DDIT4L

Summary

DDIT4L (DNA damage inducible transcript 4 like, HGNC:30555) is a protein-coding gene on chromosome 4q24, encoding DNA damage-inducible transcript 4-like protein (Q96D03). Inhibits cell growth by regulating the TOR signaling pathway upstream of the TSC1-TSC2 complex and downstream of AKT1.

Predicted to be involved in negative regulation of signal transduction. Predicted to be located in cytoplasm.

Source: NCBI Gene 115265 — RefSeq curated summary.

At a glance

• GWAS associations: 3
• Clinical variants (ClinVar): 34 total
• MANE Select transcript: NM_145244

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:30555
Approved symbol	DDIT4L
Name	DNA damage inducible transcript 4 like
Location	4q24
Locus type	gene with protein product
Status	Approved
Aliases	REDD2, Rtp801L
Ensembl gene	ENSG00000145358
Ensembl biotype	protein_coding
OMIM	607730
Entrez	115265

Gene structure

Transcript identifiers

Ensembl transcripts: 4 — 4 protein_coding

ENST00000273990, ENST00000502763, ENST00000513992, ENST00000966423

RefSeq mRNA: 1 — MANE Select: NM_145244 NM_145244

CCDS: CCDS34036

Canonical transcript exons

ENST00000273990 — 3 exons

Exon	Start	End
ENSE00001018896	100190303	100190468
ENSE00001018900	100189893	100190032
ENSE00001080679	100185870	100188167

Expression profiles

Bgee: expression breadth ubiquitous, 216 present calls, max score 99.18.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 8.4822 / max 361.2511, expressed in 925 samples.

FANTOM5 promoters (2 alternative TSS)

Promoter ID	TPM avg	Samples expressed
53313	8.4724	925
53314	0.0098	4

Top tissues by expression

249 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
deltoid	UBERON:0001476	99.18	gold quality
tibialis anterior	UBERON:0001385	98.79	gold quality
quadriceps femoris	UBERON:0001377	98.60	gold quality
vastus lateralis	UBERON:0001379	98.53	gold quality
skeletal muscle tissue of biceps brachii	UBERON:0004502	98.01	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	97.67	gold quality
biceps brachii	UBERON:0001507	97.34	gold quality
skeletal muscle tissue	UBERON:0001134	97.17	gold quality
gastrocnemius	UBERON:0001388	96.80	gold quality
skeletal muscle organ	UBERON:0014892	96.43	gold quality
hindlimb stylopod muscle	UBERON:0004252	96.28	gold quality
cartilage tissue	UBERON:0002418	96.13	gold quality
muscle of leg	UBERON:0001383	96.07	gold quality
body of tongue	UBERON:0011876	95.46	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	90.76	gold quality
muscle tissue	UBERON:0002385	90.00	gold quality
tongue	UBERON:0001723	86.38	gold quality
tibia	UBERON:0000979	85.44	gold quality
palpebral conjunctiva	UBERON:0001812	85.02	gold quality
putamen	UBERON:0001874	84.66	gold quality
metanephros cortex	UBERON:0010533	84.59	gold quality
renal medulla	UBERON:0000362	84.57	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	82.82	gold quality
caudate nucleus	UBERON:0001873	81.72	gold quality
amniotic fluid	UBERON:0000173	81.02	gold quality
minor salivary gland	UBERON:0001830	79.39	gold quality
adrenal tissue	UBERON:0018303	78.65	gold quality
pharyngeal mucosa	UBERON:0000355	78.39	gold quality
mouth mucosa	UBERON:0003729	77.56	gold quality
saliva-secreting gland	UBERON:0001044	76.92	gold quality

Single-cell (SCXA)

Detected in 2 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-MTAB-6075	yes	525.80
E-ANND-3	yes	6.46

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

74 targeting DDIT4L, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-200B-3P	100.00	73.31	2693
HSA-MIR-200C-3P	100.00	73.35	2685
HSA-MIR-429	100.00	73.44	2698
HSA-MIR-8485	100.00	77.57	4731
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-4768-5P	100.00	69.49	2861
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-6077	99.99	68.04	2299
HSA-MIR-196A-1-3P	99.99	72.15	2772
HSA-MIR-4803	99.98	71.99	3117
HSA-MIR-4650-5P	99.98	64.69	999
HSA-MIR-302C-5P	99.97	72.56	3642
HSA-MIR-551B-5P	99.96	71.28	3493
HSA-MIR-141-3P	99.94	72.79	2421
HSA-MIR-200A-3P	99.94	72.68	2420
HSA-MIR-515-5P	99.92	69.82	2343
HSA-MIR-5582-3P	99.86	72.48	4221
HSA-MIR-4307	99.82	70.45	3374
HSA-MIR-4495	99.82	72.08	3080
HSA-MIR-370-5P	99.78	66.81	706
HSA-MIR-4679	99.76	69.19	1229
HSA-MIR-3680-3P	99.75	72.51	3095
HSA-MIR-6505-5P	99.73	69.25	1595
HSA-MIR-33A-3P	99.70	70.27	3362
HSA-MIR-7154-5P	99.69	70.52	1900
HSA-MIR-3136-3P	99.57	66.59	781
HSA-MIR-7155-3P	99.57	66.48	794
HSA-MIR-766-3P	99.47	65.24	1811

Literature-anchored findings (GeneRIF, showing 3)

• RTP801 and RTP801L work downstream of AKT and upstream of TSC2 to inhibit mTOR functions (PMID:15632201)
• mediates monocyte cell death through a reduction in thioredoxin-1 expression (PMID:19268525)
• Promoter methylation and differential gene expression of five markers: COL1A2, NPM2, HSPB6, DDIT4L and MT1G were validated by sequencing of bisulfite-modified DNA and real-time reverse transcriptase PCR, respectively. (PMID:19491193)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
mus_musculus	Ddit4l	ENSMUSG00000046818
rattus_norvegicus	Ddit4l	ENSRNOG00000010047
drosophila_melanogaster	chrb	FBGN0036165
drosophila_melanogaster	scyl	FBGN0041094

Paralogs (1): DDIT4 (ENSG00000168209)

Protein

Protein identifiers

DNA damage-inducible transcript 4-like protein — Q96D03 (reviewed: Q96D03)

Alternative names: HIF-1 responsive protein RTP801-like, Protein regulated in development and DNA damage response 2

All UniProt accessions (3): D6RD49, D6RJ99, Q96D03

UniProt curated annotations — full annotation on UniProt →

Function. Inhibits cell growth by regulating the TOR signaling pathway upstream of the TSC1-TSC2 complex and downstream of AKT1.

Subcellular location. Cytoplasm.

Tissue specificity. Up-regulated in atherosclerotic plaques relative to healthy segments of the same artery.

Induction. Up-regulated by oxidized LDL and hypoxia in macrophages.

Similarity. Belongs to the DDIT4 family.

RefSeq proteins (1): NP_660287* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR012918	RTP801-like	Family
IPR038281	RTP801-like_C_sf	Homologous_superfamily

Pfam: PF07809

UniProt features (2 total): chain 1, sequence variant 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q96D03-F1	77.03	0.48

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 80 (showing top): chr4q24, GCANCTGNY_MYOD_Q6, TTTGTAG_MIR520D, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_UP, GRAESSMANN_RESPONSE_TO_MC_AND_DOXORUBICIN_UP, TGACCTY_ERR1_Q2, CAGCTG_AP4_Q5, NF1_Q6_01, TGCTGAY_UNKNOWN, GROSS_HYPOXIA_VIA_ELK3_UP, SCHAEFFER_PROSTATE_DEVELOPMENT_48HR_UP, TGGNNNNNNKCCAR_UNKNOWN, HAND1E47_01, KORKOLA_EMBRYONIC_CARCINOMA_VS_SEMINOMA_DN, MARTORIATI_MDM4_TARGETS_FETAL_LIVER_UP

GO Biological Process (1): negative regulation of signal transduction (GO:0009968)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (1): cytoplasm (GO:0005737)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
signal transduction	1
regulation of signal transduction	1
negative regulation of cell communication	1
negative regulation of signaling	1
negative regulation of response to stimulus	1
binding	1
intracellular anatomical structure	1
cellular anatomical structure	1

Protein interactions and networks

STRING

394 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
DDIT4L	TP63	Q9H3D4	547
DDIT4L	TP53	P04637	481
DDIT4L	LAMTOR3	Q9UHA4	448
DDIT4L	PDK3	Q15120	423
DDIT4L	SMARCE1	Q969G3	393
DDIT4L	AP3B2	Q13367	392
DDIT4L	WFDC3	Q8IUB2	388
DDIT4L	GOLGA2	Q08379	388
DDIT4L	TNF	P01375	387
DDIT4L	TRAF3	Q13114	385
DDIT4L	IFNG	P01579	382
DDIT4L	MAPK3	P27361	381
DDIT4L	DAPP1	Q9UN19	351
DDIT4L	TSC2	P49815	350
DDIT4L	NPM2	Q86SE8	349
DDIT4L	EXTL1	Q92935	349

IntAct

686 interactions, top by confidence:

A	B	Type	Score
SNRPG	DDIT4L	psi-mi:“MI:0915”(physical association)	0.860
LSM7	DDIT4L	psi-mi:“MI:0915”(physical association)	0.780
DDIT4L	LSM7	psi-mi:“MI:0915”(physical association)	0.780
DDIT4L	MORF4L2	psi-mi:“MI:0915”(physical association)	0.720
MORF4L2	DDIT4L	psi-mi:“MI:0915”(physical association)	0.720
DDIT4L	CALCOCO2	psi-mi:“MI:0915”(physical association)	0.560
CALCOCO2	DDIT4L	psi-mi:“MI:0915”(physical association)	0.560
TRX1	DDIT4L	psi-mi:“MI:0915”(physical association)	0.560
TRX2	DDIT4L	psi-mi:“MI:0915”(physical association)	0.560
DDIT4L	TRX1	psi-mi:“MI:0915”(physical association)	0.560
DDIT4L	TRX2	psi-mi:“MI:0915”(physical association)	0.560
ZNF410	DDIT4L	psi-mi:“MI:0915”(physical association)	0.560
SEC13	DDIT4L	psi-mi:“MI:0915”(physical association)	0.560
GTPBP3	DDIT4L	psi-mi:“MI:0915”(physical association)	0.560
STAC3	DDIT4L	psi-mi:“MI:0915”(physical association)	0.560
CCNH	DDIT4L	psi-mi:“MI:0915”(physical association)	0.560
CSK	DDIT4L	psi-mi:“MI:0915”(physical association)	0.560
TARS2	DDIT4L	psi-mi:“MI:0915”(physical association)	0.560

BioGRID (165): DDIT4L (Two-hybrid), DDIT4L (Two-hybrid), DDIT4L (Two-hybrid), DDIT4L (Two-hybrid), DDIT4L (Two-hybrid), DDIT4L (Two-hybrid), LRRC15 (Affinity Capture-MS), DDIT4L (Two-hybrid), DDIT4L (Two-hybrid), TFPT (Two-hybrid), DDIT4L (Two-hybrid), DDIT4L (Two-hybrid), DDIT4L (Two-hybrid), DDIT4L (Two-hybrid), DDIT4L (Two-hybrid)

ESM2 similar proteins: A2VDT9, B2ZCQ0, B2ZCQ2, C6Y4A2, F4IVU1, I6LJ77, O70552, O75818, O94245, P04886, P07051, P08593, P08671, P0C6Z9, P13093, P13742, P25223, P29882, P34515, P40101, P40385, P41089, P52465, P83857, Q01045, Q01226, Q0GBX7, Q0GBY2, Q1X711, Q3KSR8, Q567C3, Q5R8K0, Q5UQH7, Q5VKP0, Q64962, Q66672, Q6P2I7, Q6X1D6, Q8B6J7, Q8V3U1

Diamond homologs: A2VDT9, Q08E62, Q20A00, Q2LZ58, Q5R8K0, Q6P4J6, Q7SYV9, Q7T346, Q8VD50, Q8VHZ5, Q8VHZ9, Q96D03, Q9D3F7, Q9NX09, Q9VTH4, Q9VTI8

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

34 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	30
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (0)

SpliceAI

437 predictions. Top by Δscore:

Variant	Effect	Δscore
4:100189885:ACACT:A	donor_loss	1.0000
4:100189886:CACTC:C	donor_loss	1.0000
4:100189887:ACTCA:A	donor_loss	1.0000
4:100189888:CTCAC:C	donor_loss	1.0000
4:100189889:TCACC:T	donor_loss	1.0000
4:100189890:CACCA:C	donor_loss	1.0000
4:100189891:A:AC	donor_gain	1.0000
4:100189891:AC:A	donor_gain	1.0000
4:100189892:C:CC	donor_gain	1.0000
4:100189892:C:CT	donor_loss	1.0000
4:100189892:CC:C	donor_gain	1.0000
4:100189892:CCA:C	donor_gain	1.0000
4:100189899:G:C	donor_gain	1.0000
4:100190031:CG:C	acceptor_gain	1.0000
4:100188164:AAATC:A	acceptor_loss	0.9900
4:100188165:AATC:A	acceptor_loss	0.9900
4:100188166:ATC:A	acceptor_loss	0.9900
4:100188167:TCT:T	acceptor_loss	0.9900
4:100188168:C:CC	acceptor_gain	0.9900
4:100188168:C:T	acceptor_loss	0.9900
4:100188169:T:G	acceptor_loss	0.9900
4:100189889:TCAC:T	donor_gain	0.9900
4:100189890:CACC:C	donor_gain	0.9900
4:100189891:ACCA:A	donor_gain	0.9900
4:100189892:CCAC:C	donor_gain	0.9900
4:100189892:CCACT:C	donor_gain	0.9900
4:100190029:AGCG:A	acceptor_gain	0.9900
4:100190030:GCG:G	acceptor_gain	0.9900
4:100190031:CGC:C	acceptor_gain	0.9900
4:100190033:C:CC	acceptor_gain	0.9900

AlphaMissense

1257 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
4:100187737:A:C	F174L	0.998
4:100187737:A:T	F174L	0.998
4:100187739:A:G	F174L	0.998
4:100187857:A:C	F134L	0.998
4:100187857:A:T	F134L	0.998
4:100187859:A:G	F134L	0.998
4:100187840:A:G	F140S	0.996
4:100187993:G:T	A89D	0.996
4:100187725:C:A	K178N	0.995
4:100187725:C:G	K178N	0.995
4:100187984:A:T	V92D	0.995
4:100187846:A:T	L138H	0.994
4:100187852:A:G	L136P	0.994
4:100187738:A:G	F174S	0.991
4:100187846:A:G	L138P	0.991
4:100187750:A:T	L170H	0.990
4:100188020:A:T	V80D	0.990
4:100187852:A:T	L136H	0.988
4:100187943:A:G	C106R	0.988
4:100188008:A:G	L84P	0.988
4:100187732:A:T	L176H	0.987
4:100187735:C:G	R175P	0.987
4:100187846:A:C	L138R	0.987
4:100187946:C:G	G105R	0.987
4:100187954:C:T	G102D	0.987
4:100187963:T:A	E99V	0.987
4:100188026:A:T	V78D	0.987
4:100187858:A:G	F134S	0.986
4:100187962:C:A	E99D	0.986
4:100187962:C:G	E99D	0.986

dbSNP variants (sampled 300 via entrez): RS1000058552 (4:100190532 TGCACCGCCCCTCCCCGGCCAGC>T), RS1000395053 (4:100191433 G>T), RS10007201 (4:100187175 C>T), RS1001404871 (4:100185509 T>G), RS1001431061 (4:100190513 C>G), RS1001481584 (4:100190321 G>A), RS1001565528 (4:100191006 A>G), RS1001932631 (4:100190754 C>G), RS1002317270 (4:100189812 G>A), RS1002984036 (4:100185386 C>T), RS1003086904 (4:100192067 G>C), RS1003342551 (4:100185760 A>C), RS1003583337 (4:100188385 G>T), RS1003725026 (4:100186747 A>G), RS1004438512 (4:100186127 A>C)

Disease associations

OMIM: gene MIM:607730 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

3 associations (top):

Study	Trait	p-value
GCST003999_23	Nose size	3.000000e-07
GCST007328_22	Alcohol consumption (drinks per week)	8.000000e-12
GCST007328_7	Alcohol consumption (drinks per week)	3.000000e-23

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

40 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	increases expression, affects cotreatment, decreases expression, decreases methylation	6
trichostatin A	affects cotreatment, decreases expression	3
Cadmium Chloride	decreases expression, increases abundance, increases expression	3
entinostat	decreases expression, affects cotreatment	2
Nickel	decreases expression	2
Phenylmercuric Acetate	affects cotreatment, decreases expression	2
Silicon Dioxide	decreases expression, increases expression	2
Tobacco Smoke Pollution	decreases expression, increases expression	2
Tretinoin	decreases expression, increases expression	2
p-Chloromercuribenzoic Acid	affects cotreatment, decreases expression	2
sotorasib	affects cotreatment, decreases expression	1
methylmercuric chloride	decreases expression	1
2,5,2’,5’-tetrachlorobiphenyl	increases expression	1
mono-(2-ethylhexyl)phthalate	increases expression	1
sodium arsenite	increases expression	1
S-(1,2-dichlorovinyl)cysteine	decreases expression, affects response to substance, increases expression, affects cotreatment	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	decreases expression, affects cotreatment	1
abrine	decreases expression	1
dorsomorphin	decreases expression, affects cotreatment	1
incobotulinumtoxinA	increases expression	1
trametinib	affects cotreatment, decreases expression	1
NVP-BKM120	affects cotreatment, decreases expression	1
Pioglitazone	affects cotreatment, increases expression	1
Sunitinib	decreases expression	1
Zoledronic Acid	increases expression	1
Air Pollutants	decreases expression, increases abundance	1
Benzo(a)pyrene	increases methylation, affects methylation	1
Cadmium	increases abundance, increases expression	1
Camptothecin	increases expression	1
Carbamazepine	affects expression	1

Cellosaurus cell lines

1 cell lines: 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_SK59	HAP1 DDIT4L (-)	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.