DHFR

Summary

DHFR (dihydrofolate reductase, HGNC:2861) is a protein-coding gene on chromosome 5q14.1, encoding Dihydrofolate reductase (P00374). Catalyzes the reduction of 7,8-dihydrofolate (DHF) to 5,6,7,8-tetrahydrofolate in a NADPH-dependent manner. It is a selective cancer dependency (DepMap: 69.8% of cell lines).

Dihydrofolate reductase converts dihydrofolate into tetrahydrofolate, a methyl group shuttle required for the de novo synthesis of purines, thymidylic acid, and certain amino acids. While the functional dihydrofolate reductase gene has been mapped to chromosome 5, multiple intronless processed pseudogenes or dihydrofolate reductase-like genes have been identified on separate chromosomes. Dihydrofolate reductase deficiency has been linked to megaloblastic anemia. Several transcript variants encoding different isoforms have been found for this gene.

Source: NCBI Gene 1719 — RefSeq curated summary.

At a glance

• Gene–disease (curated): constitutional megaloblastic anemia with severe neurologic disease (Definitive, GenCC)
• GWAS associations: 9
• Clinical variants (ClinVar): 615 total — 26 pathogenic, 12 likely-pathogenic (top 5% of genes corpus-wide)
• GTEx eGene: eQTL in 49 tissues, sQTL in 1 (q < 0.05)
• Phenotypes (HPO): 25
• Drug target: yes — 5 curated mechanism-of-action drugs; 23 molecules with ChEMBL bioactivity (top 2% of genes corpus-wide)
• Approved drugs (ChEMBL mechanism of action): 4 — Methotrexate, Pemetrexed, Pemetrexed Dipotassium, +1 more
• Cancer dependency (DepMap): dependent in 69.8% of screened cell lines
• Constraint (gnomAD): pLI 0.06 (LoF-tolerant), LOEUF 0.99 (unconstrained)
• MANE Select transcript: NM_000791
• Interaction hub: 2,846 STRING partners (top 3% of genes corpus-wide)

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2861
Approved symbol	DHFR
Name	dihydrofolate reductase
Location	5q14.1
Locus type	gene with protein product
Status	Approved
Aliases	DHFR1
Ensembl gene	ENSG00000228716
Ensembl biotype	protein_coding
OMIM	126060
Entrez	1719

Gene structure

Transcript identifiers

Ensembl transcripts: 19 — 13 protein_coding, 3 nonsense_mediated_decay, 2 retained_intron, 1 protein_coding_CDS_not_defined

MANE Select: ENST00000439211

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 2, TSL 2: 3, TSL 3: 2

ENST00000439211, ENST00000504396, ENST00000505337, ENST00000508282, ENST00000511032, ENST00000513048, ENST00000513314, ENST00000935289, ENST00001027427, ENST00001081227, ENST00001081228, ENST00001091254, ENST00001091255, ENST00001106721, ENST00001130235, ENST00001130236, ENST00001130237, ENST00001130238, ENST00001132022

RefSeq mRNA: 3 — MANE Select: NM_000791 NM_000791, NM_001290354, NM_001290357

CCDS: CCDS47240, CCDS78028, CCDS78029

Canonical transcript exons

ENST00000439211 — 6 exons

Exon	Start	End
ENSE00001563315	80626226	80629165
ENSE00001594858	80654008	80654057
ENSE00001752304	80654404	80654983
ENSE00003465725	80633877	80633992
ENSE00003645386	80649389	80649494
ENSE00003668681	80637883	80638009

Expression profiles

Bgee: expression breadth ubiquitous, 290 present calls, max score 98.32.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 8.0997 / max 78.0778, expressed in 1754 samples.

Highest expression (Bgee): buccal mucosa cell, ventricular zone, ganglionic eminence, embryo, trabecular bone tissue.

Genetic regulation across tissues (GTEx eQTL / sQTL)

DHFR is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 49 tissues and its splicing (sQTL) in 1 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 50 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Muscle Skeletal	eqtl	8.6e-153	-1.02	5:80654880:TGCAGCGGCTGCAGCGGCC:T
Whole Blood	eqtl	1.4e-108	-0.66	5:80621698:A:G
Adipose Subcutaneous	eqtl	2.7e-90	-0.60	5:80651697:A:C
Testis	eqtl	1.8e-81	-0.78	5:80628382:C:T
Adipose Visceral Omentum	eqtl	1.0e-71	-0.56	5:80626530:C:A
Cells Cultured fibroblasts	eqtl	5.2e-67	-0.28	5:80651697:A:C
Artery Tibial	eqtl	3.6e-65	-0.64	5:80654344:C:CTGGCGCGTCCCGCCCAGGT
Cells EBV-transformed lymphocytes	eqtl	3.0e-63	-0.41	5:80648285:T:C
Nerve Tibial	eqtl	1.4e-59	+0.61	5:80655314:T:C
Colon Sigmoid	eqtl	8.8e-58	-0.86	5:80648285:T:C
Esophagus Muscularis	eqtl	1.4e-55	-0.65	5:80654344:C:CTGGCGCGTCCCGCCCAGGT
Heart Atrial Appendage	eqtl	2.7e-48	-0.81	5:80654880:TGCAGCGGCTGCAGCGGCC:T
Esophagus Gastroesophageal Junction	eqtl	1.1e-47	-0.69	5:80654344:C:CTGGCGCGTCCCGCCCAGGT
Heart Left Ventricle	eqtl	2.1e-43	-0.71	5:80646379:A:G
Thyroid	eqtl	1.6e-41	+0.54	5:80680569:T:C
Breast Mammary Tissue	eqtl	5.9e-41	-0.46	5:80654880:TGCAGCGGCTGCAGCGGCC:T
Colon Transverse	eqtl	1.5e-38	-0.44	5:80654880:TGCAGCGGCTGCAGCGGCC:T
Skin Sun Exposed Lower leg	eqtl	5.5e-38	-0.34	5:80654344:C:CTGGCGCGTCCCGCCCAGGT
Artery Aorta	eqtl	1.1e-37	+0.63	5:80664309:G:T
Brain Cortex	eqtl	4.3e-36	-0.88	5:80654880:TGCAGCGGCTGCAGCGGCC:T

FANTOM5 promoters

3 alternative TSS:

Promoter ID	TPM avg	Samples expressed
62314	7.8786	1750
62313	0.2084	99
62312	0.0128	5

Top tissues by expression

showing 100 of 295 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
buccal mucosa cell	CL:0002336	98.32	gold quality
ventricular zone	UBERON:0003053	97.43	gold quality
ganglionic eminence	UBERON:0004023	96.56	gold quality
embryo	UBERON:0000922	96.35	gold quality
trabecular bone tissue	UBERON:0002483	95.28	gold quality
bone marrow	UBERON:0002371	94.37	gold quality
bone marrow cell	CL:0002092	93.45	gold quality
oocyte	CL:0000023	93.03	gold quality
inferior vagus X ganglion	UBERON:0005363	91.65	gold quality
jejunal mucosa	UBERON:0000399	91.54	gold quality
endothelial cell	CL:0000115	91.12	gold quality
rectum	UBERON:0001052	91.09	gold quality
subthalamic nucleus	UBERON:0001906	91.03	gold quality
nephron tubule	UBERON:0001231	90.11	gold quality
medial globus pallidus	UBERON:0002477	90.02	gold quality
tongue squamous epithelium	UBERON:0006919	89.77	gold quality
secondary oocyte	CL:0000655	89.68	gold quality
vermiform appendix	UBERON:0001154	89.68	gold quality
caecum	UBERON:0001153	89.53	gold quality
globus pallidus	UBERON:0001875	89.49	gold quality
duodenum	UBERON:0002114	89.44	gold quality
lymph node	UBERON:0000029	89.43	gold quality
jejunum	UBERON:0002115	89.34	gold quality
spinal cord	UBERON:0002240	89.32	gold quality
thymus	UBERON:0002370	89.27	gold quality
medulla oblongata	UBERON:0001896	89.24	gold quality
liver	UBERON:0002107	89.21	gold quality
C1 segment of cervical spinal cord	UBERON:0006469	89.21	gold quality
renal medulla	UBERON:0000362	89.20	gold quality
colonic epithelium	UBERON:0000397	89.11	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	89.10	gold quality
cervix squamous epithelium	UBERON:0006922	89.03	gold quality
ventral tegmental area	UBERON:0002691	88.94	gold quality
dorsal plus ventral thalamus	UBERON:0001897	88.72	gold quality
superior vestibular nucleus	UBERON:0007227	88.67	gold quality
colonic mucosa	UBERON:0000317	88.60	gold quality
superficial temporal artery	UBERON:0001614	88.50	gold quality
tonsil	UBERON:0002372	88.31	gold quality
mucosa of sigmoid colon	UBERON:0004993	88.31	gold quality
endometrium	UBERON:0001295	87.62	gold quality
midbrain	UBERON:0001891	87.32	gold quality
epithelium of nasopharynx	UBERON:0001951	87.32	gold quality
CA1 field of hippocampus	UBERON:0003881	87.22	gold quality
substantia nigra	UBERON:0002038	87.12	gold quality
lateral globus pallidus	UBERON:0002476	86.99	gold quality
substantia nigra pars compacta	UBERON:0001965	86.50	gold quality
diaphragm	UBERON:0001103	86.41	gold quality
epithelial cell of pancreas	CL:0000083	86.32	silver quality
pigmented layer of retina	UBERON:0001782	86.31	gold quality
kidney epithelium	UBERON:0004819	86.23	gold quality
substantia nigra pars reticulata	UBERON:0001966	86.22	gold quality
mucosa of paranasal sinus	UBERON:0005030	86.02	gold quality
synovial joint	UBERON:0002217	85.90	gold quality
lateral nuclear group of thalamus	UBERON:0002736	85.79	gold quality
epithelium of mammary gland	UBERON:0003244	85.78	gold quality
squamous epithelium	UBERON:0006914	85.66	gold quality
cranial nerve II	UBERON:0000941	85.64	gold quality
right lobe of liver	UBERON:0001114	85.63	gold quality
mammary duct	UBERON:0001765	85.59	gold quality
tibia	UBERON:0000979	85.37	gold quality
kidney	UBERON:0002113	85.27	gold quality
hypothalamus	UBERON:0001898	85.03	gold quality
superior surface of tongue	UBERON:0007371	85.03	gold quality
mucosa of transverse colon	UBERON:0004991	85.01	gold quality
dorsal motor nucleus of vagus nerve	UBERON:0002870	84.99	gold quality
pons	UBERON:0000988	84.94	gold quality
adipose tissue	UBERON:0001013	84.86	gold quality
connective tissue	UBERON:0002384	84.81	gold quality
amygdala	UBERON:0001876	84.79	gold quality
oral cavity	UBERON:0000167	84.73	gold quality
metanephros	UBERON:0000081	84.67	gold quality
gingival epithelium	UBERON:0001949	84.64	gold quality
esophagus squamous epithelium	UBERON:0006920	84.62	gold quality
mammalian vulva	UBERON:0000997	84.52	gold quality
Ammon’s horn	UBERON:0001954	84.51	gold quality
epithelium of esophagus	UBERON:0001976	84.47	gold quality
adrenal tissue	UBERON:0018303	84.43	gold quality
endometrium epithelium	UBERON:0004811	84.41	gold quality
mammary gland	UBERON:0001911	84.39	gold quality
thoracic mammary gland	UBERON:0005200	84.35	gold quality
tongue	UBERON:0001723	84.16	gold quality
putamen	UBERON:0001874	83.89	gold quality
smooth muscle tissue	UBERON:0001135	83.88	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	83.85	gold quality
choroid plexus epithelium	UBERON:0003911	83.84	gold quality
calcaneal tendon	UBERON:0003701	83.83	gold quality
pylorus	UBERON:0001166	83.81	gold quality
pancreatic ductal cell	CL:0002079	83.78	gold quality
inferior olivary complex	UBERON:0002127	83.78	gold quality
parietal pleura	UBERON:0002400	83.76	gold quality
amniotic fluid	UBERON:0000173	83.72	gold quality
cortex of kidney	UBERON:0001225	83.68	gold quality
stromal cell of endometrium	CL:0002255	83.64	gold quality
gingiva	UBERON:0001828	83.45	gold quality
pleura	UBERON:0000977	83.40	gold quality
metanephric glomerulus	UBERON:0004736	83.31	gold quality
germinal epithelium of ovary	UBERON:0001304	83.30	gold quality
occipital lobe	UBERON:0002021	83.26	gold quality
Brodmann (1909) area 23	UBERON:0013554	83.22	gold quality
temporal lobe	UBERON:0001871	83.17	gold quality

Single-cell (SCXA)

Detected in 10 experiment(s), a significant marker in 7.

Experiment	Marker?	Max mean expression
E-GEOD-93593	yes	254.25
E-GEOD-76312	yes	236.38
E-GEOD-81383	yes	158.39
E-CURD-112	yes	38.54
E-CURD-122	yes	25.07
E-GEOD-125970	yes	21.22
E-ANND-3	yes	7.63
E-MTAB-6379	no	400.53
E-MTAB-6524	no	182.41
E-MTAB-6108	no	148.74

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 79 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Thymus	tissue	56.4
Liver	tissue	56.1	low
Bone marrow	tissue	51.2	medium
Lymph node	tissue	38.6	medium
Tonsil	tissue	36.9	medium
Tongue	tissue	23.9
Rectum	tissue	23.7	medium
Small intestine	tissue	23.6	high
Adipose tissue	tissue	23.5	not detected
Duodenum	tissue	23.0	high
Colon	tissue	20.0	medium
Kidney	tissue	19.8	medium
Appendix	tissue	19.5	medium
Skeletal muscle	tissue	18.3	medium
Corpus callosum	tissue	17.7
Putamen	tissue	17.6
Spinal cord	tissue	17.4
Septum	tissue	17.4
Testis	tissue	17.3	medium
Superior colliculi	tissue	17.3
Midbrain	tissue	17.1
Ventral forebrain	tissue	17.1
Basal ganglia	tissue	16.8	low
Cerebellum	tissue	16.4	medium
Hippocampal formation	tissue	15.7
Periaqueductal gray	tissue	15.5
Pons	tissue	15.4
Substantia nigra	tissue	14.8
Medulla oblongata	tissue	14.7
Hypothalamus	tissue	14.7
Thalamus	tissue	14.6
Nucleus accumbens	tissue	14.2
Hippocampus	tissue	13.9	low
Locus coeruleus	tissue	13.8
Placenta	tissue	13.5	high
Esophagus	tissue	13.3	low
Choroid plexus	tissue	13.2
Cerebral cortex	tissue	12.8	low
Somatosensory cortex	tissue	12.8
Occipital cortex	tissue	12.7
Olfactory bulb	tissue	12.5
Prefrontal cortex	tissue	11.5
Stomach 1	tissue	11.5	medium
Entorhinal cortex	tissue	11.3
Breast	tissue	11.2	medium
Temporal cortex	tissue	11.2
Smooth muscle	tissue	11.1	medium
Motor cortex	tissue	10.7
Retrosplenial cortex	tissue	10.7
Amygdala	tissue	10.4
Retrosplenial and cingulate cortex	tissue	10.3
Postcentral gyrus	tissue	9.9
Spleen	tissue	9.7	low
Urinary bladder	tissue	9.6	medium
Retina	tissue	9.5
Insular cortex	tissue	9.4
Skin 1	tissue	9.2	medium
Seminal vesicle	tissue	8.9	high
Ovary	tissue	8.7	low
Parathyroid gland	tissue	8.6	low

Brain sub-regions (HPA Brain Atlas): detected in 191; highest nTPM — Cerebellar white matter (21.8), Temporal white matter (21.3), Cervical spinal cord, ventral horn (20.4), Nucleus gracilis (20.3), Parieto-temporal junction (white matter) (20.3).

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): CUX1, E2F1, E2F4, ELK3, MYC, NR0B2, NR3C1, RB1, RBL2, SP1, SP2, TBP, TFDP1

miRNA regulators (miRDB)

Targeting DHFR by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 101 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-656-3P	100.00	72.15	2788
HSA-MIR-4795-3P	100.00	74.62	4024
HSA-MIR-4455	100.00	65.48	1587
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-548AJ-3P	99.96	73.38	5345
HSA-MIR-548X-3P	99.96	73.38	5345
HSA-MIR-570-3P	99.96	72.41	4910
HSA-MIR-548J-3P	99.94	72.61	4881
HSA-MIR-335-3P	99.93	73.36	4958
HSA-MIR-548AE-3P	99.93	72.66	4867
HSA-MIR-548AH-3P	99.93	72.54	4872
HSA-MIR-548AM-3P	99.93	72.54	4872
HSA-MIR-548AQ-3P	99.93	72.66	4867
HSA-MIR-10523-5P	99.91	69.22	2038
HSA-MIR-8062	99.88	68.43	995
HSA-MIR-30A-3P	99.87	69.74	2928
HSA-MIR-30D-3P	99.87	69.92	2917
HSA-MIR-30E-3P	99.87	69.68	2942
HSA-MIR-5003-3P	99.85	69.29	2517
HSA-MIR-576-5P	99.84	70.46	2582
HSA-MIR-5010-3P	99.83	70.60	2357
HSA-MIR-4420	99.82	70.08	1624
HSA-MIR-181B-2-3P	99.81	70.06	1646
HSA-MIR-181B-3P	99.81	70.06	1646
HSA-MIR-374C-5P	99.80	72.06	2910
HSA-MIR-655-3P	99.80	72.19	2909
HSA-MIR-2681-5P	99.75	67.64	1655
HSA-MIR-6885-3P	99.75	70.36	3187

Functional genomics

gnomAD constraint: pLI 0.0608, LOEUF 0.994, missense Z 1.7 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000439211 splits into 3 regions with different missense tolerance; 0 are missense-constrained. Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
5:80,629,090–80,637,932	45 / 95.3	0.47	no
5:80,637,933–80,649,471	59 / 59.5	0.99	no
5:80,649,472–80,654,489	38 / 66.4	0.57	no
DepMap (CRISPR cell-line fitness): dependent in 69.8% of screened cell lines.

Most-dependent cell lines (DepMap gene-effect, lower = stronger; ≤ −0.5 shown): NCI-H2171 (-2.651), PC-14 (-2.137), NCI-H209 (-2.114), CAL-120 (-2.101), KMS-20 (-2.034), SNU-1196 (-1.932), SUP-M2 (-1.869), JH-EsoAd1 (-1.865), AsPC-1 (-1.856), JHH-6 (-1.824), KELLY (-1.799), VCaP (-1.797), KU812 (-1.783), KARPAS-299 (-1.779), PA-TU-8988S (-1.763).

Literature-anchored findings (GeneRIF, showing 40)

• protein folding of dihydrofolate reductases (DHFR) from human, Escherichia coli, and Lactobacillus casei were elucidated and compared using intrinsic Trp fluorescence and fluorescence-detected ANS binding (PMID:11779239)
• studied differences between the regulation of Plasmodium and human dihydrofolate reductases (PMID:11964483)
• Computer modeling studies of the structural role of NADPH binding to active site mutants of human dihydrofolate reductase in complex with piritrexim (PMID:11996001)
• Molecular mechanisms that govern translational regulation of DHFR in response to MTX. Review. (PMID:12084458)
• The crystal structures of two human dihydrofolate reductase (hDHFR) ternary complexes, each with bound NADPH cofactor and a lipophilic antifolate inhibitor, have been determined at atomic resolution. (PMID:12096917)
• Identification of amino acid residues on dihydrofolate reductase protein that mediate binding to its own mRNA (PMID:12384595)
• E2F-responsive dihydrofolate reductase promoter regulates the balance between acetylation and methylation of histone H3 lysine 9 (PMID:12588981)
• RNA polymerase II accumulates in the promoter-proximal region of the dihydrofolate reductase and gamma-actin genes. (PMID:12612070)
• cooperative regulation of dhfr gene transcription by Sp1 and E2F in human osteosarcoma cells, U2OS (PMID:12788094)
• Characterization of a cis-acting regulatory element in dihydrofolate reductase mRNA that functions as a dihydrofolate reductase response element. (PMID:14664697)
• Amplification of the DHFR gene may occur more frequently in the presence of RB1-mediated negative regulation of its activity and can be present at clinical onset in osteosarcoma patients (PMID:14679136)
• The polymorphic alleles that diminish bioavailability of reduced folate in the mother during pregnancy was found to contribute to SB and found to be a 19 bp deletion allele (frequency 0.45) within intron-1 of dihydrofolate reductase (DHFR). (PMID:14735580)
• DHFR exists in two conformations, one bound to DHFR mRNA and the other bound to NADPH (PMID:15817466)
• GroEL bound hDHFR might best be described as a dynamic ensemble of randomly structured conformers (PMID:16116078)
• Point mutations in 5 codons of the DHFR gene, which is known to be related to pyrimethamine resistance, were detected in 15 out of the 50 samples (30%). (PMID:16124424)
• The Expression of baseline dihydrofolate reductase and glycinamide ribonucleotide formyl transferase tended to be higher in responders but this association was not significant. (PMID:16467096)
• switch-like behavior results from a well-studied mechanism for the action of human dihydrofolate reductase (PMID:16735474)
• The 19-bp deletion genotype of DHFR gene was associated with a lower plasma total Homocysteine compared with the wild-type genotype. (PMID:16969375)
• transcriptional repression of the major promoter of the dihydrofolate reductase gene depends on a non-coding transcript initiated from the upstream minor promoter and involves both the direct interaction of the RNA and promoter-specific interference (PMID:17237763)
• We did not find evidence for an effect of the DHFR 19-bp deletion or 9-bp repeat on spina bifida risk in mothers and children. (PMID:17336564)
• DHFR 19-bp deletion polymorphism affects the transcription of DHFR gene in humans (PMID:17413111)
• The DHFR intron 19-bp deletion allele may be a protective neural tube defects genetic factor by increasing DHFR mRNA levels in pregnant women. (PMID:17486595)
• study reports that the 19bp-deletion polymorphism of DHFR acts independently (OR 2.69, 95% CI; 1.00-7.28, p<0.05) and in concert with related folate polymorphisms as a significant risk factor for autism (PMID:17597297)
• The tea polyphenol, epigallocatechin-3-gallate, is an efficient inhibitor of human dihydrofolate reductase. (PMID:17683969)
• Preinvasive cervical lesions display locus specific gene amplification of DHFR, and could be considered as a biological marker for genomic instability in the cervix. (PMID:17917571)
• DHFR27 RNA could repress the luciferase expression in a DHFR-dependent manner when placed upstream of luciferase mRNA. (PMID:18045573)
• analysis of human dihydrofolate reductase folding trajectories inside the GroEL GroES chaperonin cavity and free in solution (PMID:18093916)
• An insertion/deletion polymorphism of the dihydrofolate reductase gene is associated with variation in serum and red blood cell folate concentrations in women (PMID:18247058)
• MDM2 regulates dihydrofolate reductase activity through monoubiquitination. (PMID:18451149)
• our early results showed that neither of MTHFR 677CT and DHFR 19-bp deletion polymorphisms were associated with breast cancer risk (PMID:18498051)
• A 19-base pair deletion polymorphism in dihydrofolate reductase is a functional polymorphism, because it limits assimilation of folic acid into cellular folate stores at high and low folic acid intakes. (PMID:19022952)
• Dhps-437 and dhps-540 are strongly associated with SP treatment failure and should be evaluated further as a method for surveillance of SP-based therapy in DRC. (PMID:19055622)
• the first kinetic parameters for DHFR from pjDHFR and pcDHFR with methotrexate (MTX), trimethoprim (TMP), and its potent analogue, PY957, is reported. (PMID:19196009)
• The nuclear translocation of DHFR was not a pre-requisite for DNA damage induced apoptosis. (PMID:19360472)
• DHFR 19-bp insertion/deletion polymorphism and MTHFR C677T in adult acute lymphoblastic leukaemia (PMID:19536847)
• dihydrofolate reductase knockdown has a role in the anticancer activity of 2-hydroxyoleic acid (PMID:19666584)
• The reduction of folic acid by DHFR per gram of human liver (n = 6) is, on average, less than 2% of that in rat liver at physiological pH. (PMID:19706381)
• DHFR is a novel modulator of beta-catenin and GSK3 signaling (PMID:19727391)
• DNA variants have a role in predisposition to disease-free survival in childhood acute lymphoblastic leukemia (PMID:19861437)
• The 19-base pair deletion polymorphism of DHFR was studied in Japanese. The genotype distribution was wild/wild, 11.9%; wild/deletion, 40.1%; deletion/deletion, 48.0%. Frequencies of wild type and deletion alleles were 0.32 and 0.68, respectively. (PMID:20834190)

Cross-species orthologs

6 orthologs

Organism	Symbol	Gene ID
danio_rerio	dhfr	ENSDARG00000004251
danio_rerio	zgc:153031	ENSDARG00000068876
mus_musculus	Dhfr	ENSMUSG00000021707
rattus_norvegicus	Dhfr	ENSRNOG00000082925
drosophila_melanogaster	Dhfr	FBGN0004087
caenorhabditis_elegans	dhfr-1	WBGENE00007974

Paralogs (2): TYMS (ENSG00000176890), DHFR2 (ENSG00000178700)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:94890) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 22 distinct phenotype terms.

Mouse phenotype (MP)	Records
extramedullary hematopoiesis	1
liver hypoplasia	1
pale liver	1
enlarged spleen	1
decreased embryo size	1
decreased erythrocyte cell number	1
pallor	1
decreased fetal size	1
decreased mean corpuscular hemoglobin	1
decreased vasodilation	1
decreased common myeloid progenitor cell number	1
abnormal DNA methylation	1
decreased erythroid progenitor cell number	1
decreased prepulse inhibition	1
increased nucleated erythrocyte cell number	1
preweaning lethality, complete penetrance	1
lethality during fetal growth through weaning, complete penetrance	1
abnormal folic acid level	1
embryonic lethality prior to organogenesis	1
embryonic lethality prior to tooth bud stage	1
abnormal hemopoiesis	1
decreased granulocyte monocyte progenitor cell number	1

Additional cross-species homologs

Sequence homologs in species beyond Ensembl Compara’s model organisms, by Diamond local protein alignment (% sequence identity; best hit per species). Lower-identity rows are more distant homologs. The matched accessions’ gene symbols aren’t in biobtree yet, so each row shows the UniProt accession.

Organism	UniProt	Identity	Method
Mycobacterium tuberculosis variant bovis AF2122/97	P0A547	100.0%	Diamond
Escherichia coli	P0ABQ7	100.0%	Diamond
Shigella sonnei	P0ABQ8	100.0%	Diamond
Mycobacterium tuberculosis CDC1551	P9WNX0	100.0%	Diamond
Mycobacterium tuberculosis H37Rv	P9WNX1	100.0%	Diamond
Neisseria meningitidis Z2491	Q9JSQ9	99.4%	Diamond
Neisseria meningitidis MC58	Q9K168	99.4%	Diamond
Mesocricetus auratus	P04753	96.8%	Diamond
Neisseria gonorrhoeae	P04174	94.4%	Diamond
Sus scrofa	P00377	92.9%	Diamond
Bos taurus	P00376	90.8%	Diamond
Gallus gallus	P00378	78.4%	Diamond
Mycobacterium leprae TN	Q9CBW1	70.9%	Diamond
Buchnera aphidicola str. APS (Acyrthosiphon pisum)	P57243	68.9%	Diamond
Aedes albopictus	P28019	57.4%	Diamond
Buchnera aphidicola str. Bp (Baizongia pistaciae)	Q89AV2	55.8%	Diamond
Cryptococcus deneoformans JEC21	Q07801	55.6%	Diamond
Haemophilus influenzae Rd KW20	P43791	53.5%	Diamond
Haloferax volcanii	Q9UWQ4	51.5%	Diamond
Bacillus subtilis subsp. subtilis str. 168	P11045	50.6%	Diamond
Staphylococcus haemolyticus	Q54277	50.6%	Diamond
Saccharomyces cerevisiae S288C	P07807	50.5%	Diamond
Candida albicans	P22906	48.0%	Diamond
Heliothis virescens	Q9U8B8	44.9%	Diamond
Encephalitozoon cuniculi GB-M1	O62583	44.8%	Diamond
Schistosoma mansoni	G4VJD6	44.4%	Diamond
Pneumocystis carinii	P16184	43.9%	Diamond
Schizosaccharomyces pombe 972h-	P36591	38.2%	Diamond
Herpesvirus saimiri (strain 488)	P22573	95.7%	Diamond
Herpesvirus saimiri (strain 484-77)	P27421	95.7%	Diamond
Herpesvirus saimiri (strain 11)	P09503	83.9%	Diamond
Human herpesvirus 8 strain GK18	Q2HRC6	50.3%	Diamond

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
RASGRF2-AS1	ncRNA	102524628
MSH3	protein-coding	4437
RASGRF2	protein-coding	5924
LINC01337	ncRNA	103689917
ANKRD34B	protein-coding	340120
FAM151B	protein-coding	167555

Protein

Protein identifiers

Dihydrofolate reductase — P00374 (reviewed: P00374)

All UniProt accessions (3): B0YJ76, B4DM58, P00374

UniProt curated annotations — full annotation on UniProt →

Function. Catalyzes the reduction of 7,8-dihydrofolate (DHF) to 5,6,7,8-tetrahydrofolate in a NADPH-dependent manner. Key enzyme in folate metabolism. Contributes to the nuclear and mitochondrial de novo thymidylate biosynthesis pathway. Catalyzes an essential reaction for de novo glycine and purine synthesis, and for DNA precursor synthesis. Binds its own mRNA and that of DHFR2.

Subunit / interactions. Homodimer. Part of the de novo thymidylate synthesis complex composed at least by SHMT1, DHFR and TYMS. Interacts with SHMT1; this interaction is DNA-dependent and mediates DHFR co-localization with LMNB1.

Subcellular location. Mitochondrion. Cytoplasm. Nucleus.

Tissue specificity. Widely expressed in fetal and adult tissues, including throughout the fetal and adult brains and whole blood. Expression is higher in the adult brain than in the fetal brain.

Post-translational modifications. Sumoylated by UBE2I/UBC9.

Disease relevance. Megaloblastic anemia due to dihydrofolate reductase deficiency (DHFRD) [MIM:613839] An inborn error of metabolism, characterized by megaloblastic anemia and/or pancytopenia, severe cerebral folate deficiency, and cerebral tetrahydrobiopterin deficiency. Clinical features include variable neurologic symptoms, ranging from severe developmental delay and generalized seizures in infancy, to childhood absence epilepsy with learning difficulties, to lack of symptoms. The disease is caused by variants affecting the gene represented in this entry.

Pathway. Cofactor biosynthesis; tetrahydrofolate biosynthesis; 5,6,7,8-tetrahydrofolate from 7,8-dihydrofolate: step 1/1.

Similarity. Belongs to the dihydrofolate reductase family.

Isoforms (2)

UniProt ID	Names	Canonical?
P00374-1	1	yes
P00374-2	2

RefSeq proteins (3): NP_000782, NP_001277283, NP_001277286 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001796	DHFR_dom	Domain
IPR012259	DHFR	Family
IPR017925	DHFR_CS	Conserved_site
IPR024072	DHFR-like_dom_sf	Homologous_superfamily

Pfam: PF00186

Enzyme classification (BRENDA)

• EC 1.5.1.3 — dihydrofolate reductase (BRENDA: 90 organisms, 121 substrates, 914 inhibitors, 438 Km, 293 kcat entries)

Substrate kinetics (BRENDA)

12 substrates with measured Km, best-characterized 12. Km ranges are aggregated across organisms/conditions.

Substrate	Km (mM)	Measurements
7,8-DIHYDROFOLATE	—	241
NADPH	0.0004–0.415	157
DIHYDROFOLATE	0.0006–0.238	8
8-METHYLPTERIN	0.03–0.3	4
FOLATE	0.0041–0.0067	2
NADH	0.268–0.32	2
10-FORMYL-DIHYDROFOLATE	0.003	1
6-HYDROXYMETHYLPTERIN	0.0034	1
DIHYDROPTEROATE	0.0009	1
L-THREO-NEOPTERIN	0.0035	1
NADP+	0.123	1
ACETYLPYRIDINE ADENINE NUCLEOTIDE	—	0

Catalyzed reactions (Rhea)

• (6S)-5,6,7,8-tetrahydrofolate + NADP(+) = 7,8-dihydrofolate + NADPH + H(+) (RHEA:15009)

UniProt features (45 total): strand 15, mutagenesis site 8, binding site 8, helix 6, sequence variant 2, turn 2, chain 1, domain 1, splice variant 1, sequence conflict 1

Structure

Experimental structures (PDB)

showing 30 of 89 structures by resolution:

PDB	Title	Method	Resolution (Å)
1KMV	HUMAN DIHYDROFOLATE REDUCTASE COMPLEXED WITH NADPH AND …	X-RAY DIFFRACTION	1.05
1KMS	HUMAN DIHYDROFOLATE REDUCTASE COMPLEXED WITH NADPH AND …	X-RAY DIFFRACTION	1.09
4M6J	Crystal structure of human dihydrofolate reductase (DHFR) bound to NADPH	X-RAY DIFFRACTION	1.2
5HSR	Fluorine substituted …	X-RAY DIFFRACTION	1.21
3FS6	Correlations of Inhibitor Kinetics for Pneumocystis jirovecii and Human Dihydrofolate …	X-RAY DIFFRACTION	1.23
3GHW	Human dihydrofolate reductase inhibitor complex	X-RAY DIFFRACTION	1.24
2W3B	HUMAN DIHYDROFOLATE REDUCTASE COMPLEXED WITH NADPH AND A LIPOPHILIC ANTIFOLATE SELECTIVE …	X-RAY DIFFRACTION	1.27
3GHC	Design, Synthesis, and X-ray Crystal Structure of Classical and Nonclassical …	X-RAY DIFFRACTION	1.3
3GHV	Human dihydrofolate reductase Q35K/N64F double mutant inhibitor complex	X-RAY DIFFRACTION	1.3
3NTZ	Design, Synthesis, Biological Evaluation and X-ray Crystal Structures of Novel Classical …	X-RAY DIFFRACTION	1.35
3NU0	Design, Synthesis, Biological Evaluation and X-ray Crystal Structure of Novel Classical …	X-RAY DIFFRACTION	1.35
3NXO	Perferential Selection of Isomer Binding from Chiral Mixtures: Alternate Binding Modes …	X-RAY DIFFRACTION	1.35
3NXR	Perferential Selection of Isomer Binding from Chiral Mixtures: Alternate Binding Modes …	X-RAY DIFFRACTION	1.35
3NXX	Preferential Selection of Isomer Binding from Chiral Mixtures: Alternate Binding Modes …	X-RAY DIFFRACTION	1.35
4G95	hDHFR-OAG binary complex	X-RAY DIFFRACTION	1.35
4M6K	Crystal structure of human dihydrofolate reductase (DHFR) bound to NADP+ and folate	X-RAY DIFFRACTION	1.4
2C2S	Human Dihydrofolate Reductase Complexed With NADPH and …	X-RAY DIFFRACTION	1.4
3F8Y	Correlations of Human Dihydrofolate Reductase with Structural Data for Human Active Site …	X-RAY DIFFRACTION	1.45
4KEB	Human dihydrofolate reductase complexed with NADPH and …	X-RAY DIFFRACTION	1.45
5HQY	human dihydrofolate reductase complex with NADPH and …	X-RAY DIFFRACTION	1.46
5HQZ	Fluorine substituted …	X-RAY DIFFRACTION	1.46
5HSU	Fluorine substituted …	X-RAY DIFFRACTION	1.46
5HUI	6-substituted pyrido[3,2-d]pyrimidine–6-4’-trifluoromethoxyphenyl)	X-RAY DIFFRACTION	1.46
5HVE	5-methyl-6-(3’-trifluromethoxyphenylthio)[2,3-d]pyrimidine 2,4-diamine	X-RAY DIFFRACTION	1.46
2C2T	Human Dihydrofolate Reductase Complexed With NADPH and …	X-RAY DIFFRACTION	1.5
2W3A	HUMAN DIHYDROFOLATE REDUCTASE COMPLEXED WITH NADPH AND TRIMETHOPRIM	X-RAY DIFFRACTION	1.5
3GI2	Human dihydrofolate reductase Q35K mutant inhibitor complex	X-RAY DIFFRACTION	1.53
3S3V	human dihydrofolate reductase Q35K/N64F double mutant binary complex with trimethoprim	X-RAY DIFFRACTION	1.53
5SDB	Crystal Structure of Human DHFR complexed with NADP and N10-formyl-tetrahydrofolate	X-RAY DIFFRACTION	1.55
6DAV	Crystal Structure of Human DHFR complexed with NADP and N10formyltetrahydrofolate	X-RAY DIFFRACTION	1.55

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P00374-F1	96.32	0.97

Human Protein Atlas

Protein class: Enzymes, ENZYME proteins, Oxidoreductases, Metabolic proteins, Predicted intracellular proteins, Cancer-related genes, Candidate cancer biomarkers, Disease related genes, FDA approved drug targets, Small molecule drugs, Human disease related genes, Congenital disorders of metabolism, Congenital disorders of cofactor/vitamin metabolism, Essential proteins

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): mitochondria

Antibody reliability (HPA): IH uncertain · IF approved

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Ligand- & substrate-binding residues (8)

Position	Role
10	NADP(+)
16–22	NADP(+)
31–36	substrate
55–57	NADP(+)
65	substrate
71	substrate
77–79	NADP(+)
117–124	NADP(+)

Mutagenesis-validated functional residues (8)

Position	Phenotype
23	decreases affinity for nadp and dihydrofolate over 10-fold.
23	strongly decreased affinity for methotrexate. decreases catalytic rate constant 200-fold. decreases affinity for nadp and dihydrofolate …
32	reduces catalytic rate 5-fold. reduces affinity for dihydrofolate 9-fold; when associated with e-36.
36	reduces catalytic rate 2-fold. reduces affinity for dihydrofolate 9-fold; when associated with r-32.
36	increases affinity for dihydrofolate about 3-fold. reduces affinity for nadph about 3-fold.
36	increases affinity for dihydrofolate about 2-fold. no effect on affinity for nadph.
65	increases affinity for dihydrofolate about 3-fold. no effect on affinity for nadph.
65	increases affinity for dihydrofolate about 15-fold. no effect on affinity for nadph.

Function

Pathways and Gene Ontology

Reactome pathways

2 curated (TAS) of 11; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

11 pathways:

ID	Pathway	Evidence
R-HSA-69205	G1/S-Specific Transcription	curated
R-HSA-196757	Metabolism of folate and pterines	curated
R-HSA-1640170	Cell Cycle	—
R-HSA-69278	Cell Cycle, Mitotic	—
R-HSA-69206	G1/S Transition	—
R-HSA-1430728	Metabolism	—
R-HSA-8978934	Metabolism of cofactors	—
R-HSA-196854	Metabolism of vitamins and cofactors	—
R-HSA-196849	Metabolism of water-soluble vitamins and cofactors	—
R-HSA-453279	Mitotic G1 phase and G1/S transition	—
R-HSA-1474151	Tetrahydrobiopterin (BH4) synthesis, recycling, salvage and regulation	electronic

MSigDB gene sets: 472 (showing top): BROWNE_HCMV_INFECTION_30MIN_DN, GOBP_RESPONSE_TO_NITROGEN_COMPOUND, MULLIGHAN_NPM1_SIGNATURE_3_UP, HORIUCHI_WTAP_TARGETS_DN, BUYTAERT_PHOTODYNAMIC_THERAPY_STRESS_DN, REACTOME_G1_S_SPECIFIC_TRANSCRIPTION, YAGI_AML_WITH_INV_16_TRANSLOCATION, RODRIGUES_THYROID_CARCINOMA_POORLY_DIFFERENTIATED_UP, GOBP_POLYOL_METABOLIC_PROCESS, GOBP_SUPEROXIDE_METABOLIC_PROCESS, GOBP_REGENERATION, GOBP_NEUROGENESIS, GOBP_RESPONSE_TO_AXON_INJURY, GOBP_CELLULAR_RESPONSE_TO_OXYGEN_CONTAINING_COMPOUND, GOBP_PYRIMIDINE_NUCLEOBASE_METABOLIC_PROCESS

GO Biological Process (12): ‘de novo’ pyrimidine nucleobase biosynthetic process (GO:0006207), DNA replication (GO:0006260), tetrahydrobiopterin biosynthetic process (GO:0006729), one-carbon metabolic process (GO:0006730), negative regulation of translation (GO:0017148), axon regeneration (GO:0031103), response to methotrexate (GO:0031427), dihydrofolate metabolic process (GO:0046452), tetrahydrofolate metabolic process (GO:0046653), tetrahydrofolate biosynthetic process (GO:0046654), folic acid metabolic process (GO:0046655), regulation of removal of superoxide radicals (GO:2000121)

GO Molecular Function (10): mRNA regulatory element binding translation repressor activity (GO:0000900), mRNA binding (GO:0003729), dihydrofolate reductase activity (GO:0004146), folic acid binding (GO:0005542), NADP binding (GO:0050661), NADPH binding (GO:0070402), sequence-specific mRNA binding (GO:1990825), RNA binding (GO:0003723), protein binding (GO:0005515), oxidoreductase activity (GO:0016491)

GO Cellular Component (5): nucleus (GO:0005634), replication fork (GO:0005657), mitochondrion (GO:0005739), cytosol (GO:0005829), cytoplasm (GO:0005737)

Reactome top-level categories

8 top-level categories:

Category	Pathways
Metabolism of vitamins and cofactors	2
Metabolism of cofactors	1
Metabolism of water-soluble vitamins and cofactors	1
G1/S Transition	1
Metabolism	1
Cell Cycle, Mitotic	1
Mitotic G1 phase and G1/S transition	1
Cell Cycle	1

GO top-level categories

43 GO namespaces:

Category	Terms
folic acid-containing compound metabolic process	3
cellular anatomical structure	3
dicarboxylic acid metabolic process	2
mRNA binding	2
intracellular membrane-bounded organelle	2
cytoplasm	2
pyrimidine nucleobase biosynthetic process	1
DNA metabolic process	1
DNA biosynthetic process	1
diol biosynthetic process	1
pteridine-containing compound biosynthetic process	1
tetrahydrobiopterin metabolic process	1
small molecule metabolic process	1
translation	1
regulation of translation	1
negative regulation of gene expression	1
negative regulation of protein metabolic process	1
neuron projection regeneration	1
response to axon injury	1
axon development	1
response to nitrogen compound	1
response to oxygen-containing compound	1
folic acid-containing compound biosynthetic process	1
tetrahydrofolate metabolic process	1
removal of superoxide radicals	1
regulation of superoxide metabolic process	1
regulation of cellular response to oxidative stress	1
regulation of response to reactive oxygen species	1
translation repressor activity	1
RNA binding	1
oxidoreductase activity, acting on the CH-NH group of donors, NAD or NADP as acceptor	1
vitamin binding	1
carboxylic acid binding	1
modified amino acid binding	1
heterocyclic compound binding	1
adenyl nucleotide binding	1
anion binding	1
NADP binding	1
nucleic acid binding	1
binding	1
catalytic activity	1
chromosome	1
intracellular anatomical structure	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 15 of 27 annotations. The rest are phylogenetic / computational / electronic (IEA).

15 experimentally-supported GO terms:

GO term	NS	Evidence
‘de novo’ pyrimidine nucleobase biosynthetic process	BP	direct assay
DNA replication	BP	direct assay
dihydrofolate metabolic process	BP	direct assay
negative regulation of translation	BP	direct assay
tetrahydrobiopterin biosynthetic process	BP	mutant phenotype
tetrahydrofolate biosynthetic process	BP	direct assay
tetrahydrofolate metabolic process	BP	direct assay
mitochondrion	CC	high-throughput
replication fork	CC	direct assay
NADPH binding	MF	direct assay
dihydrofolate reductase activity	MF	direct assay
folic acid binding	MF	direct assay
mRNA binding	MF	direct assay
mRNA regulatory element binding translation repressor activity	MF	direct assay
sequence-specific mRNA binding	MF	direct assay

Protein interactions and networks

STRING

showing 15 of 2,846 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
DHFR	TYMS	P04818	921
DHFR	DHODH	Q02127	873
DHFR	MTHFR	P42898	818
DHFR	GART	P22102	812
DHFR	SPR	P35270	807
DHFR	FPGS	Q05932	792
DHFR	SHMT1	P34896	776
DHFR	DHPS	P49366	775
DHFR	QDPR	P09417	768
DHFR	TCN2	P20062	766
DHFR	MTHFD1	P11586	764
DHFR	MTR	Q99707	750
DHFR	ATIC	P31939	724
DHFR	SHMT2	P34897	724
DHFR	CBR1	P16152	720

IntAct

Human interaction partners of DHFR in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

3 partners by confidence:

Partner	Interaction type	MIscore	Records
DHFR2	physical association	0.560	1
FANCA	association	0.350	1
PDLIM1	association	0.350	1

BioGRID (182 interactions; top human partners by supporting records): MDM2 (Affinity Capture-Western; 6 records), KRAS (Proximity Label-MS; 3 records), EGFR (Affinity Capture-MS; 2 records), HSPD1 (Reconstituted Complex; 2 records), SQSTM1 (Proximity Label-MS; 2 records), ABCF3 (Affinity Capture-MS), ACTR3 (Co-fractionation), ACY1 (Co-fractionation), AIFM1 (Affinity Capture-MS), AMFR (Biochemical Activity), AR (Affinity Capture-MS), ARAP3 (Affinity Capture-MS), ARHGEF5 (Affinity Capture-MS), ATG10 (Phenotypic Suppression), ATG3 (Phenotypic Suppression)

SIGNOR signaling

showing 9 of 10 signaling interactions:

A	Effect	B	Mechanism
pemetrexed	down-regulates	DHFR	“chemical inhibition”
E2F1	“up-regulates quantity by expression”	DHFR	“transcriptional regulation”
TFDP1	“up-regulates quantity by expression”	DHFR	“transcriptional regulation”
pralatrexate	“down-regulates activity”	DHFR	“chemical inhibition”
methotrexate	“down-regulates activity”	DHFR	“chemical inhibition”
trimetrexate	“down-regulates activity”	DHFR	“chemical inhibition”
“pemetrexed disodium”	“down-regulates activity”	DHFR	“chemical inhibition”
DHFR	“down-regulates quantity”	dihydrofolate(2-)	“chemical modification”
DHFR	“up-regulates quantity”	(6S)-5,6,7,8-tetrahydrofolate(2-)	“chemical modification”

Protein complexes (CORUM) (3)

Experimentally-characterized complexes this protein is a subunit of (★ = the complex contains a known drug target).

3 complexes by size:

Complex	Subunits	Members
★ DHFR-SHMT1-TYMS complex	3	DHFR, SHMT1, TYMS
★ DHFR-TYMS complex	2	DHFR, TYMS
★ Dihydrofolate reductase (EC:1.5.1.3)	1	DHFR

Disease & clinical

Genetic variants

Variant evidence for DHFR: 615 ClinVar records (38 pathogenic / likely pathogenic); 9 PharmGKB clinical annotations; 9 GWAS associations. Per-variant detail is on Sugi Variant.

ClinVar

615 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	26
Likely pathogenic	12
Uncertain significance	284
Likely benign	204
Benign	17

Top pathogenic / likely-pathogenic (15)

Showing the 15 best-reviewed of 38 pathogenic / likely-pathogenic ClinVar records, ranked by ClinVar review status (expert panel → multiple submitters → single submitter), then by number of submitting labs.

Variant ID	HGVS	Classification	Review	Submitters
1072664	NM_002439.5(MSH3):c.205_224dup (p.His78fs)	Pathogenic	criteria provided, multiple submitters, no conflicts	2
1067890	NM_000791.4(DHFR):c.-476C>G	Likely pathogenic	criteria provided, multiple submitters, no conflicts	3
1790284	NM_002439.5(MSH3):c.237+1G>A	Likely pathogenic	criteria provided, multiple submitters, no conflicts	2
2676780	NM_002439.5(MSH3):c.161del (p.Ala54fs)	Likely pathogenic	criteria provided, multiple submitters, no conflicts	2
1071775	NM_002439.5(MSH3):c.213_220dup (p.Gln74fs)	Pathogenic	criteria provided, single submitter	1
1755218	NM_002439.5(MSH3):c.122del (p.Thr41fs)	Pathogenic	criteria provided, single submitter	1
1771531	NM_002439.5(MSH3):c.139_178del (p.Val47fs)	Pathogenic	criteria provided, single submitter	1
2091670	NM_002439.5(MSH3):c.71del (p.Val23_Leu24insTer)	Pathogenic	criteria provided, single submitter	1
2451067	NM_002439.5(MSH3):c.205_224del (p.Pro69fs)	Pathogenic	criteria provided, single submitter	1
2451077	NM_002439.5(MSH3):c.147_154dup (p.Ala52fs)	Pathogenic	criteria provided, single submitter	1
2673497	NM_002439.5(MSH3):c.85C>T (p.Gln29Ter)	Pathogenic	criteria provided, single submitter	1
2673506	NM_002439.5(MSH3):c.36del (p.Ala13fs)	Pathogenic	criteria provided, single submitter	1
2673531	NM_002439.5(MSH3):c.90dup (p.Thr31fs)	Pathogenic	criteria provided, single submitter	1
2673556	NM_002439.5(MSH3):c.85del (p.Gln29fs)	Pathogenic	criteria provided, single submitter	1
2673571	NM_002439.5(MSH3):c.61C>T (p.Gln21Ter)	Pathogenic	criteria provided, single submitter	1

Per-variant reference — Sugi Variant

Explore DHFR’s pathogenic and likely-pathogenic variants individually — each with its ClinVar classification and conditions, applied ACMG criteria (ClinGen expert panel, where curated), the calibrated in-silico predictors (AlphaMissense, REVEL, SaProt, conservation), gnomAD frequency, and the predictor-disagreement QC signal — on Sugi Variant.

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 33 predictions of 568):

Position(s)	Effect	Δscore	Sites
5:80633875–80633876	donor_loss	1.0000	5
5:80633872–80633875	donor_loss	0.9900	6
5:80633993–80633994	acceptor_loss	0.9900	5
5:80633994–80633995	acceptor_gain	0.9900	2
5:80633871	donor_loss	0.9800
5:80654402–80654403	donor_loss	0.9800	4
5:80654436	donor_gain	0.9800
5:80654720	donor_gain	0.9800
5:80629166–80629168	acceptor_loss	0.9600	7
5:80633871	donor_loss	0.9600

AlphaMissense

421 missense substitutions predicted likely pathogenic (of 1,243 scored), across 110 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M53	9	0.779	0.919
F35	8	0.910	0.986
N49	8	0.851	0.964
W25	7	0.963	0.990
W58	7	0.955	0.989
W114	7	0.949	0.984
D146	7	0.898	0.935
F135	7	0.834	0.965
F180	7	0.826	0.981
N73	7	0.808	0.985
F32	7	0.804	0.902
F149	7	0.751	0.937
E173	7	0.733	0.872
G54	6	0.956	0.985
G117	6	0.939	0.978
R71	6	0.932	0.986
G118	6	0.895	0.955
T137	6	0.878	0.967
G18	6	0.876	0.975
T39	6	0.875	0.946

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

2 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Chromophobe (TCGA)	unfavorable	0.000146
Lung Adenocarcinoma (TCGA)	unfavorable	0.00085

Disease associations

OMIM: gene MIM:126060 | disease phenotypes: MIM:617100, MIM:613839

GenCC curated gene-disease

1 curated gene-disease records:

Disease	Classification	Inheritance	Records
constitutional megaloblastic anemia with severe neurologic disease	Definitive	Autosomal recessive	4

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (13 panels, 13 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

13 panels:

Panel	Rating
Cerebral folate deficiency	green
Cytopenias and congenital anaemias	green
DDG2P	green
Fetal anomalies	green
Hypotonic infant	green
Intellectual disability	green
Leukodystrophy, childhood onset	green
Likely inborn error of metabolism	green
Neurotransmitter disorders	green
Paediatric disorders	green
Rare anaemia	green
Undiagnosed metabolic disorders	green
Unexplained death in infancy and sudden unexplained death in childhood	green

Mondo (4): hereditary neoplastic syndrome (MONDO:0015356), endometrial carcinoma (MONDO:0002447), familial adenomatous polyposis 4 (MONDO:0044300), constitutional megaloblastic anemia with severe neurologic disease (MONDO:0013456)

Orphanet (3): Inherited cancer-predisposing syndrome (Orphanet:140162), MSH3-related polyposis (Orphanet:480536), Constitutional megaloblastic anemia with severe neurologic disease (Orphanet:319651)

HPO phenotypes

25 phenotypes (HPO-id order):

HPO	Term
HP:0000007	Autosomal recessive inheritance
HP:0000952	Jaundice
HP:0000980	Pallor
HP:0001251	Ataxia
HP:0001252	Hypotonia
HP:0001263	Global developmental delay
HP:0001290	Generalized hypotonia
HP:0001321	Cerebellar hypoplasia
HP:0001873	Thrombocytopenia
HP:0001876	Pancytopenia
HP:0001889	Megaloblastic anemia
HP:0002059	Cerebral atrophy
HP:0002121	Generalized non-motor (absence) seizure
HP:0002240	Hepatomegaly
HP:0002421	Poor head control
HP:0003621	Juvenile onset
HP:0005484	Secondary microcephaly
HP:0005518	Increased mean corpuscular volume
HP:0011149	Absence seizure with eyelid myoclonia
HP:0011968	Feeding difficulties
HP:0012446	Decreased CSF 5-methyltetrahydrofolate concentration
HP:0012448	Delayed myelination
HP:0025097	Eyelid myoclonus
HP:0025435	Increased circulating lactate dehydrogenase concentration
HP:0040087	Abnormal circulating folate concentration

GWAS associations

9 associations:

Study	Trait	p-value
GCST011618_9	Cortical thickness	1e-15
GCST010703_237	Brain morphology (MOSTest)	4e-15
GCST004691_1	Huntington’s disease progression	1e-10
GCST010702_34	Subcortical volume (MOSTest)	8e-10
GCST010701_120	Cortical surface area (MOSTest)	1e-8
GCST003372_22	Glomerular filtration rate (creatinine)	1e-7
GCST010172_7	Idiopathic downbeat nystagmus	5e-7
GCST002654_1	Shingles	1e-6
GCST002654_2	Shingles	4e-6

EFO canonical traits (from GWAS)

3 canonical traits:

EFO ID	Trait name
EFO:0008336	disease progression measurement
EFO:0004346	neuroimaging measurement
EFO:0004840	cortical thickness

MeSH disease descriptors

2 disease descriptors:

Descriptor	Name	Tree numbers
D009386	Neoplastic Syndromes, Hereditary	C04.700; C16.320.700
C565095	Megaloblastic Anemia due to Dihydrofolate Reductase Deficiency *(supp.)*

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL202 (SINGLE PROTEIN)

Drugs by curated mechanism of action (ChEMBL)

Drugs whose curated ChEMBL mechanism of action targets the DHFR protein itself — single-protein targets only (drugs acting on a protein family or complex that merely includes it are excluded). Includes antibodies and oligonucleotides that bioactivity screening does not capture.

5 curated-mechanism drugs:

Drug	Modality	Max phase
METHOTREXATE	Small molecule	4
PEMETREXED	Small molecule	4
PEMETREXED DIPOTASSIUM	Small molecule	4
PRALATREXATE	Small molecule	4
PIRITREXIM	Small molecule	2

Molecules with ChEMBL bioactivity

Phase ≥1, by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 991,762 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

23 molecules by phase:

Molecule	Name	Phase	Patents
CHEMBL34259	METHOTREXATE	4	402,177
CHEMBL225072	PEMETREXED	4	56,714
CHEMBL1201746	PRALATREXATE	4	14,758
CHEMBL898	DIFLUNISAL	4	55,163
CHEMBL6067485	GENTAMICIN	4
CHEMBL1679	LEUCOVORIN	4	82,367
CHEMBL686	MEFENAMIC ACID	4	62,458
CHEMBL36	PYRIMETHAMINE	4	19,521
CHEMBL225071	RALTITREXED	4	97,728
CHEMBL455	SULFACETAMIDE	4	18,327
CHEMBL439	SULFADIAZINE	4	31,967
CHEMBL973	TERIFLUNOMIDE	4	7,705
CHEMBL22	TRIMETHOPRIM	4	56,501
CHEMBL119	TRIMETREXATE	4	57,609
CHEMBL134561	ICLAPRIM	3	1,003
CHEMBL7492	PIRITREXIM	2	12,654
CHEMBL376180	AMINOPTERIN	2	363
CHEMBL38434	BREQUINAR	2	8,213
CHEMBL747	CYCLOGUANIL	2	4,935
CHEMBL19633	DIAVERIDINE	2	1,599
CHEMBL296373	EDATREXATE	2
CHEMBL280378	EPIROPRIM	2
CHEMBL4468777	FANOTAPRIM	1

PharmGKB: 1 entry (CPIC guideline: no)

PharmGKB clinical annotations

9 annotations by evidence level (1 strongest → 4):

Variant	Association	Level	Drugs	Phenotypes
rs1053129	Efficacy	3	methotrexate	Osteosarcoma
rs1105525	Efficacy	3	methotrexate	Acute lymphoblastic leukemia
rs1643650	Efficacy	3	methotrexate	Rheumatoid arthritis
rs1650697	Toxicity	3	pemetrexed	Mesothelioma;Non-Small Cell Lung Carcinoma
rs1650723	Toxicity	3	methotrexate	Osteosarcoma
rs408626	Efficacy,Toxicity	3	methotrexate	Acute lymphoblastic leukemia
rs442767	Toxicity	3	pemetrexed	Non-Small Cell Lung Carcinoma
rs442767	Toxicity	3	methotrexate	Acute lymphoblastic leukemia
rs70991108	Toxicity	3	methotrexate	Acute lymphoblastic leukemia;Drug-induced liver injury;Leukopenia;Thrombocytopenia

PharmGKB variants

8 variants:

Variant	Genes	Level	Score	#Clin annots	Drugs
rs408626	DHFR, MSH3	3	5.50	1	methotrexate
rs442767	DHFR, MSH3	3	2.25	2	pemetrexed;methotrexate
rs1053129	DHFR	3	2.25	1	methotrexate
rs1105525	DHFR, MSH3	3	2.75	1	methotrexate
rs1643650	DHFR	3	0.00	1	methotrexate
rs1650697	DHFR, MSH3	3	2.50	1	pemetrexed
rs1650723	DHFR	3	2.25	1	methotrexate
rs70991108	DHFR, MSH3	3	0.50	1	methotrexate

PharmGKB variant annotations

Per-publication pharmacogenomic findings for this gene (significant associations).

18 published findings:

Variant	Drug(s)	Category	Finding	PMID
rs442767	pemetrexed	Toxicity	Genotype GG is associated with increased risk of Fatigue when treated with pemetrexed in people with Carcinoma, Non-Small-Cell Lung as compared to genotypes GT + TT.	PMID:23709418
rs1650697	pemetrexed	Toxicity	Genotypes AA + AG is associated with increased risk of Drug Toxicity when treated with pemetrexed in people with Carcinoma, Non-Small-Cell Lung and Mesothelioma as compared to genotype GG.	PMID:24732178
rs408626	methotrexate	Efficacy	Genotype CC is associated with decreased event-free survival and overall survival when treated with methotrexate in people with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes CT + TT.	PMID:26335211
rs408626	methotrexate	Toxicity	Genotype TT is associated with increased risk of Leukopenia when treated with methotrexate in people with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes CC + CT.	PMID:26335211
rs442767	methotrexate	Toxicity	Genotype GT is associated with increased risk of Leukopenia when treated with methotrexate in people with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotype TT.	PMID:26335211
rs1053129	methotrexate	Toxicity	Genotype CC is associated with increased risk of Neoplasm Metastasis when treated with methotrexate in people with Osteosarcoma as compared to genotype AC.	PMID:25778468
rs1650723	methotrexate	Toxicity	Allele T is associated with increased severity of mucositis when treated with methotrexate in people with Osteosarcoma as compared to allele C.	PMID:25778468
rs34965641	cyclosporine, methotrexate	Efficacy	Genotype GG is associated with decreased risk of Graft vs Host Disease when treated with cyclosporine and methotrexate in people with Hematopoietic stem cell transplantation as compared to genotypes AA + AG.	PMID:25425682
rs3045983	methotrexate	Toxicity	Genotypes GGGAGCTGG/del + del/del is associated with decreased likelihood of Drug Toxicity when treated with methotrexate in people with Arthritis, Rheumatoid as compared to genotype GGGAGCTGG/GGGAGCTGG.	PMID:27636122
rs442767	methotrexate	Efficacy	Genotype GG is associated with decreased event-free survival when treated with methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes GT + TT.	PMID:29210328
rs408626	methotrexate	Efficacy	Genotype TT is associated with decreased event-free survival when treated with methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes CC + CT.	PMID:29210328
rs1650697	methotrexate	Efficacy	Genotype AA is associated with decreased event-free survival when treated with methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes AG + GG.	PMID:29210328
rs70991108	methotrexate	Toxicity	Genotype TGGCGCGTCCCGCCCAGGT/TGGCGCGTCCCGCCCAGGT is associated with increased severity of Leukopenia due to methotrexate in children with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes TGGCGCGTCCCGCCCAGGT/del + del/del.	PMID:30684021
rs408626	methotrexate	Efficacy	Allele C is associated with decreased clinical benefit to methotrexate in people with Crohn Disease as compared to allele T.	PMID:38369687
rs11951910	oxaliplatin, pralatrexate	Efficacy	Genotype CT is associated with decreased likelihood of Progression-free survival when treated with oxaliplatin and pralatrexate in people with Gastroesophageal Cancer as compared to genotype TT.	PMID:31575653
rs70991108		Other	Genotype del/del is associated with increased serum and red blood cell folate concentrations.	PMID:18247058
rs1105525	methotrexate	Efficacy	Genotypes CT + TT are associated with decreased event free survival when treated with methotrexate in people with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotype CC.	PMID:19861437
rs70991108	methotrexate	Toxicity	Genotype TGGCGCGTCCCGCCCAGGT/TGGCGCGTCCCGCCCAGGT is associated with increased risk of Thrombocytopenia when treated with methotrexate in people with Precursor Cell Lymphoblastic Leukemia-Lymphoma as compared to genotypes TGGCGCGTCCCGCCCAGGT/del + del/del.	PMID:21747412

GtoPdb / IUPHAR curated pharmacology

(IUPHAR/BPS Guide to Pharmacology — expert-curated)

Target class: enzyme — Nucleoside synthesis and metabolism

Most potent curated ligand interactions (7 total), top 7:

Ligand	Action	Affinity	Parameter
compound 9 [PMID: 15615544]	Inhibition	10.47	pKi
methotrexate	Inhibition	8.92	pKi
pemetrexed	Inhibition	8.15	pKi
trimetrexate	Inhibition	7.89	pKi
pralatrexate	Inhibition	7.35	pKi
iclaprim	Inhibition	6.11	pKi
diflunisal	Inhibition	4.47	pKi

Binding affinities (BindingDB)

711 measured of 803 human assays (1428 total across all organisms); most potent 50 below. Values come from heterogeneous assays and are not directly comparable.

Ligand	Measure	Value
N-(4-Carboxy-4-{4-[2-(6,8-diamino-naphthalen-2-yl)-ethyl]-benzoylamino}-butyl)-phthalamic acid	KI	0.00021 nM
N-(4-Carboxy-4-{4-[2-(6,8-diamino-quinoxalin-2-yl)-ethyl]-benzoylamino}-butyl)-phthalamic acid	KI	0.00035 nM
N-(4-Carboxy-4-{4-[(6,8-diamino-quinoxalin-2-ylmethyl)-amino]-benzoylamino}-butyl)-phthalamic acid	KI	0.00033 nM
N-(4-Carboxy-4-{4-[1-(6,8-diamino-quinoxalin-2-ylmethyl)-but-3-ynyl]-benzoylamino}-butyl)-phthalamic acid	KI	0.0006 nM
N-(4-Carboxy-4-{4-[1-(6,8-diamino-quinoxalin-2-ylmethyl)-propyl]-benzoylamino}-butyl)-phthalamic acid	KI	0.00062 nM
LY-298207	KI	0.005 nM
2-{4-[(2,4-Diamino-quinazolin-6-ylmethyl)-amino]-benzoylamino}-pentanedioic acid	KI	0.01 nM
2-S-[5-[2,4-diaminopteridin-6-yl)methyamino]-2,3-dihydro-1-oxo–2(1H)-isoindolyl glutaric acid	KI	0.034 nM
2-R,S-[5-[(2,4-diaminopteridin-6-yl)methylamino]-2,3-dihydro-1-oxo-2(1H)-isoindolyl]glutaric acid	KI	0.077 nM
2-Amino-8-isobutyl-5-methyl-2,8-dihydro-3H-pyrido[2,3-d]pyrimidin-4-one	KD	0.1 nM
TCMDC-137308	KI	0.1 nM
7-tert-Butyl-8-ethyl-7H-pyrrolo[3,2-f]quinazoline-1,3-diamine	KI	0.1 nM
7-(1-Ethyl-propyl)-8-isopropyl-7H-pyrrolo[3,2-f]quinazoline-1,3-diamine	KI	0.1 nM
2-{4-[(3-Carboxy-propyl)-(2,4-diamino-pteridin-6-ylmethyl)-amino]-benzoylamino}-pentanedioic acid	KI	0.107 nM
(S)-2-{(S)-4-[3-(2,4-Diamino-pyrimidin-5-yl)-propyl]-benzoylamino}-pentanedioic acid	KI	0.12 nM
2-{4-[(4-Carboxy-butyl)-(2,4-diamino-pteridin-6-ylmethyl)-amino]-benzoylamino}-pentanedioic acid	KI	0.131 nM
2-{4-[(5-Carboxy-pentyl)-(2,4-diamino-pteridin-6-ylmethyl)-amino]-benzoylamino}-pentanedioic acid	KI	0.183 nM
6-[(4-Chloro-2-methyl-phenylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.19 nM
6-(5-Chloro-2-methyl-benzyl)-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.19 nM
6-[(3,5-Dipropoxy-phenylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.19 nM
8-Ethyl-7-(1-ethyl-propyl)-7H-pyrrolo[3,2-f]quinazoline-1,3-diamine	KI	0.2 nM
8-tert-Butyl-7-isopropyl-7H-pyrrolo[3,2-f]quinazoline-1,3-diamine	KI	0.2 nM
(R)-2-{4-[2-(2,4-Diamino-5,6,7,8-tetrahydro-pyrido[2,3-d]pyrimidin-6-yl)-ethyl]-benzoylamino}-2-methyl-pentanedioic acid	KI	0.29 nM
5-(2-fluorobenzyloxy)quinazoline-2,4-diamine	IC50	0.39 nM
TCMDC-137312	KI	0.4 nM
5-methyl-6-{[(3,4,5-trimethoxyphenyl)amino]methyl}quinazoline-2,4-diamine	IC50	0.42 nM
6-[(4-Chloro-naphthalen-1-ylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.43 nM
2-Amino-7-methyl-8-propyl-2,8-dihydro-3H-pyrido[2,3-d]pyrimidin-4-one	KD	0.5 nM
2-{4-[(2,4-Diamino-quinazolin-5-ylmethyl)-amino]-benzoylamino}-pentanedioic acid	KI	0.54 nM
6-[(3-Bromo-4-methyl-phenylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.6 nM
6-(3,5-Dimethoxy-benzyl)-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.64 nM
LY-335580	KI	0.69 nM
6-[(2,5-Dibromo-phenylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.7 nM
4-[5-(2,4-Diamino-pteridin-6-ylmethyl)-5H-dibenzo[b,f]azepin-2-yloxymethyl]-benzoic acid	IC50	0.75 nM
5-Methyl-6-(naphthalen-2-ylaminomethyl)-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.76 nM
6-[(2-Chloro-4-fluoro-5-methyl-phenylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.78 nM
6-[(5-Chloro-2-methyl-phenylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.79 nM
5-(4-Methoxy-3,5-dipropenyl-benzyl)-pyrimidine-2,4-diamine	KI	0.8 nM
6-[(3-Chloro-2-methyl-phenylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.82 nM
6-[(2-Bromo-5-trifluoromethyl-phenylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.82 nM
(2R,4R)-2-{4-[(2,4-Diamino-pteridin-6-ylmethyl)-methyl-amino]-benzoylamino}-4-fluoro-pentanedioic acid	IC50	0.84 nM
6-[(4-Bromo-2-methyl-phenylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.85 nM
6-[(5-Fluoro-2-methyl-phenylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.85 nM
6-[(2-Fluoro-5-trifluoromethyl-phenylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.86 nM
6-[(9H-Fluoren-2-ylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.86 nM
6-[(4-Bromo-3-methyl-phenylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.87 nM
6-[(2-Difluoromethoxy-phenylamino)-methyl]-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.87 nM
6-(Isoquinolin-5-ylaminomethyl)-5-methyl-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.87 nM
5-Ethyl-6-[(2-methoxy-5-trifluoromethyl-phenylamino)-methyl]-pyrido[2,3-d]pyrimidine-2,4-diamine	IC50	0.88 nM
xv5-Methyl-6-(pyren-1-ylaminomethyl)-pyrido[2,3-d]pyrimidineamine	IC50	0.88 nM

ChEMBL bioactivities

1537 potent at pChembl≥5 of 1792 total, top 50 by pChembl (potency: 10 = 0.1 nM, 6 = 1 µM).

pChembl	Type	Value	Unit	Molecule
11.00	Ki	0.01	nM	METHOTREXATE
11.00	Ki	0.01	nM	CHEMBL305177
10.87	Ki	0.0134	nM	PRALATREXATE
10.60	Ki	0.025	nM	PIRITREXIM
10.47	Ki	0.034	nM	CHEMBL390990
10.42	Ki	0.038	nM	METHOTREXATE
10.40	Ki	0.04	nM	TRIMETREXATE
10.11	Ki	0.077	nM	CHEMBL388501
10.11	Ki	0.077	nM	METHOTREXATE
10.00	Ki	0.1	nM	CHEMBL369258
10.00	Ki	0.1	nM	CHEMBL171765
10.00	Ki	0.1	nM	CHEMBL170760
10.00	Kd	0.1	nM	CHEMBL135937
9.97	Ki	0.107	nM	CHEMBL35364
9.96	Ki	0.11	nM	METHOTREXATE
9.92	Ki	0.12	nM	CHEMBL443763
9.88	Ki	0.131	nM	CHEMBL284943
9.75	Ki	0.179	nM	METHOTREXATE
9.74	Ki	0.183	nM	CHEMBL35427
9.70	Ki	0.2	nM	CHEMBL170837
9.70	Ki	0.2	nM	CHEMBL352960
9.70	Kd	0.2	nM	CHEMBL135937
9.68	Ki	0.21	nM	AMINOPTERIN
9.54	Ki	0.29	nM	CHEMBL354249
9.52	Ki	0.3	nM	CHEMBL170758
9.41	IC50	0.39	nM	CHEMBL251427
9.40	Ki	0.4	nM	CHEMBL424170
9.40	Ki	0.4	nM	CHEMBL171494
9.38	IC50	0.42	nM	TRIMETREXATE
9.30	Kd	0.5	nM	CHEMBL135581
9.27	Ki	0.54	nM	CHEMBL162476
9.22	IC50	0.6	nM	METHOTREXATE
9.22	Kd	0.6	nM	CHEMBL135581
9.16	Ki	0.69	nM	CHEMBL168069
9.15	IC50	0.7	nM	METHOTREXATE
9.14	IC50	0.72	nM	METHOTREXATE
9.10	Ki	0.8	nM	CHEMBL301030
9.09	IC50	0.82	nM	METHOTREXATE
9.08	IC50	0.84	nM	CHEMBL349572
9.00	IC50	1	nM	METHOTREXATE
9.00	IC50	1	nM	CHEMBL36083
8.96	IC50	1.1	nM	CHEMBL18155
8.93	IC50	1.18	nM	METHOTREXATE
8.92	IC50	1.2	nM	METHOTREXATE
8.89	IC50	1.3	nM	CHEMBL2261432
8.89	IC50	1.3	nM	CHEMBL83644
8.87	IC50	1.35	nM	CHEMBL160505
8.87	IC50	1.34	nM	CHEMBL160699
8.85	IC50	1.4	nM	TRIMETREXATE
8.85	IC50	1.4	nM	METHOTREXATE

PubChem BioAssay actives

1487 with measured affinity, of 3482 total; 50 most potent distinct compounds. Largely complementary to BindingDB; screening values are coarse (µM, 4 dp), so sub-nM hits tie at the floor.

Compound	Assay	Type	Value	Unit
2-[[4-carboxy-4-[[4-[(2,4-diaminoquinazolin-6-yl)methylamino]benzoyl]amino]butyl]carbamoyl]benzoic acid	57132: Compound was evaluated for the inhibition of Dihydrofolate reductase at concentration ranged from 0.15-0.50 uM	ki	<0.0001	uM
2-[[4-carboxy-4-[[4-[(2,4-diaminopyrido[2,3-d]pyrimidin-6-yl)methylamino]benzoyl]amino]butyl]carbamoyl]benzoic acid	57132: Compound was evaluated for the inhibition of Dihydrofolate reductase at concentration ranged from 0.15-0.50 uM	ki	<0.0001	uM
2-[[4-carboxy-4-[[4-[(2,4-diamino-5-chloroquinazolin-6-yl)methylamino]benzoyl]amino]butyl]carbamoyl]benzoic acid	57132: Compound was evaluated for the inhibition of Dihydrofolate reductase at concentration ranged from 0.15-0.50 uM	ki	<0.0001	uM
(2S)-2-[6-[(2,4-diaminopteridin-6-yl)methylamino]-3-oxo-1H-isoindol-2-yl]pentanedioic acid	282637: Inhibition of human DHFR	ki	<0.0001	uM
2-[[4-carboxy-4-[[4-[(2,4-diamino-5-methylquinazolin-6-yl)methylamino]benzoyl]amino]butyl]carbamoyl]benzoic acid	57132: Compound was evaluated for the inhibition of Dihydrofolate reductase at concentration ranged from 0.15-0.50 uM	ki	<0.0001	uM
Methotrexate	1314225: Inhibition of recombinant human DHFR assessed as reduction in NADPH oxidation using dihydrofolate as substrate by fluorescence spectrophotometric analysis	ki	<0.0001	uM
Pralatrexate	1894187: Inhibition of DHFR (unknown origin) at pH 6.7	ki	<0.0001	uM
5-(3-chlorophenyl)-6-[2-[2-(3-phenylpropoxy)phenyl]ethyl]pyrimidine-2,4-diamine;hydrochloride	1611287: Inhibition of human dihydrofolate reductase using dihydrofolate as substrate in presence of NADPH by UV-vis spectrophotometry analysis	ki	<0.0001	uM
(2S)-2-[[4-[(2,4-diaminopteridin-6-yl)methylamino]benzoyl]amino]pentanedioic acid	219254: Inhibitory activity against Wild-type human DHFR	ki	<0.0001	uM
8-methyl-7-pentan-3-ylpyrrolo[3,2-f]quinazoline-1,3-diamine	1260819: Competitive inhibition of human recombinant DHFR preincubated for 2 mins followed by substrate addition in presence of dihydrofolate	ki	<0.0001	uM
2-[[4-[(2,4-diaminoquinazolin-6-yl)methylamino]benzoyl]amino]pentanedioic acid	219254: Inhibitory activity against Wild-type human DHFR	ki	<0.0001	uM
2-[[4-carboxy-4-[[4-[(2,4-diaminopteridin-6-yl)methylamino]benzoyl]amino]butyl]carbamoyl]benzoic acid	57132: Compound was evaluated for the inhibition of Dihydrofolate reductase at concentration ranged from 0.15-0.50 uM	ki	<0.0001	uM
2-[[4-carboxy-4-[[4-[(2,4-diamino-5-methylpyrido[2,3-d]pyrimidin-6-yl)methylamino]benzoyl]amino]butyl]carbamoyl]benzoic acid	57132: Compound was evaluated for the inhibition of Dihydrofolate reductase at concentration ranged from 0.15-0.50 uM	ki	<0.0001	uM
2-[[4-carboxy-4-[[4-[(6,8-diaminoquinoxalin-2-yl)methylamino]benzoyl]amino]butyl]carbamoyl]benzoic acid	57138: Inhibitory activity against human recombinant Dihydrofolate reductase	ki	<0.0001	uM
2-[[4-carboxy-4-[[4-[1-(6,8-diaminoquinoxalin-2-yl)pent-4-yn-2-yl]benzoyl]amino]butyl]carbamoyl]benzoic acid	57138: Inhibitory activity against human recombinant Dihydrofolate reductase	ki	<0.0001	uM
2-[[4-carboxy-4-[[4-[2-(6,8-diaminoquinoxalin-2-yl)ethyl]benzoyl]amino]butyl]carbamoyl]benzoic acid	57138: Inhibitory activity against human recombinant Dihydrofolate reductase	ki	<0.0001	uM
2-[[4-carboxy-4-[[4-[1-(6,8-diaminoquinoxalin-2-yl)butan-2-yl]benzoyl]amino]butyl]carbamoyl]benzoic acid	57138: Inhibitory activity against human recombinant Dihydrofolate reductase	ki	<0.0001	uM
2-[[4-carboxy-4-[[4-[2-(6,8-diaminonaphthalen-2-yl)ethyl]benzoyl]amino]butyl]carbamoyl]benzoic acid	57138: Inhibitory activity against human recombinant Dihydrofolate reductase	ki	<0.0001	uM
2-[[4-carboxy-4-[[4-[(2,4-diaminopyrido[3,2-d]pyrimidin-6-yl)methylamino]benzoyl]amino]butyl]carbamoyl]benzoic acid	57132: Compound was evaluated for the inhibition of Dihydrofolate reductase at concentration ranged from 0.15-0.50 uM	ki	<0.0001	uM
2-[[4-[(2,4-diaminopyrido[2,3-d]pyrimidin-6-yl)methylamino]naphthalene-1-carbonyl]amino]pentanedioic acid	56168: Tested for inhibition against Dihydrofolate reductase from Pneumocystis carinii	ic50	<0.0001	uM
6-[(2,5-dimethoxyphenyl)methyl]-5-methylpyrido[2,3-d]pyrimidine-2,4-diamine	57133: Inhibition of human recombinant Dihydrofolate reductase enzyme	ki	<0.0001	uM
Trimethoprim	1179551: Binding affinity to DHFR (unknown origin) by NMR analysis	ki	<0.0001	uM
5-methyl-6-[(3,4,5-trimethoxyanilino)methyl]quinazoline-2,4-diamine	1915711: Inhibition of DHFR (unknown origin) assessed as inhibition constant	ki	<0.0001	uM
2-[[4-[3-carboxypropyl-[(2,4-diaminopteridin-6-yl)methyl]amino]benzoyl]amino]pentanedioic acid	56458: Inhibitory activity against Trypanosoma cruzi dihydrofolate reductase	ki	0.0001	uM
2-[[4-[4-carboxybutyl-[(2,4-diaminopteridin-6-yl)methyl]amino]benzoyl]amino]pentanedioic acid	56458: Inhibitory activity against Trypanosoma cruzi dihydrofolate reductase	ki	0.0001	uM
2-amino-5-methyl-8-(2-methylpropyl)-2,3-dihydropyrido[2,3-d]pyrimidin-4-one	57126: Tested for the apparent dissociation constant for binding of compound to ternary NADPH complex with human dihydrofolate reductase using equation 4	kd	0.0001	uM
2-[6-[(2,4-diaminopteridin-6-yl)methylamino]-3-oxo-1H-isoindol-2-yl]pentanedioic acid	282637: Inhibition of human DHFR	ki	0.0001	uM
7-tert-butyl-8-ethylpyrrolo[3,2-f]quinazoline-1,3-diamine	57133: Inhibition of human recombinant Dihydrofolate reductase enzyme	ki	0.0001	uM
7-butan-2-yl-8-ethylpyrrolo[3,2-f]quinazoline-1,3-diamine	57133: Inhibition of human recombinant Dihydrofolate reductase enzyme	ki	0.0001	uM
7-pentan-3-yl-8-propan-2-ylpyrrolo[3,2-f]quinazoline-1,3-diamine	57133: Inhibition of human recombinant Dihydrofolate reductase enzyme	ki	0.0001	uM
2-[[4-[5-carboxypentyl-[(2,4-diaminopteridin-6-yl)methyl]amino]benzoyl]amino]pentanedioic acid	56458: Inhibitory activity against Trypanosoma cruzi dihydrofolate reductase	ki	0.0002	uM
8-tert-butyl-7-propan-2-ylpyrrolo[3,2-f]quinazoline-1,3-diamine	57133: Inhibition of human recombinant Dihydrofolate reductase enzyme	ki	0.0002	uM
8-ethyl-7-pentan-3-ylpyrrolo[3,2-f]quinazoline-1,3-diamine	57133: Inhibition of human recombinant Dihydrofolate reductase enzyme	ki	0.0002	uM
(2R)-2-[[4-[2-(2,4-diamino-5,6,7,8-tetrahydropyrido[2,3-d]pyrimidin-6-yl)ethyl]benzoyl]amino]-2-methylpentanedioic acid	57139: Inhibitory activity against recombinant human dihydrofolate reductase (DHFR)	ki	0.0003	uM
5-[(2-fluorophenyl)methoxy]quinazoline-2,4-diamine	313040: Inhibition of human recombinant DHFR	ic50	0.0004	uM
8-methyl-7-(2-methylbutan-2-yl)pyrrolo[3,2-f]quinazoline-1,3-diamine	57133: Inhibition of human recombinant Dihydrofolate reductase enzyme	ki	0.0004	uM
7-pentan-3-yl-8-propylpyrrolo[3,2-f]quinazoline-1,3-diamine	57133: Inhibition of human recombinant Dihydrofolate reductase enzyme	ki	0.0004	uM
2-amino-7-methyl-8-propyl-2,3-dihydropyrido[2,3-d]pyrimidin-4-one	57123: Tested for the apparent dissociation constant for binding of compound to binary NADPH complex with human dihydrofolate reductase using equation 4	kd	0.0005	uM
2-[[4-[(2,4-diaminoquinazolin-5-yl)methylamino]benzoyl]amino]pentanedioic acid	219254: Inhibitory activity against Wild-type human DHFR	ki	0.0005	uM
(2R)-2-[[5-[2-(2,4-diamino-5,6,7,8-tetrahydropyrido[2,3-d]pyrimidin-6-yl)ethyl]thiophene-2-carbonyl]amino]-2-methylpentanedioic acid	57139: Inhibitory activity against recombinant human dihydrofolate reductase (DHFR)	ki	0.0007	uM
5-[[4-methoxy-3,5-bis[(E)-prop-1-enyl]phenyl]methyl]pyrimidine-2,4-diamine	56001: Antibacterial activity against Escherichia coli	ki	0.0008	uM
(2R,4R)-2-[[4-[(2,4-diaminopteridin-6-yl)methyl-methylamino]benzoyl]amino]-4-fluoropentanedioic acid	56966: Inhibitory activity against Dihydrofolate reductase (DHFR) isolated from CCRF-CEM human leukemia cells in experiment 1	ic50	0.0008	uM
4H-pyrrolo[3,2-f]quinazoline-1,3-diamine	1260819: Competitive inhibition of human recombinant DHFR preincubated for 2 mins followed by substrate addition in presence of dihydrofolate	ki	0.0010	uM
5-amino-2-[[4-[(2,4-diaminopteridin-6-yl)methyl-methylamino]benzoyl]amino]pentanoic acid	56974: Inhibitory concentration against dihydrofolate reductase enzyme (DHFR) enzyme isolated from CCRF-CEM human leukemia cells. value mentioned is from literature	ic50	0.0010	uM
5-amino-2-[[4-[(2,4-diaminopteridin-6-yl)methyl-methylamino]benzoyl]amino]-4,4-difluoropentanoic acid	56973: Inhibitory concentration against dihydrofolate reductase enzyme (DHFR) enzyme isolated from CCRF-CEM human leukemia cells.	ic50	0.0013	uM
2-[[4-[(2,4-diaminopteridin-6-yl)methyl-methylamino]benzoyl]amino]-3,3-difluoropentanedioic acid	56967: Inhibitory activity against Dihydrofolate reductase (DHFR) isolated from CCRF-CEM human leukemia cells in experiment 2	ic50	0.0013	uM
2-[[4-[(2,4-diaminopteridin-6-yl)methyl-methylamino]benzoyl]amino]-4-fluoropentanedioic acid	56966: Inhibitory activity against Dihydrofolate reductase (DHFR) isolated from CCRF-CEM human leukemia cells in experiment 1	ic50	0.0014	uM
6-[(3,5-dimethoxyphenyl)methyl]-5-methylpyrido[2,3-d]pyrimidine-2,4-diamine	56975: Inhibitory concentration against dihydrofolate reductase of rat liver	ic50	0.0015	uM
5-(3-chlorophenyl)-6-ethylpyrimidine-2,4-diamine	1533249: Inhibition of human DHFR	ki	0.0016	uM
6-fluoro-2-[4-(2-fluorophenyl)phenyl]-3-methylquinoline-4-carboxylic acid	1439522: Inhibition of recombinant human N-terminal truncated GST-tagged DHFR (31 to 395 residues) expressed in Escherichia coli BL21(DE3) pyrD using DHO as substrate preincubated for 5 mins followed by substrate addition measured for 5 mins by DCIP oxidation based CoQ10 enzyme coupled assay	ic50	0.0018	uM

CTD chemical–gene interactions

114 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Methotrexate	affects cotreatment, affects binding, increases expression, affects expression, affects response to substance (+5 more)	13
Folic Acid	decreases abundance, affects expression, affects response to substance, affects cotreatment, decreases expression (+2 more)	6
bisphenol A	affects expression, affects cotreatment, decreases methylation, decreases expression	4
sodium arsenite	decreases expression, increases expression, increases mutagenesis	4
Tobacco Smoke Pollution	decreases expression, increases methylation	4
Benzo(a)pyrene	decreases expression, increases expression	3
Fluorouracil	affects expression, increases expression	3
perfluorooctanoic acid	decreases expression	2
epigallocatechin gallate	affects cotreatment, increases expression, affects binding, decreases activity	2
Air Pollutants	increases expression, decreases expression, increases abundance	2
Arsenic	affects methylation, affects response to substance	2
Cisplatin	decreases expression, increases reaction, increases expression	2
Leucovorin	decreases abundance, decreases reaction, increases expression	2
7,8-Dihydro-7,8-dihydroxybenzo(a)pyrene 9,10-oxide	decreases expression, increases expression	2
aristolochic acid I	increases expression	1
GSK-J4	decreases expression	1
afuresertib	decreases expression	1
TAK-243	increases sumoylation	1
syringic acid	decreases activity	1
methylmercuric chloride	decreases expression	1
ferulic acid	decreases activity	1
naringin	decreases activity	1
triphenyl phosphate	affects expression	1
propionaldehyde	decreases expression	1
methylselenic acid	decreases expression	1
sodium arsenate	decreases expression	1
methylparaben	decreases expression	1
tris(1,3-dichloro-2-propyl)phosphate	decreases expression	1
cobaltous chloride	decreases expression	1
alpha-cobratoxin	decreases expression, decreases reaction	1

ChEMBL screening assays

457 unique, capped per target: 426 binding, 16 admet, 12 functional, 3 toxicity

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1017358	Binding	Inhibition of DHFR	A new bastadin from the sponge Psammaplysilla purpurea. — *J Nat Prod*
CHEMBL3867373	ADMET	Inhibition of recombinant human DHFR expressed in Escherichia coli preincubated for 15 mins followed by addition of DHF as substrate and NADPH measured after 60 mins by resazurin/diaphorase coupled assay	Discovery of Potent and Selective Leads against Toxoplasma gondii Dihydrofolate Reductase via Structure-Based Design. — *ACS Med Chem Lett*
CHEMBL5148457	Toxicity	Inhibition of recombinant human DHFR expressed in Escherichia coli BL21 (DE3) cells using dihydrofolate as substrate in presence of NADPH by spectrophotometric analysis	Multitarget, Selective Compound Design Yields Potent Inhibitors of a Kinetoplastid Pteridine Reductase 1. — *J Med Chem*

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 300 trials:

NCT	Phase	Status	Title
NCT00190697	Phase 4	COMPLETED	A Study of LY353381 (Arzoxifene) for Patients Who Benefitted From This Drug in Other Oncology Trials and Wished to Continue Treatment
NCT00719017	Phase 4	UNKNOWN	Upper Vaginectomy Versus Brachytherapy in Patients With Early Stage Endometrial Cancer Treated With Laparoscopic Surgery
NCT02543710	Phase 4	RECRUITING	Biomarker Guided Treatment in Gynaecological Cancer
NCT03349463	Phase 4	UNKNOWN	Evaluation of Fluciclovine Uptake in Patients With Cervical, Ovarian Epithelial or Endometrial Cancers.
NCT03752606	Phase 4	COMPLETED	Application of Tachosil During Lymphadenectomy
NCT05949424	Phase 4	UNKNOWN	OPTI - DOSE: Optimal Dosing of Oral Anticancer Drugs in Older Adults
NCT06049693	Phase 4	COMPLETED	Iron Prehabilitation in Endometrial Cancer
NCT06726291	Phase 4	RECRUITING	Akynzeo as Antiemetic Treatment in Patients With Endometrial Cancer
NCT06871787	Phase 4	NOT_YET_RECRUITING	Near-Infrared Fluorescence Imaging With Indocyanine Green to Evaluate Bowel Anastomoses in Gynecologic Oncology Surgery
NCT07281547	Phase 4	NOT_YET_RECRUITING	Low Dose Aspirin to Lower Inflammation and Prevent Endometrial Cancer in Postmenopausal Women With Non-atrophic Endometrial Changes and Pain
NCT07462663	Phase 4	NOT_YET_RECRUITING	SHAPE-ENDO: Pilot Randomized Trial of Multimodal Pre-Surgical Optimization Versus Standard Surgery in Patients With Obesity and Early-Stage Endometrial Cancer
NCT00002459	Phase 3	COMPLETED	Radiation Therapy or No Further Treatment Following Surgery in Treating Patients With Cancer of the Uterus
NCT00002493	Phase 3	COMPLETED	Radiation Therapy Compared With Combination Chemotherapy in Treating Patients With Advanced Endometrial Cancer
NCT00002641	Phase 3	COMPLETED	Surgery With or Without Chemotherapy in Treating Patients With Soft Tissue Sarcoma
NCT00002764	Phase 3	COMPLETED	Surgery With or Without Combination Chemotherapy in Treating Patients With Lung Metastases From Soft Tissue Sarcoma
NCT00002920	Phase 3	COMPLETED	S9630, Medroxyprogesterone in Treating Women With Breast Cancer
NCT00002976	Phase 3	TERMINATED	Estrogen Replacement Therapy in Treating Women With Early-Stage Endometrial Cancer
NCT00003267	Phase 3	COMPLETED	Pelvic Drains After Radical Hysterectomy in Treating Patients With Uterine, Cervical, or Vaginal Cancer
NCT00003691	Phase 3	COMPLETED	Combination Chemotherapy With or Without G-CSF in Treating Patients With Stage III, Stage IV, or Recurrent Endometrial Cancer
NCT00003749	Phase 3	COMPLETED	Surgery With or Without Lymphadenectomy and Radiation Therapy in Treating Patients With Endometrial Cancer
NCT00005583	Phase 3	COMPLETED	Radiation Therapy With or Without Chemotherapy in Treating Patients With High-Risk Endometrial Cancer
NCT00006027	Phase 3	COMPLETED	Comparison of Radiation Therapy With or Without Combination Chemotherapy Following Surgery in Treating Patients With Stage I or Stage II Endometrial Cancer
NCT00016341	Phase 3	TERMINATED	Combination Chemotherapy Compared With Hormone Therapy in Treating Patients With Recurrent, Stage III, or Stage IV Endometrial Cancer
NCT00033605	Phase 3	COMPLETED	Octreotide in Preventing Diarrhea in Patients Who Are Undergoing Radiation Therapy to the Pelvis
NCT00096408	Phase 3	COMPLETED	Laparoscopic Approach to Cancer of the Endometrium
NCT00245050	Phase 3	COMPLETED	Pyridoxine in Preventing Hand-Foot Syndrome in Patients Who Are Receiving Liposomal Doxorubicin for Cancer
NCT00376844	Phase 3	COMPLETED	External-Beam Radiation Therapy Compared With Vaginal Brachytherapy After Surgery for Stage I Endometrial Cancer
NCT00411138	Phase 3	UNKNOWN	Randomized Trial of Radiation Therapy With or Without Chemotherapy for Endometrial Cancer
NCT00566644	Phase 3	TERMINATED	Intrauterine Levonorgestrel and Observation or Observation Alone in Preventing Atypical Endometrial Hyperplasia and Endometrial Cancer in Women With Hereditary Non-Polyposis Colorectal Cancer or Lynch Syndrome
NCT00883116	Phase 3	TERMINATED	A Study of Ixabepilone as Second-line Therapy for Locally Advanced, Recurrent, or Metastatic Endometrial Cancer
NCT01087268	Phase 3	UNKNOWN	Hyperbaric Oxygen Therapy in Treating Long-Term Gastrointestinal Adverse Effects Caused by Radiation Therapy in Patients With Pelvic Cancer
NCT01470677	Phase 3	COMPLETED	Tachosil for the Prevention of Symptomatic Lymph Cysts
NCT01672892	Phase 3	COMPLETED	Standard Versus Intensity-Modulated Pelvic Radiation Therapy in Treating Patients With Endometrial or Cervical Cancer
NCT01767155	Phase 3	COMPLETED	Zoptarelin Doxorubicin (AEZS 108) as Second Line Therapy for Endometrial Cancer
NCT02584478	Phase 3	UNKNOWN	Phase 1/2a/3 Evaluation of Adding AL3818 to Standard Platinum-Based Chemotherapy in Subjects With Recurrent or Metastatic Endometrial, Ovarian, Fallopian, Primary Peritoneal or Cervical Carcinoma (AL3818-US-002)
NCT02762214	Phase 3	UNKNOWN	Role of Uterine Manipulator in Hysterectomy - Ro.Man.HY
NCT03469674	Phase 3	ACTIVE_NOT_RECRUITING	PORTEC-4a: Molecular Profile-based Versus Standard Adjuvant Radiotherapy in Endometrial Cancer
NCT03555422	Phase 3	COMPLETED	Maintenance With Selinexor/Placebo After Combination Chemotherapy in Participants With Endometrial Cancer [SIENDO]
NCT03603184	Phase 3	COMPLETED	Atezolizumab Trial in Endometrial Cancer - AtTEnd
NCT03785288	Phase 3	RECRUITING	Vaginal Cuff Brachytherapy Fractionation Study
NCT03914612	Phase 3	ACTIVE_NOT_RECRUITING	Testing the Addition of the Immunotherapy Drug Pembrolizumab to the Usual Chemotherapy Treatment (Paclitaxel and Carboplatin) in Stage III-IV or Recurrent Endometrial Cancer
NCT04073706	Phase 3	RECRUITING	Sentinel Node Biopsy in Endometrial Cancer
NCT04237090	Phase 3	COMPLETED	Feasibility of a Clinical Trial Comparing the Use of Cetirizine to Replace Diphenhydramine in the Prevention of Reactions Related to Paclitaxel
NCT04789694	Phase 3	RECRUITING	Prehabilitation in Gynaecological Cancer Patients
NCT04792749	Phase 3	UNKNOWN	Clinical Effects of Metformin on Fertility-sparing Treatment for Early Endometrial Cancer
NCT04970368	Phase 3	TERMINATED	Comparison of Nodal Staging in Endometrial Cancer
NCT05077215	Phase 3	NOT_YET_RECRUITING	Efficacy and Safety of a Repurposed Drug Added to the Combination of Len Plus Pem in Advanced Endometrial Cancer
NCT05078047	Phase 3	ACTIVE_NOT_RECRUITING	Study Comparing the Standard Administration of IO Versus the Same IO Administered Each 3 Months in Patients in Response After 6 Months of Standard IO
NCT05201547	Phase 3	ACTIVE_NOT_RECRUITING	Endometrial Cancer Patientes MMR Deficient Comparing Chemotherapy vs Dostarlimab in First Line
NCT05256225	Phase 3	RECRUITING	Testing the Addition of Herceptin Hylecta or Phesgo to the Usual Chemotherapy for HER2 Positive Endometrial Serous Carcinoma or Carcinosarcoma
NCT05446324	Phase 3	UNKNOWN	Feasibility of Gallium-68-tilmanocept PET/CT for Sentinel Lymph Node Detection in Endometrial Cancer
NCT05524389	Phase 3	NOT_YET_RECRUITING	Study of Early Stage Endometrial Cancer Based on Molecular Classification and Traditional Risk Stratification to Guide Adjuvant Radiotherapy Decisions
NCT05611931	Phase 3	ACTIVE_NOT_RECRUITING	Selinexor in Maintenance Therapy After Systemic Therapy for Participants With p53 Wild-Type, Advanced or Recurrent Endometrial Carcinoma
NCT05712941	Phase 3	WITHDRAWN	Comparison of Letrozole With Lerociclib Versus Letrozole With Placebo Control in Patients With Advanced/Metastatic or Recurrent, Grade 1 or Grade 2 Endometrial Cancer
NCT06007586	Phase 3	COMPLETED	Prevention and Treatment of CINV Caused by TC Regimen in Gynecological Malignant Tumor Patients
NCT06132958	Phase 3	ACTIVE_NOT_RECRUITING	Sacituzumab Tirumotecan (MK-2870) in Post Platinum and Post Immunotherapy Endometrial Cancer (MK-2870-005)
NCT06340568	Phase 3	RECRUITING	A Clinical Study of the Anti-cancer Effects of an Investigational Therapy or Chemotherapy in Patients With Recurring Uterine Cancer
NCT06475599	Phase 3	NOT_YET_RECRUITING	Anlotinib Hydrochloride Capsules Combined With TQB2450 in the Treatment of Endometrial Cancer
NCT06486441	Phase 3	ACTIVE_NOT_RECRUITING	Study of Sacituzumab Govitecan Versus Treatment of Physician’s Choice in Participants With Endometrial Cancer After Platinum-Based Chemotherapy and Immunotherapy (ASCENT-GYN-01/GOG-3104/ENGOT-en26)
NCT06584032	Phase 3	RECRUITING	Study of Fruquintinib Plus Sintilimab for Treatment of Advanced Endometrial Cancer

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for DHFR across ~30M SureChEMBL compounds — explore on Sugi Predict.