DDN

Summary

DDN (dendrin, HGNC:24458) is a protein-coding gene on chromosome 12q13.12, encoding Dendrin (O94850). Promotes apoptosis of kidney glomerular podocytes. It is a selective cancer dependency (DepMap: 27.9% of cell lines).

Predicted to enable DNA-binding transcription factor activity, RNA polymerase II-specific and RNA polymerase II cis-regulatory region sequence-specific DNA binding activity. Predicted to act upstream of or within positive regulation of transcription by RNA polymerase II. Located in cell projection and cytoplasm.

Source: NCBI Gene 23109 — RefSeq curated summary.

At a glance

• GWAS associations: 6
• Clinical variants (ClinVar): 102 total
• Cancer dependency (DepMap): dependent in 27.9% of screened cell lines
• MANE Select transcript: NM_015086

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:24458
Approved symbol	DDN
Name	dendrin
Location	12q13.12
Locus type	gene with protein product
Status	Approved
Aliases	KIAA0749
Ensembl gene	ENSG00000181418
Ensembl biotype	protein_coding
OMIM	610588
Entrez	23109

Gene structure

Transcript identifiers

Ensembl transcripts: 1 — 1 protein_coding

ENST00000421952

RefSeq mRNA: 1 — MANE Select: NM_015086 NM_015086

CCDS: CCDS31791

Canonical transcript exons

ENST00000421952 — 2 exons

Exon	Start	End
ENSE00001231872	48999079	48999375
ENSE00001884051	48995149	48998666

Expression profiles

Bgee: expression breadth ubiquitous, 162 present calls, max score 98.94.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.9347 / max 100.2676, expressed in 153 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
130772	0.6166	80
130776	0.1093	51
130777	0.1006	52
130775	0.0576	32
130774	0.0281	22
130773	0.0226	16

Top tissues by expression

277 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
gluteal muscle	UBERON:0002000	98.94	gold quality
CA1 field of hippocampus	UBERON:0003881	97.68	gold quality
cingulate cortex	UBERON:0003027	97.43	gold quality
anterior cingulate cortex	UBERON:0009835	97.43	gold quality
amygdala	UBERON:0001876	97.39	gold quality
nucleus accumbens	UBERON:0001882	97.12	gold quality
caudate nucleus	UBERON:0001873	96.86	gold quality
entorhinal cortex	UBERON:0002728	96.84	gold quality
prefrontal cortex	UBERON:0000451	96.79	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	96.75	gold quality
putamen	UBERON:0001874	96.67	gold quality
temporal lobe	UBERON:0001871	96.61	gold quality
frontal pole	UBERON:0002795	96.54	gold quality
Brodmann (1909) area 46	UBERON:0006483	96.38	gold quality
orbitofrontal cortex	UBERON:0004167	96.24	gold quality
gastrocnemius	UBERON:0001388	96.03	gold quality
frontal cortex	UBERON:0001870	95.64	gold quality
Brodmann (1909) area 9	UBERON:0013540	95.54	gold quality
right frontal lobe	UBERON:0002810	95.49	gold quality
superior frontal gyrus	UBERON:0002661	95.45	gold quality
Ammon’s horn	UBERON:0001954	95.01	gold quality
postcentral gyrus	UBERON:0002581	94.96	gold quality
telencephalon	UBERON:0001893	94.81	gold quality
cerebral cortex	UBERON:0000956	94.73	gold quality
neocortex	UBERON:0001950	94.70	gold quality
renal glomerulus	UBERON:0000074	94.01	gold quality
metanephric glomerulus	UBERON:0004736	94.01	gold quality
parietal lobe	UBERON:0001872	93.47	gold quality
muscle of leg	UBERON:0001383	93.23	gold quality
Brodmann (1909) area 10	UBERON:0013541	92.49	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-GEOD-114530	yes	1042.16
E-HCAD-10	yes	16.99
E-MTAB-7249	no	6.11
E-ANND-3	no	0.80

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

97 targeting DDN, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-6851-5P	100.00	65.63	1294
HSA-MIR-3689D	100.00	66.14	1181
HSA-MIR-4673	100.00	66.64	1490
HSA-MIR-5193	100.00	67.26	1744
HSA-MIR-3667-3P	99.99	67.17	1636
HSA-MIR-5696	99.98	72.36	4487
HSA-MIR-4645-5P	99.98	65.81	1284
HSA-MIR-4725-3P	99.96	69.53	2520
HSA-MIR-6780B-5P	99.96	69.60	2562
HSA-MIR-6825-5P	99.96	69.81	3431
HSA-MIR-2110	99.96	66.68	1930
HSA-MIR-381-3P	99.93	71.87	2854
HSA-MIR-300	99.92	71.76	2856
HSA-MIR-8063	99.91	69.76	3146
HSA-MIR-4493	99.90	66.48	977
HSA-MIR-4271	99.88	68.32	2244
HSA-MIR-6124	99.87	69.78	3551
HSA-MIR-579-3P	99.86	71.66	3628
HSA-MIR-4728-5P	99.85	69.39	4718
HSA-MIR-765	99.84	68.24	2442
HSA-MIR-664B-3P	99.84	71.65	3590
HSA-MIR-6785-5P	99.82	68.68	4428
HSA-MIR-3934-3P	99.76	65.51	1351
HSA-MIR-11181-3P	99.75	66.38	2205
HSA-MIR-1255A	99.74	68.09	744
HSA-MIR-1255B-5P	99.74	68.16	741
HSA-MIR-1976	99.74	65.48	1127
HSA-MIR-4719	99.73	72.10	3329
HSA-MIR-6752-3P	99.72	66.71	1587
HSA-MIR-149-3P	99.72	68.22	3963

Functional genomics

DepMap (CRISPR cell-line fitness): dependent in 27.9% of screened cell lines.

Literature-anchored findings (GeneRIF, showing 6)

• In minimal change nephrotic syndrome, dendrin and ZO-1 are re-distributed within the podocytes. Whether this is a cause or a consequence of foot process effacement remains unclear. (PMID:18356187)
• Relocation of dendrin to the podocyte nuclei is useful as a novel marker of podocyte injury in human glomerulopathy. (PMID:21606645)
• Increasing number of dendrin-positive nuclei in the glomeruli suggest acute glomerular injury in IgA nephropathy. (PMID:23143340)
• YAP binding to dendrin is a prosurvival mechanism in podocytes. (PMID:23667252)
• The number of dendrin positive nuclei was higher in podocytopathies than in inflammatory glomerular diseases and correlated with chronic tubulointerstitial changes and lower creatinine clearance. (PMID:30458823)
• The role of dendrin in IgA nephropathy. (PMID:35767852)

Cross-species orthologs

2 orthologs

Organism	Symbol	Gene ID
mus_musculus	Ddn	ENSMUSG00000059213
rattus_norvegicus	Ddn	ENSRNOG00000059605

Protein

Protein identifiers

Dendrin — O94850 (reviewed: O94850)

All UniProt accessions (1): O94850

UniProt curated annotations — full annotation on UniProt →

Function. Promotes apoptosis of kidney glomerular podocytes. Podocytes are highly specialized cells essential to the ultrafiltration of blood, resulting in the extraction of urine and the retention of protein.

Subunit / interactions. Forms a ternary complex with MAGI2 and SH3KBP1; recruits DDN to the cytoplasm. Interacts with MAGI1. Interacts with ACTN1 and may interact with WWC1. Interacts with the podocyte slit diaphragm proteins CD2AP, NPHS1 and NPHS2; the interaction with CD2AP and NPHS1 is direct.

Subcellular location. Cell projection. Dendritic spine membrane. Cytoplasm. Endoplasmic reticulum membrane. Perikaryon. Nucleus.

Tissue specificity. Specifically expressed in brain and kidney. Expressed in kidney glomerular capillary loops (at protein level).

RefSeq proteins (1): NP_055901* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR026500	Dendrin	Family

Pfam: PF15498

UniProt features (18 total): region of interest 8, compositionally biased region 6, chain 1, modified residue 1, sequence variant 1, coiled-coil region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O94850-F1	46.28	0.01

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1): 389

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 115 (showing top): GOCC_NEURON_PROJECTION, MORF_WNT1, CUI_TCF21_TARGETS_2_DN, MODULE_48, MODULE_95, SHEN_SMARCA2_TARGETS_DN, GOCC_CELL_PROJECTION_MEMBRANE, GOCC_POSTSYNAPSE, GOCC_NEURON_SPINE, GOCC_LEADING_EDGE_MEMBRANE, CTGAGCC_MIR24, GOCC_SYNAPSE, GOCC_DENDRITE_MEMBRANE, GOCC_NUCLEAR_OUTER_MEMBRANE_ENDOPLASMIC_RETICULUM_MEMBRANE_NETWORK, GOCC_PLASMA_MEMBRANE_REGION

GO Biological Process (1): positive regulation of transcription by RNA polymerase II (GO:0045944)

GO Molecular Function (3): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), protein binding (GO:0005515)

GO Cellular Component (14): nucleus (GO:0005634), cytoplasm (GO:0005737), endoplasmic reticulum membrane (GO:0005789), dendritic spine membrane (GO:0032591), cell projection (GO:0042995), perikaryon (GO:0043204), presynapse (GO:0098793), endoplasmic reticulum (GO:0005783), plasma membrane (GO:0005886), membrane (GO:0016020), dendrite (GO:0030425), synapse (GO:0045202), postsynaptic membrane (GO:0045211), postsynapse (GO:0098794)

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
cellular anatomical structure	6
regulation of transcription by RNA polymerase II	2
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
intracellular membrane-bounded organelle	2
synaptic membrane	2
synapse	2
transcription by RNA polymerase II	1
positive regulation of DNA-templated transcription	1
cis-regulatory region sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1
binding	1
intracellular anatomical structure	1
organelle membrane	1
nuclear outer membrane-endoplasmic reticulum membrane network	1
endoplasmic reticulum subcompartment	1
neuron projection membrane	1
dendrite membrane	1
dendritic spine	1
neuronal cell body	1
cytoplasm	1
endomembrane system	1
membrane	1
cell periphery	1
neuron projection	1
dendritic tree	1
cell junction	1
postsynapse	1

Protein interactions and networks

STRING

752 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
DDN	WWC1	Q8IX03	998
DDN	NPHS1	O60500	759
DDN	SYNPO	Q8N3V7	723
DDN	CD2AP	Q9Y5K6	697
DDN	CCDC192	P0DO97	648
DDN	KIRREL1	Q96J84	551
DDN	CTXN3	Q4LDR2	549
DDN	FGD1	P98174	528
DDN	KIRREL3	Q8IZU9	459
DDN	FAT2	Q9NYQ8	444
DDN	AICDA	Q9GZX7	419
DDN	FAT1	Q14517	408
DDN	DDR1	Q08345	396
DDN	MAGI2	Q86UL8	392
DDN	NCK1	P16333	387

IntAct

14 interactions, top by confidence:

A	B	Type	Score
DDN	SH3KBP1	psi-mi:“MI:0915”(physical association)	0.620
SH3KBP1	DDN	psi-mi:“MI:0915”(physical association)	0.620
NEDD4	DDN	psi-mi:“MI:0407”(direct interaction)	0.440
YAP1	DDN	psi-mi:“MI:0407”(direct interaction)	0.440
DDN	RALA	psi-mi:“MI:0915”(physical association)	0.400
DDN	Magi2	psi-mi:“MI:0915”(physical association)	0.400
Magi2	DDN	psi-mi:“MI:0915”(physical association)	0.400
DDN	Magi1	psi-mi:“MI:0915”(physical association)	0.370
SH3KBP1	Magi2	psi-mi:“MI:0914”(association)	0.350
CD2AP	DDN	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (12): RALA (Proximity Label-MS), DDN (Protein-peptide), DDN (Protein-peptide), DDN (Affinity Capture-RNA), MAGI1 (Two-hybrid), ACTN1 (Two-hybrid), MAGI1 (Reconstituted Complex), ACTN1 (Reconstituted Complex), MAGI1 (Co-localization), ACTN1 (Co-localization), SH3KBP1 (Affinity Capture-Western), DDN (Affinity Capture-Western)

ESM2 similar proteins: A0A0U1RRK4, A0A1W2PPE3, A0A1W2PR82, A0A2Z4LIS9, A2VE02, A4D1S0, A5PKC7, A5PL33, A6H7B4, A6NEL2, A6QP24, A6QPM6, A8MTW9, A8MYA2, D3ZAQ5, D4AAA5, E7EW31, O75474, O75638, O89113, O94850, P0C7X2, P14652, P50617, P70339, Q2KIS6, Q3UN58, Q5JPB2, Q5VZ46, Q6GQX2, Q6NZ36, Q6ZSJ8, Q6ZW13, Q76NI1, Q7TNS8, Q80TS7, Q86UU5, Q8IWN7, Q8N6K4, Q8N944

Diamond homologs: O94850, P50617, Q80TS7

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

102 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	93
Likely benign	5
Benign	2

Top pathogenic / likely-pathogenic (0)

SpliceAI

198 predictions. Top by Δscore:

Variant	Effect	Δscore
12:48999072:CACT:C	donor_loss	1.0000
12:48999073:ACTC:A	donor_loss	1.0000
12:48999074:CTCA:C	donor_loss	1.0000
12:48999075:TCACG:T	donor_loss	1.0000
12:48999076:C:CC	donor_loss	1.0000
12:48999077:A:AC	donor_gain	1.0000
12:48999077:ACGT:A	donor_loss	1.0000
12:48999078:C:A	donor_loss	1.0000
12:48999078:C:CC	donor_gain	1.0000
12:48999078:CGTG:C	donor_gain	1.0000
12:48999062:ACC:A	donor_gain	0.9900
12:48999063:CCC:C	donor_gain	0.9900
12:48999077:ACGTG:A	donor_gain	0.9900
12:48999078:CGT:C	donor_gain	0.9900
12:48999078:CGTGC:C	donor_gain	0.9900
12:48999071:TCAC:T	donor_loss	0.9800
12:48999078:CG:C	donor_gain	0.9800
12:48999064:CCC:C	donor_gain	0.9600
12:48999181:A:AC	donor_gain	0.9600
12:48999073:A:AC	donor_gain	0.9400
12:48999074:C:CC	donor_gain	0.9400
12:48999081:G:A	donor_gain	0.9400
12:48999071:T:TA	donor_gain	0.8900
12:48999058:C:A	donor_gain	0.8800
12:48999076:C:CG	donor_gain	0.8800
12:48998536:T:A	donor_gain	0.8700
12:48999065:C:T	donor_gain	0.8700
12:48999075:TCA:T	donor_gain	0.8700
12:48999077:A:G	donor_gain	0.8700
12:48999070:TTCAC:T	donor_gain	0.8600

AlphaMissense

4491 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
12:48997023:A:G	I618T	0.999
12:48997023:A:C	I618S	0.998
12:48997023:A:T	I618N	0.998
12:48997491:A:T	I462K	0.997
12:48997026:C:G	R617P	0.996
12:48997509:T:A	D456V	0.996
12:48997512:A:T	I455N	0.996
12:48997515:A:T	V454D	0.996
12:48997517:A:C	F453L	0.996
12:48997517:A:T	F453L	0.996
12:48997518:A:G	F453S	0.996
12:48997519:A:G	F453L	0.996
12:48997021:G:T	R619S	0.995
12:48997491:A:C	I462R	0.995
12:48997491:A:G	I462T	0.995
12:48997500:C:T	C459Y	0.995
12:48997027:G:T	R617S	0.994
12:48997036:C:G	A614P	0.994
12:48997499:G:C	C459W	0.994
12:48997512:A:C	I455S	0.994
12:48999181:A:T	I36K	0.994
12:48997008:G:T	A623D	0.993
12:48997017:C:G	R620P	0.993
12:48997020:C:G	R619P	0.993
12:48997497:A:T	V460E	0.993
12:48997013:G:C	H621Q	0.992
12:48997013:G:T	H621Q	0.992
12:48997015:G:C	H621D	0.992
12:48998270:G:C	S202R	0.992
12:48998270:G:T	S202R	0.992

dbSNP variants (sampled 300 via entrez): RS1000060268 (12:48995518 G>A,C,T), RS1000594281 (12:48997406 G>A), RS1000603715 (12:48999503 C>G), RS1001545392 (12:48999541 G>C), RS1001717698 (12:48998371 C>G,T), RS1002231985 (12:48998713 G>A,C), RS1002698870 (12:49000209 TTTATGGAGGACAGAGTAAGTGC>T), RS1002962281 (12:49001033 T>A,C), RS1003730870 (12:48994811 G>T), RS1003795433 (12:48996875 T>C), RS1004517056 (12:48996158 T>C), RS1004557064 (12:49000543 C>T), RS1005243415 (12:49000823 G>A), RS1005804557 (12:48999937 T>G), RS1006300842 (12:48994970 G>A,T)

Disease associations

OMIM: gene MIM:610588 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

6 associations (top):

Study	Trait	p-value
GCST003724_5	Bipolar disorder	1.000000e-08
GCST004139_23	Bipolar disorder	6.000000e-08
GCST006288_13	Heel bone mineral density	6.000000e-16
GCST006288_389	Heel bone mineral density	2.000000e-11
GCST006979_1055	Heel bone mineral density	3.000000e-70
GCST008103_109	Bipolar disorder	4.000000e-06

EFO canonical traits (1, from GWAS)

EFO ID	Trait name
EFO:0009270	heel bone mineral density

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

28 total (human), top 28 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Resveratrol	affects cotreatment, decreases expression	2
Benzo(a)pyrene	decreases methylation, increases mutagenesis	2
aristolochic acid I	increases expression	1
TAK-243	increases sumoylation	1
bisphenol A	decreases expression	1
trichostatin A	affects expression	1
sulforaphane	decreases expression	1
sodium arsenite	affects expression	1
CGP 52608	increases reaction, affects binding	1
2-(1H-indazol-4-yl)-6-(4-methanesulfonylpiperazin-1-ylmethyl)-4-morpholin-4-ylthieno(3,2-d)pyrimidine	increases response to substance	1
bisphenol S	affects cotreatment, increases expression	1
(+)-JQ1 compound	decreases expression	1
Sunitinib	increases expression	1
Fulvestrant	increases methylation	1
Acetaminophen	decreases expression	1
Cisplatin	decreases expression	1
Copper	affects cotreatment, decreases expression	1
Dexamethasone	affects cotreatment, increases expression	1
Ethyl Methanesulfonate	decreases expression	1
Indomethacin	affects cotreatment, increases expression	1
Methyl Methanesulfonate	decreases expression	1
Plant Extracts	affects cotreatment, decreases expression	1
Smoke	decreases expression	1
Tobacco Smoke Pollution	increases expression	1
Triclosan	decreases expression	1
Valproic Acid	affects expression	1
1-Methyl-3-isobutylxanthine	affects cotreatment, increases expression	1
Okadaic Acid	increases expression	1

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.