesion	1
negative regulation of cellular process	1
animal organ development	1
collecting duct development	1
negative regulation of activin receptor signaling pathway	1
nodal signaling pathway	1
regulation of nodal signaling pathway	1
protein kinase binding	1
binding	1
intracellular anatomical structure	1
cellular anatomical structure	1

Protein interactions and networks

STRING

showing 15 of 434 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
DACT2	DACT3	Q96B18	924
DACT2	ACVR1B	P36896	623
DACT2	CTNNB1	P35222	603
DACT2	TGFBR1	P36897	560
DACT2	FRMD1	Q8N878	502
DACT2	DYNLT2	Q8IZS6	493
DACT2	ANO7	Q6IWH7	453
DACT2	PHF10	Q8WUB8	446
DACT2	SMAD2	Q15796	445
DACT2	KRTAP5-2	Q701N4	443
DACT2	KIF25	Q9UIL4	429
DACT2	WDR27	A2RRH5	408
DACT2	SMOC2	Q9H3U7	407
DACT2	WIF1	Q9Y5W5	396
DACT2	DACT1	Q9NYF0	390

IntAct

Human interaction partners of DACT2 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

2 partners by confidence:

Partner	Interaction type	MIscore	Records
SMCHD1	physical association	0.400	1
MLYCD	association	0.350	1

BioGRID (17 interactions; top human partners by supporting records): CAMK2D (Affinity Capture-MS), CAMK2G (Affinity Capture-MS), CYSRT1 (Two-hybrid), DAK (Affinity Capture-MS), IQSEC1 (Affinity Capture-MS), MLYCD (Affinity Capture-MS), NARS2 (Cross-Linking-MS (XL-MS)), RHOU (Reconstituted Complex), SEL1L3 (Affinity Capture-MS), SMEK1 (Affinity Capture-MS), TRIM71 (Affinity Capture-RNA), TRRAP (Affinity Capture-MS), VHL (Affinity Capture-Western), WDR48 (Affinity Capture-MS), ZBTB20 (Affinity Capture-MS)

SIGNOR signaling

1 signaling interactions:

A	Effect	B	Mechanism
DACT2	down-regulates	TGFBR1	binding

Disease & clinical

Genetic variants

Variant evidence for DACT2: 178 ClinVar records (3 pathogenic / likely pathogenic); 4 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

178 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	3
Likely pathogenic	0
Uncertain significance	151
Likely benign	19
Benign	3

Top pathogenic / likely-pathogenic (3)

Showing all 3 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
202226	GRCh37/hg19 6q26-27(chr6:162865436-170901287)x3	Pathogenic	criteria provided, single submitter	1
150709	GRCh38/hg38 6q27(chr6:167963618-170597678)x1	Pathogenic	no assertion criteria provided	1
685707	GRCh37/hg19 6q27(chr6:166607593-170919482)x1	Pathogenic	no assertion criteria provided	1

Per-variant reference — Sugi Variant

Explore DACT2’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 36 predictions of 316):

Position(s)	Effect	Δscore	Sites
6:168308946	donor_gain	1.0000
6:168309099–168309100	acceptor_loss	1.0000	6
6:168311150–168311151	donor_loss	1.0000	3
6:168311285–168311286	acceptor_loss	1.0000	6
6:168310166–168310167	donor_loss	0.9900	4
6:168310447–168310448	acceptor_loss	0.9900	6
6:168311150–168311151	donor_loss	0.9900	3
6:168311186	donor_gain	0.9900
6:168319386–168319387	donor_loss	0.9900	5
6:168309107	acceptor_gain	0.9800

AlphaMissense

645 missense substitutions predicted likely pathogenic (of 4,949 scored), across 170 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
F128	8	0.931	0.997
H280	8	0.921	0.964
F289	8	0.919	0.987
S277	8	0.894	0.998
S125	8	0.883	0.994
D121	8	0.863	0.935
D89	8	0.862	0.937
S286	8	0.846	0.993
M771	8	0.819	0.929
D221	8	0.782	0.870
F763	7	0.908	0.989
R21	7	0.896	0.973
R123	7	0.896	0.973
S122	7	0.880	0.990
E31	7	0.862	0.948
W609	7	0.855	0.942
D263	7	0.789	0.842
F694	7	0.761	0.956
D133	7	0.755	0.850
K751	6	0.914	0.982

HPA cancer prognostics

RNA cancer specificity: Cancer enhanced (Uterine Corpus Endometrial Carcinoma)

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

1 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Papillary Cell Carcinoma (TCGA)	favorable	4.7e-05

Disease associations

OMIM: gene MIM:608966 | disease phenotypes:

GWAS associations

4 associations:

Study	Trait	p-value
GCST010653_12	Thyroid stimulating hormone levels	1e-11
GCST002063_4	Sexual dimorphism in anthropometric traits	3e-6
GCST007637_17	Diffusing capacity of carbon monoxide	5e-6
GCST012145_16	Ferritin levels	9e-6

EFO canonical traits (from GWAS)

3 canonical traits:

EFO ID	Trait name
EFO:0005951	sexual dimorphism
EFO:0009369	diffusing capacity of the lung for carbon monoxide
EFO:0004459	ferritin measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

26 total (human), top 26 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Benzo(a)pyrene	affects methylation, increases methylation, increases mutagenesis	2
beta-lapachone	decreases expression	1
mono-(2-ethylhexyl)phthalate	increases abundance, increases methylation	1
butyraldehyde	decreases expression	1
benzo(e)pyrene	affects methylation, increases methylation	1
aflatoxin B2	increases methylation	1
ICG 001	decreases expression	1
abrine	increases expression	1
bisphenol S	decreases methylation	1
4-(4-((5-(4,5-dimethyl-2-nitrophenyl)-2-furanyl)methylene)-4,5-dihydro-3-methyl-5-oxo-1H-pyrazol-1-yl)benzoic acid	decreases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Decitabine	affects methylation, affects expression	1
Microplastics	decreases expression, increases abundance	1
Air Pollutants	decreases expression, increases abundance	1
Citrulline	increases expression	1
Diethylhexyl Phthalate	increases abundance, increases methylation	1
Hydralazine	affects cotreatment, increases expression	1
Methapyrilene	affects methylation, increases methylation	1
Plant Extracts	decreases expression, affects cotreatment	1
Polystyrenes	decreases expression, increases abundance	1
Silicon Dioxide	decreases expression	1
Tetrachlorodibenzodioxin	affects expression	1
Tobacco Smoke Pollution	decreases expression	1
Urethane	decreases expression	1
Valproic Acid	affects cotreatment, increases expression	1
Particulate Matter	decreases expression, increases abundance	1

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.