DBN1

Summary

DBN1 (drebrin 1, HGNC:2695) is a protein-coding gene on chromosome 5q35.3, encoding Drebrin (Q16643). Actin cytoskeleton-organizing protein that plays a role in the formation of cell projections.

The protein encoded by this gene is a cytoplasmic actin-binding protein thought to play a role in the process of neuronal growth. It is a member of the drebrin family of proteins that are developmentally regulated in the brain. A decrease in the amount of this protein in the brain has been implicated as a possible contributing factor in the pathogenesis of memory disturbance in Alzheimer’s disease. At least two alternative splice variants encoding different protein isoforms have been described for this gene.

Source: NCBI Gene 1627 — RefSeq curated summary.

At a glance

• GWAS associations: 5
• Clinical variants (ClinVar): 127 total — 2 pathogenic
• Druggable target: yes
• MANE Select transcript: NM_001363541

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2695
Approved symbol	DBN1
Name	drebrin 1
Location	5q35.3
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000113758
Ensembl biotype	protein_coding
OMIM	126660
Entrez	1627

Gene structure

Transcript identifiers

Ensembl transcripts: 21 — 17 protein_coding, 4 retained_intron

ENST00000292385, ENST00000309007, ENST00000393565, ENST00000467054, ENST00000471767, ENST00000472831, ENST00000477391, ENST00000505550, ENST00000506117, ENST00000512501, ENST00000514833, ENST00000853639, ENST00000853640, ENST00000853641, ENST00000853642, ENST00000853643, ENST00000853644, ENST00000952660, ENST00000952661, ENST00000952662, ENST00000952663

RefSeq mRNA: 7 — MANE Select: NM_001363541 NM_001363541, NM_001364151, NM_001364152, NM_001393630, NM_001393631, NM_004395, NM_080881

CCDS: CCDS4420, CCDS4421, CCDS87354

Canonical transcript exons

ENST00000393565 — 15 exons

Exon	Start	End
ENSE00000769871	177467743	177467817
ENSE00000769873	177467481	177467627
ENSE00001515857	177456610	177457503
ENSE00001515860	177459603	177459740
ENSE00002028976	177473436	177473634
ENSE00003496100	177458058	177458707
ENSE00003524965	177466772	177466835
ENSE00003537622	177467255	177467332
ENSE00003566197	177468844	177468899
ENSE00003573802	177459098	177459268
ENSE00003626607	177457655	177457757
ENSE00003627927	177460644	177460703
ENSE00003642977	177468108	177468220
ENSE00003668736	177466911	177467062
ENSE00003786419	177460432	177460555

Expression profiles

Bgee: expression breadth ubiquitous, 283 present calls, max score 99.27.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 90.1178 / max 601.8499, expressed in 1717 samples.

FANTOM5 promoters (7 alternative TSS)

Promoter ID	TPM avg	Samples expressed
65106	84.6175	1685
65105	2.5321	1211
65101	1.7129	960
65102	0.8279	518
65099	0.3391	128
65100	0.0492	20
65104	0.0390	24

Top tissues by expression

294 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
ganglionic eminence	UBERON:0004023	99.27	gold quality
cortical plate	UBERON:0005343	99.14	gold quality
sural nerve	UBERON:0015488	98.65	gold quality
stromal cell of endometrium	CL:0002255	98.60	gold quality
ventricular zone	UBERON:0003053	98.26	gold quality
mucosa of stomach	UBERON:0001199	97.65	gold quality
embryo	UBERON:0000922	97.45	gold quality
lower esophagus muscularis layer	UBERON:0035833	96.46	gold quality
esophagogastric junction muscularis propria	UBERON:0035841	96.43	gold quality
lower esophagus	UBERON:0013473	96.42	gold quality
ascending aorta	UBERON:0001496	95.99	gold quality
thoracic aorta	UBERON:0001515	95.98	gold quality
left uterine tube	UBERON:0001303	95.94	gold quality
descending thoracic aorta	UBERON:0002345	95.83	gold quality
nucleus accumbens	UBERON:0001882	95.70	gold quality
body of uterus	UBERON:0009853	95.67	gold quality
right frontal lobe	UBERON:0002810	95.60	gold quality
caudate nucleus	UBERON:0001873	95.26	gold quality
endocervix	UBERON:0000458	95.24	gold quality
adenohypophysis	UBERON:0002196	95.16	gold quality
aorta	UBERON:0000947	95.00	gold quality
muscle layer of sigmoid colon	UBERON:0035805	94.97	gold quality
right coronary artery	UBERON:0001625	94.89	gold quality
apex of heart	UBERON:0002098	94.72	gold quality
putamen	UBERON:0001874	94.69	gold quality
popliteal artery	UBERON:0002250	94.34	gold quality
tibial artery	UBERON:0007610	94.33	gold quality
ectocervix	UBERON:0012249	94.06	gold quality
left coronary artery	UBERON:0001626	94.04	gold quality
pituitary gland	UBERON:0000007	94.01	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-HCAD-5	yes	20.63
E-ANND-3	yes	17.35
E-CURD-114	yes	9.56
E-GEOD-93593	no	14.95

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): SOX11

miRNA regulators (miRDB)

64 targeting DBN1, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-4776-3P	100.00	68.73	1340
HSA-MIR-4803	99.98	71.99	3117
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-19A-3P	99.98	75.33	2762
HSA-MIR-19B-3P	99.98	75.44	2754
HSA-MIR-1468-3P	99.96	72.74	3797
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-218-5P	99.93	72.22	2103
HSA-MIR-6124	99.87	69.78	3551
HSA-MIR-137-3P	99.87	74.74	2401
HSA-MIR-320A-3P	99.77	69.73	2107
HSA-MIR-320B	99.77	69.73	2107
HSA-MIR-320C	99.77	69.73	2107
HSA-MIR-320D	99.77	69.73	2107
HSA-MIR-4429	99.77	69.62	2111
HSA-MIR-6764-5P	99.75	67.89	2304
HSA-MIR-187-5P	99.74	70.26	1404
HSA-MIR-4446-5P	99.72	69.19	2544
HSA-MIR-494-3P	99.70	71.45	2795
HSA-MIR-1260A	99.61	66.67	1098
HSA-MIR-1260B	99.61	66.67	1098
HSA-MIR-7106-5P	99.53	67.47	3574
HSA-MIR-3123	99.47	67.15	2693
HSA-MIR-6882-5P	99.35	71.13	1206
HSA-MIR-4311	99.31	70.47	3041
HSA-MIR-6809-5P	99.13	68.45	1223
HSA-MIR-6884-5P	99.10	64.50	1987

Literature-anchored findings (GeneRIF, showing 39)

• We found decreased levels of drebrin in frontal and temporal cortex from patients with DS and AD. Reduced drebrin could cause loss of spine plasticity in DS and may be a marker for neurodegenerative disorders. (PMID:12009525)
• These data confirm the role of drebrin E2 in the formation of branching processes and further indicate that during cell migration, the protein contributes to retraction of the cell body and the tail but not to lamellipodia formation. (PMID:16780834)
• the down-regulation of drebrin mRNA expression plays an important role in Alzheimer’s disease and is closely related to the progression of the disease (PMID:18338803)
• Drebrin targets EB3 to coordinate F-actin-microtubule interactions that underlie neuritogenesis. (PMID:18806788)
• The downregulation of Drebrin in Alzheimer’s Disease and Down Syndrome and conversely its upregulation in various carcinomas indicate that Drebrin is an important component of the pathogenesis of multiple diseases. (PMID:20183806)
• Data show that DBN1, SETMAR and HIG2 are direct transcriptional targets of the SOX11 protein. (PMID:21124928)
• High expression of cytoskeletal protein drebrin is associated with TEL/AML1pos B-cell precursor acute lymphoblastic leukemia (PMID:21497902)
• decreasing the drebrin E levels disrupted the normal subapical F-actin-myosin-IIB-betaII-spectrin network and the apical accumulation of EB3, a microtubule-plus-end-binding protein (PMID:22275434)
• The results of this study showed that Hippocampal drebrin loss in mild cognitive impairment. (PMID:22310934)
• Drebrin contributes to the maintenance of cell shape, and may play an important role in glioma cell motility. (PMID:23201135)
• drebrin has a role in HIV infection by modulating viral entry, mainly through the control of actin cytoskeleton polymerization in response to HIV-1 (PMID:23926103)
• These findings show that drebrin contains a cryptic F-actin-bundling activity regulated by phosphorylation and provide a mechanistic model for microtubule-F-actin coupling. (PMID:23979715)
• In basal cell carcinoma tissues, intense and homogeneous drebrin expression was observed mainly at tumor cell-cell boundaries. In contrast, drebrin was stained only weakly and non-homogeneously in trichoblastoma and trichoepthelioma tissue samples. (PMID:24346822)
• Rab8a and Drebrin E act as key proteins in the regulation of apical trafficking in intestinal epithelial cells. (PMID:24399445)
• The study compared the proteome profiles of the human colon adenocarcinoma cell line HCT-116 with its metastatic derivative E1. DBN1 was found to be overexpressed in E1 as compared to HCT-116 cells. (PMID:24610677)
• Drebrin is critical for progranulin-dependent activation of the Akt and MAPK pathways and modulates motility, invasion and anchorage-independent growth in bladder neoplasms. (PMID:25839164)
• Exploring the relationship between drebrin and cognitive function may provide insight into the early prevention of cognitive impairment and in the diagnosis and treatment of Alzheimer’s disease. (PMID:26123582)
• Drebrin reduces SMC activation through its interaction with the actin cytoskeleton but independently of its interaction with Homer scaffolds to prevent neointima formation. (PMID:27013612)
• Inhibition of cortactin or dynamin-2 abrogated the increased virus entry observed in DBN1-deficient cells, suggesting that DBN1 suppresses dynamin-mediated endocytosis via interaction with cortactin. (PMID:28416666)
• Lack of drebrin leads to the dysfunction of cell-cell communication, resulting in aberrant migration of metastatic cancer cells, aberrant synaptic function in dementia, and rupture of endothelial integrity. (PMID:28865011)
• One candidate pathway coupling actin filaments to microtubules consists of the actin filament-binding protein drebrin and the microtubule-binding +TIP protein EB3. This pathway is regulated proximally by cyclin-dependent kinase 5 phosphorylation of drebrin but the upstream elements in the pathway have yet to be identified. (PMID:28865014)
• These observations indicate that drebrin loss in dendritic spines occurs at the prodromal stage of Alzheimer’s disease (AD), before the density and morphology of dendritic spines change. Quantitation of drebrin may be a possible tool for diagnosing the prodromal stage of AD, before dementia development in AD. (PMID:28865022)
• Taking into account that connexin-43 (Cx43) (together with Cx30) is heavily expressed in astrocytes and that drebrin supports cell-cell contacts, the understanding of details of how brain cells live and die reveals molecular pathology involved in neurodegeneration, Alzheimer’s disease (AD), other cognitive disorders, and aging (PMID:28865023)
• further studies on drebrin and its binding proteins will be of great importance to elucidate the pathologies of various diseases and may contribute to their medical treatment and diagnostics development. (PMID:28865024)
• through its interaction with CXCR4 and the actin cytoskeleton, drebrin regulates T cell activation. CD4(+) T cells are one of the main targets for the human immunodeficiency virus (HIV)-1. (PMID:28865025)
• Our work has shown that the immunosuppressant compound BTP2, which blocks Ca(2+) influx into cells, interacts with the actin-reorganizing protein, drebrin. Here we review the role of drebrin in the regulation of calcium signaling, with a focus on immune cells. (PMID:28865026)
• Upregulation of drebrin was noted in several types of cancers, e.g., basal cell carcinomas for which it may serve as marker, liver metastases of colon carcinomas, and bladder cancer, suggesting that it is involved in regulating actin dynamics during tumor development, progression, and metastasis. (PMID:28865028)
• drebrin has to be added to the list of actin-binding proteins regulating actin dynamics of mesangial cell processes and foot processes of podocytes. It will be important to determine its role in hereditary and acquired glomerulopathies. (PMID:28865030)
• these results contribute to the current understanding of cell-cell junction regulation, introducing a new function of drebrin as a stabilizer of endothelial integrity. (PMID:28865031)
• Cancer cell motility and invasion are crucial elements in the metastatic cascade and involve dramatic changes in cellular morphology that are associated with dynamic remodelling of the cytoskeleton. Interestingly, it now appears that drebrin could deliver this role during cancer development. (PMID:28865033)
• Drebrin may regulate activities of epigenetic reader ZMYND8 via its cytoplasmic sequestration. (PMID:28966017)
• we show that drebrin and hCDC14A regulate the recruitment of the actin organizer Arp2 to centrosomes. In addition, during ciliogenesis hCDC14A also regulates endocytosis and targeting of myosin Va vesicles to the basal body in a drebrin-independent manner, indicating that it impacts primary cilia formation in a multilayered manner. (PMID:30467237)
• Study results showed that the vincristine resistant colon cancer cell line has reduced DBN1 expression which may be related to changes in the drug-target sites. (PMID:30880752)
• TFAP2A Induced ITPKA Serves as an Oncogene and Interacts with DBN1 in Lung Adenocarcinoma. (PMID:32015686)
• Drebrin expression patterns in patients with refractory temporal lobe epilepsy and hippocampal sclerosis. (PMID:32662890)
• Physical interaction between BAALC and DBN1 induces chemoresistance in leukemia. (PMID:33453340)
• Effects of neuronal drebrin on actin dynamics. (PMID:33739391)
• Drebrin promotes lung adenocarcinoma cell migration through inducing integrin beta1 endocytosis. (PMID:36155064)
• The well-developed actin cytoskeleton and Cthrc1 expression by actin-binding protein drebrin in myofibroblasts promote cardiac and hepatic fibrosis. (PMID:36690273)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	dbn1	ENSDARG00000069113
mus_musculus	Dbn1	ENSMUSG00000034675
rattus_norvegicus	Dbn1	ENSRNOG00000014170

Paralogs (4): CTTN (ENSG00000085733), COTL1 (ENSG00000103187), DBNL (ENSG00000136279), HCLS1 (ENSG00000180353)

Protein

Protein identifiers

Drebrin — Q16643 (reviewed: Q16643)

Alternative names: Developmentally-regulated brain protein

All UniProt accessions (5): Q16643, D6R9Q9, D6R9W4, D6RCR4, D6RFI1

UniProt curated annotations — full annotation on UniProt →

Function. Actin cytoskeleton-organizing protein that plays a role in the formation of cell projections. Required for actin polymerization at immunological synapses (IS) and for the recruitment of the chemokine receptor CXCR4 to IS. Plays a role in dendritic spine morphogenesis and organization, including the localization of the dopamine receptor DRD1 to the dendritic spines. Involved in memory-related synaptic plasticity in the hippocampus.

Subunit / interactions. Interacts with RUFY3. Interacts with CXCR4; this interaction is enhanced by antigenic stimulation. Interacts (via ADF-H domain) with ZMYND8 (via N-terminus); the interaction leads to sequestering of ZMYND8 in the cytoplasm.

Subcellular location. Cytoplasm. Cell projection. Dendrite. Cell cortex. Cell junction. Growth cone.

Tissue specificity. Expressed in the brain, with expression in the molecular layer of the dentate gyrus, stratum pyramidale, and stratum radiatum of the hippocampus (at protein level). Also expressed in the terminal varicosities distributed along dendritic trees of pyramidal cells in CA4 and CA3 of the hippocampus (at protein level). Expressed in pyramidal cells in CA2, CA1 and the subiculum of the hippocampus (at protein level). Expressed in peripheral blood lymphocytes, including T-cells (at protein level). Expressed in the brain (PubMed:8216329, Ref.2). Expressed in the heart, placenta, lung, skeletal muscle, kidney, pancreas, skin fibroblasts, gingival fibroblasts and bone-derived cells (Ref.2).

Disease relevance. Alzheimer disease (AD) [MIM:104300] Alzheimer disease is a neurodegenerative disorder characterized by progressive dementia, loss of cognitive abilities, and deposition of fibrillar amyloid proteins as intraneuronal neurofibrillary tangles, extracellular amyloid plaques and vascular amyloid deposits. The major constituents of these plaques are neurotoxic amyloid-beta protein 40 and amyloid-beta protein 42, that are produced by the proteolysis of the transmembrane APP protein. The cytotoxic C-terminal fragments (CTFs) and the caspase-cleaved products, such as C31, are also implicated in neuronal death. The protein represented in this entry may be involved in disease pathogenesis. In brains of patients with AD, decreased expression and absence from dystrophic neurites in amyloid plaques. Disappearance of debrin from the hippocampus may contribute to the pathogenesis of memory disturbance in AD.

Isoforms (3)

UniProt ID	Names	Canonical?
Q16643-1	1, Drebrin E, drebrin E2, Embryonic drebrin	yes
Q16643-2	2
Q16643-3	3, Drebrin A

RefSeq proteins (7): NP_001350470, NP_001351080, NP_001351081, NP_001380559, NP_001380560, NP_004386, NP_543157 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002108	ADF-H	Domain
IPR029006	ADF-H/Gelsolin-like_dom_sf	Homologous_superfamily

Pfam: PF00241

UniProt features (46 total): modified residue 12, helix 8, strand 7, compositionally biased region 5, sequence variant 4, region of interest 3, splice variant 2, mutagenesis site 2, initiator methionine 1, chain 1, domain 1

Structure

Experimental structures (PDB)

2 structures.

PDB	Method	Resolution (Å)
5ZZ9	X-RAY DIFFRACTION	2.3
5Y1Z	X-RAY DIFFRACTION	2.68

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q16643-F1	62.93	0.25

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (12): 2, 141, 142, 331, 335, 337, 339, 345, 346, 416, 497, 601

Mutagenesis-validated functional residues (2):

Position	Phenotype
10	loss of binding to zmynd8. loss of zmynd8 cytoplasmic localization.
96	decreased binding to zmynd8.

Function

Pathways and Gene Ontology

Reactome pathways

4 pathways

ID	Pathway
R-HSA-9013405	RHOD GTPase cycle
R-HSA-9013407	RHOH GTPase cycle
R-HSA-9013418	RHOBTB2 GTPase cycle
R-HSA-9013422	RHOBTB1 GTPase cycle

MSigDB gene sets: 258 (showing top): GOBP_DENDRITE_DEVELOPMENT, MODULE_52, BORCZUK_MALIGNANT_MESOTHELIOMA_UP, GOBP_EMBRYO_DEVELOPMENT_ENDING_IN_BIRTH_OR_EGG_HATCHING, TSENG_IRS1_TARGETS_UP, GOBP_REGULATION_OF_CELL_MORPHOGENESIS, GOBP_REGULATION_OF_NEURONAL_SYNAPTIC_PLASTICITY, GOBP_REGULATION_OF_DENDRITE_MORPHOGENESIS, GOBP_DENDRITIC_SPINE_DEVELOPMENT, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_DN, GOBP_NEUROGENESIS, GOBP_REGULATION_OF_NERVOUS_SYSTEM_DEVELOPMENT, CAGGTCC_MIR492, GOBP_POSITIVE_REGULATION_OF_NERVOUS_SYSTEM_DEVELOPMENT

GO Biological Process (14): in utero embryonic development (GO:0001701), actin filament organization (GO:0007015), cell communication by chemical coupling (GO:0010643), cell communication by electrical coupling (GO:0010644), positive regulation of synaptic plasticity (GO:0031915), maintenance of protein location in cell (GO:0032507), regulation of neuronal synaptic plasticity (GO:0048168), generation of neurons (GO:0048699), regulation of dendrite development (GO:0050773), positive regulation of dendritic spine morphogenesis (GO:0061003), neural precursor cell proliferation (GO:0061351), positive regulation of receptor localization to synapse (GO:1902685), nervous system development (GO:0007399), cell differentiation (GO:0030154)

GO Molecular Function (5): actin binding (GO:0003779), profilin binding (GO:0005522), cadherin binding (GO:0045296), protein sequestering activity (GO:0140311), protein binding (GO:0005515)

GO Cellular Component (20): cytoplasm (GO:0005737), cytoskeleton (GO:0005856), gap junction (GO:0005921), postsynaptic density (GO:0014069), actin cytoskeleton (GO:0015629), dendrite (GO:0030425), growth cone (GO:0030426), cortical cytoskeleton (GO:0030863), actomyosin (GO:0042641), postsynaptic membrane (GO:0045211), glutamatergic synapse (GO:0098978), postsynaptic cytosol (GO:0099524), plasma membrane (GO:0005886), cell-cell junction (GO:0005911), cell cortex (GO:0005938), membrane (GO:0016020), cell projection (GO:0042995), neuron projection (GO:0043005), anchoring junction (GO:0070161), cell periphery (GO:0071944)

Reactome top-level categories

Rollup of top-2 pathways:

Category	Pathways
RHO GTPase cycle	2
RHOBTB GTPase Cycle	2

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	5
cell communication	2
regulation of synaptic plasticity	2
protein binding	2
cytoskeleton	2
postsynapse	2
cell periphery	2
chordate embryonic development	1
actin cytoskeleton organization	1
supramolecular fiber organization	1
maintenance of protein location	1
maintenance of location in cell	1
neurogenesis	1
regulation of neuron projection development	1
dendrite development	1
regulation of developmental process	1
positive regulation of neuron projection development	1
positive regulation of dendrite morphogenesis	1
dendritic spine morphogenesis	1
positive regulation of dendritic spine development	1
regulation of dendritic spine morphogenesis	1
cell population proliferation	1
positive regulation of biological process	1
receptor localization to synapse	1
regulation of receptor localization to synapse	1
system development	1
cellular developmental process	1
cytoskeletal protein binding	1
cell adhesion molecule binding	1
molecular sequestering activity	1
binding	1
intracellular anatomical structure	1
intracellular membraneless organelle	1
cell-cell junction	1
asymmetric synapse	1
postsynaptic specialization	1
neuron projection	1
dendritic tree	1
site of polarized growth	1
distal axon	1

Protein interactions and networks

STRING

1892 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
DBN1	MAPRE3	Q9UPY8	979
DBN1	GJA1	P17302	898
DBN1	MAP4K3	Q8IVH8	818
DBN1	PFN4	Q8NHR9	742
DBN1	TJP1	Q07157	710
DBN1	PPP1R9B	Q96SB3	702
DBN1	CXCR4	P30991	700
DBN1	PFN3	P60673	675
DBN1	CFL1	P23528	672
DBN1	CFL2	Q9Y281	668
DBN1	MAP4K1	Q92918	668
DBN1	PFN1	P07737	658
DBN1	NEXN	Q0ZGT2	645
DBN1	DLG4	P78352	643
DBN1	APP	P05067	639

IntAct

275 interactions, top by confidence:

A	B	Type	Score
CHUK	IKBKB	psi-mi:“MI:0914”(association)	0.960
HOMER1	TRAF5	psi-mi:“MI:0914”(association)	0.740
CFTR	ESYT2	psi-mi:“MI:0914”(association)	0.710
CFTR	ESYT2	psi-mi:“MI:2364”(proximity)	0.710
DBN1	GRB2	psi-mi:“MI:0915”(physical association)	0.670
GRB2	DBN1	psi-mi:“MI:0915”(physical association)	0.670
PAK5	AURKA	psi-mi:“MI:0914”(association)	0.640
DBN1	ZMYND8	psi-mi:“MI:0407”(direct interaction)	0.630
DBN1	ZMYND8	psi-mi:“MI:0403”(colocalization)	0.630
GRN	DBN1	psi-mi:“MI:0915”(physical association)	0.580
GRN	DBN1	psi-mi:“MI:0403”(colocalization)	0.580
TWF1	MYO1C	psi-mi:“MI:0914”(association)	0.530
DBN1	GSN	psi-mi:“MI:0914”(association)	0.530
DBN1	TINF2	psi-mi:“MI:0915”(physical association)	0.510
RABGAP1L	DBN1	psi-mi:“MI:0915”(physical association)	0.490

BioGRID (533): DBN1 (Affinity Capture-MS), DBN1 (Affinity Capture-RNA), DBN1 (Affinity Capture-MS), DBN1 (Affinity Capture-MS), DBN1 (Affinity Capture-MS), DBN1 (Reconstituted Complex), DBN1 (Affinity Capture-MS), DBN1 (Affinity Capture-MS), DBN1 (Two-hybrid), DBN1 (Two-hybrid), DBN1 (Affinity Capture-Luminescence), DBN1 (Reconstituted Complex), DBN1 (Affinity Capture-MS), ACTG1 (Affinity Capture-MS), ACTN4 (Affinity Capture-MS)

ESM2 similar proteins: A0JNJ3, A0M8T5, A0PJT0, A2BIJ3, D3ZTQ1, O35867, O94876, P42566, P42567, P97578, Q00PJ1, Q02225, Q09YI1, Q09YK4, Q09YM8, Q16643, Q2IBF8, Q2QL82, Q2QLA2, Q2QLG9, Q2T9N1, Q3SX22, Q3UQU0, Q3USH5, Q5BJ78, Q5RDH2, Q5T1M5, Q5U3K5, Q5ZIK6, Q68EF0, Q69ZZ6, Q6INU2, Q6NTW1, Q6P9Q6, Q6TYB5, Q6ZPJ0, Q80Y55, Q8IWB9, Q8IWE2, Q8N0X7

Diamond homologs: A3LXQ8, A6H7G2, A6ZR73, A7MBI0, B3LRN4, B5VHP4, B8R1V5, C4Y1G1, C7GKW5, E7KBW4, E7KMS3, E7LTJ6, E7Q311, E7QE10, G5EC32, O13154, O35179, O35180, O42287, O60861, O74749, O75886, O76041, O77506, O88811, P08487, P10569, P10686, P14317, P18302, P19174, P20929, P34121, P34416, P40073, P49710, P70297, Q01406, Q07266, Q09822

SIGNOR signaling

1 interactions.

A	Effect	B	Mechanism
CDK5	“up-regulates activity”	DBN1	phosphorylation

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 186 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
RHO GTPases activate PAKs	6	25.3×	4e-05
Signaling by cytosolic FGFR1 fusion mutants	5	24.6×	1e-04
Signaling by FLT3 fusion proteins	5	22.1×	1e-04
Telomere Extension By Telomerase	6	21.2×	6e-05
Signaling by phosphorylated juxtamembrane, extracellular and kinase domain KIT mutants	5	20.1×	2e-04
Downstream signal transduction	6	17.7×	1e-04
Parasite infection	6	16.1×	1e-04
Leishmania phagocytosis	6	16.1×	1e-04

GO biological processes:

GO term	Partners	Fold	FDR
positive regulation of telomere maintenance	5	15.8×	3e-03
regulation of MAPK cascade	5	14.1×	4e-03
Ras protein signal transduction	9	11.4×	2e-04
canonical NF-kappaB signal transduction	5	11.3×	6e-03
obsolete positive regulation of NF-kappaB transcription factor activity	8	10.2×	7e-04
apoptotic signaling pathway	6	8.3×	6e-03
protein autophosphorylation	9	8.1×	8e-04
cellular response to type II interferon	6	7.7×	8e-03

Disease & clinical

Clinical variants and AI predictions

ClinVar

127 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	2
Likely pathogenic	0
Uncertain significance	95
Likely benign	3
Benign	7

Top pathogenic / likely-pathogenic (2)

Variant ID	HGVS	Classification
563129	GRCh37/hg19 5q35.2-35.3(chr5:176044976-177023859)x1	Pathogenic
57051	GRCh38/hg38 5q35.2-35.3(chr5:176132340-177586960)x1	Pathogenic

SpliceAI

2051 predictions. Top by Δscore:

Variant	Effect	Δscore
5:177457652:TA:T	donor_loss	1.0000
5:177457654:C:CA	donor_loss	1.0000
5:177457753:CTGGC:C	acceptor_gain	1.0000
5:177457754:TGGC:T	acceptor_gain	1.0000
5:177457755:GGC:G	acceptor_gain	1.0000
5:177457756:GC:G	acceptor_gain	1.0000
5:177457757:CC:C	acceptor_gain	1.0000
5:177457758:C:CC	acceptor_gain	1.0000
5:177458053:CGCAC:C	donor_loss	1.0000
5:177458055:CACCT:C	donor_loss	1.0000
5:177458056:A:AT	donor_loss	1.0000
5:177458057:C:A	donor_loss	1.0000
5:177458068:T:TA	donor_gain	1.0000
5:177458717:C:CT	acceptor_gain	1.0000
5:177459092:TCTCA:T	donor_loss	1.0000
5:177459093:CTCA:C	donor_loss	1.0000
5:177459094:TCA:T	donor_loss	1.0000
5:177459095:CACC:C	donor_loss	1.0000
5:177459096:ACCTT:A	donor_loss	1.0000
5:177459097:C:A	donor_loss	1.0000
5:177459265:CTGC:C	acceptor_gain	1.0000
5:177459266:TGC:T	acceptor_gain	1.0000
5:177459267:GC:G	acceptor_gain	1.0000
5:177459267:GCCT:G	acceptor_loss	1.0000
5:177459268:CC:C	acceptor_gain	1.0000
5:177459269:C:CA	acceptor_loss	1.0000
5:177459269:C:CC	acceptor_gain	1.0000
5:177459271:G:C	acceptor_gain	1.0000
5:177460429:TACCT:T	donor_loss	1.0000
5:177460430:A:C	donor_loss	1.0000

AlphaMissense

4523 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
5:177460505:G:C	F294L	1.000
5:177460505:G:T	F294L	1.000
5:177460507:A:G	F294L	1.000
5:177460552:C:G	A279P	1.000
5:177466935:C:G	R228P	1.000
5:177466947:C:G	R224P	1.000
5:177466956:C:G	R221P	1.000
5:177466957:G:T	R221S	1.000
5:177466989:C:G	R210P	1.000
5:177467046:C:G	R191P	1.000
5:177467260:C:G	A184P	1.000
5:177467267:C:A	W181C	1.000
5:177467267:C:G	W181C	1.000
5:177467269:A:G	W181R	1.000
5:177467269:A:T	W181R	1.000
5:177467270:G:C	F180L	1.000
5:177467270:G:T	F180L	1.000
5:177467271:A:C	F180C	1.000
5:177467271:A:G	F180S	1.000
5:177467272:A:G	F180L	1.000
5:177467605:G:T	A118D	1.000
5:177467606:C:G	A118P	1.000
5:177467747:A:G	F109S	1.000
5:177467750:A:G	F108S	1.000
5:177467777:G:T	A99D	1.000
5:177467788:C:A	K95N	1.000
5:177467788:C:G	K95N	1.000
5:177467790:T:C	K95E	1.000
5:177467813:C:A	G87V	1.000
5:177467813:C:T	G87D	1.000

dbSNP variants (sampled 300 via entrez): RS1000212219 (5:177461518 A>G,T), RS1000216234 (5:177472009 G>A,C,T), RS1000306866 (5:177466350 GGGAGATGCTGCTCCCAA>G,GGGAGATGCTGCTCCCAAGGAGATGCTGCTCCCAA), RS1000554669 (5:177474060 C>T), RS1000577709 (5:177470368 A>C), RS1000782888 (5:177464150 T>A,C), RS1000919489 (5:177470638 T>C), RS1000983072 (5:177468433 A>G), RS1001180763 (5:177470657 A>G), RS1001398411 (5:177474329 A>C), RS1001452749 (5:177461947 A>C), RS1001532598 (5:177469482 C>T), RS1001547939 (5:177464627 A>G), RS1001650409 (5:177466296 T>C,G), RS1001983212 (5:177469269 G>C)

Disease associations

OMIM: gene MIM:126660 | disease phenotypes: MIM:117550

GenCC curated gene-disease

Mondo (1): Sotos syndrome (MONDO:0019349)

Orphanet (1): Sotos syndrome (Orphanet:821)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

5 associations (top):

Study	Trait	p-value
GCST001574_7	Activated partial thromboplastin time	6.000000e-88
GCST005956_15	Waist-to-hip ratio adjusted for BMI	1.000000e-07
GCST005957_13	Waist-to-hip ratio adjusted for BMI (age <50)	3.000000e-07
GCST005962_42	Waist-to-hip ratio adjusted for BMI x sex x age interaction (4df test)	1.000000e-08
GCST007044_13	Extremely high intelligence	3.000000e-08

EFO canonical traits (4, from GWAS)

EFO ID	Trait name
EFO:0007788	BMI-adjusted waist-hip ratio
EFO:0008007	age at assessment
EFO:0008343	sex interaction measurement
EFO:0004337	intelligence

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
D058495	Sotos Syndrome	C16.131.077.889; C16.131.260.905; C16.320.180.905

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6067064 (SINGLE PROTEIN)

PharmGKB: 1 entry (VIP=true, CPIC=false)

ChEMBL bioactivities

2 potent at pChembl≥5 of 2 total, top 2 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
6.30	Kd	498.3	nM	CHEMBL5653589
5.52	ED50	3036	nM	CHEMBL5653589

PubChem BioAssay actives

1 with measured affinity, of 2 total; 1 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
4-methyl-3-[(2-methyl-6-pyridin-3-ylpyrazolo[3,4-d]pyrimidin-4-yl)amino]-N-[3-(trifluoromethyl)phenyl]benzamide	2148197: Binding affinity to human DBN1 incubated for 45 mins by Kinobead based pull down assay	kd	0.4983	uM

CTD chemical–gene interactions

71 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	decreases expression, decreases methylation	4
Benzo(a)pyrene	affects methylation, increases expression	3
Estradiol	affects cotreatment, increases expression, decreases expression	3
Cyclosporine	increases expression, decreases expression	3
pirinixic acid	increases activity, decreases reaction, increases expression, affects binding, decreases expression	2
sodium arsenite	increases expression, decreases expression	2
Arsenic Trioxide	decreases expression, increases expression	2
Valproic Acid	affects expression, decreases expression, increases methylation	2
GSK-J4	decreases expression	1
FR900359	affects phosphorylation	1
bisphenol F	increases expression	1
triphenyl phosphate	affects expression	1
sodium arsenate	decreases expression	1
beta-lapachone	increases expression	1
mono-(2-ethylhexyl)phthalate	decreases methylation, increases abundance	1
cobaltous chloride	decreases expression	1
benzo(e)pyrene	increases methylation	1
2,3-bis(3’-hydroxybenzyl)butyrolactone	affects cotreatment, decreases expression	1
coumarin	affects phosphorylation	1
S-(1,2-dichlorovinyl)cysteine	affects response to substance, increases expression, affects cotreatment, decreases expression	1
perfluorooctane sulfonic acid	decreases expression	1
perfluoro-n-nonanoic acid	increases expression	1
nutlin 3	affects cotreatment, increases secretion	1
bisphenol B	increases expression	1
bisphenol S	affects expression	1
bisphenol AF	increases expression	1
Bortezomib	increases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Temozolomide	increases expression	1
Acetaminophen	increases expression	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5651239	Binding	Binding affinity to human DBN1 incubated for 45 mins by Kinobead based pull down assay	NVP-BHG712: Effects of Regioisomers on the Affinity and Selectivity toward the EPHrin Family. — ChemMedChem

Cellosaurus cell lines

2 cell lines: 2 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_SK41	HAP1 DBN1 (-) 1	Cancer cell line	Male
CVCL_XN10	HAP1 DBN1 (-) 2	Cancer cell line	Male

Clinical trials (associated diseases)

1 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT04993235	Not specified	UNKNOWN	Body Perception and Representation in Overgrowth Syndromes, Behavioral Assessment and Neuropsychological Development