DHRS9

Summary

DHRS9 (dehydrogenase/reductase 9, HGNC:16888) is a protein-coding gene on chromosome 2q31.1, encoding Dehydrogenase/reductase SDR family member 9 (Q9BPW9). 3-alpha-hydroxysteroid dehydrogenase that converts 3-alpha-tetrahydroprogesterone (allopregnanolone) to dihydroxyprogesterone and 3-alpha-androstanediol to dihydroxyprogesterone.

This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. This protein demonstrates oxidoreductase activity toward hydroxysteroids and is able to convert 3-alpha-tetrahydroprogesterone to dihydroxyprogesterone and 3-alpha-androstanediol to dihydroxyprogesterone in the cytoplasm, and may additionally function as a transcriptional repressor in the nucleus. Alternative splicing results in multiple transcript variants.

Source: NCBI Gene 10170 — RefSeq curated summary.

At a glance

• GWAS associations: 7
• Clinical variants (ClinVar): 74 total — 1 likely-pathogenic
• Druggable target: yes — 1 molecules with ChEMBL bioactivity
• MANE Select transcript: NM_001376924

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:16888
Approved symbol	DHRS9
Name	dehydrogenase/reductase 9
Location	2q31.1
Locus type	gene with protein product
Status	Approved
Aliases	RDHL, 3alpha-HSD, RETSDR8, RDH15, SDR9C4
Ensembl gene	ENSG00000073737
Ensembl biotype	protein_coding
OMIM	612131
Entrez	10170

Gene structure

Transcript identifiers

Ensembl transcripts: 16 — 16 protein_coding

ENST00000357546, ENST00000412271, ENST00000421653, ENST00000428522, ENST00000432060, ENST00000436483, ENST00000450153, ENST00000602501, ENST00000674881, ENST00000867643, ENST00000867644, ENST00000867645, ENST00000867646, ENST00000867647, ENST00000867648, ENST00000969118

RefSeq mRNA: 5 — MANE Select: NM_001376924 NM_001142270, NM_001142271, NM_001289763, NM_001376924, NM_199204

CCDS: CCDS2231, CCDS74600

Canonical transcript exons

ENST00000674881 — 5 exons

Exon	Start	End
ENSE00001411079	169095544	169096167
ENSE00002275346	169091790	169091953
ENSE00003534237	169083329	169083587
ENSE00003585749	169081523	169081894
ENSE00003901214	169069563	169069717

Expression profiles

Bgee: expression breadth ubiquitous, 227 present calls, max score 99.20.

FANTOM5 (CAGE): breadth broad, TPM avg 5.3333 / max 411.2630, expressed in 463 samples.

FANTOM5 promoters (11 alternative TSS)

Promoter ID	TPM avg	Samples expressed
23529	3.6082	391
23531	0.6696	160
23534	0.2332	54
23530	0.1974	103
23532	0.1908	74
23525	0.1127	45
23526	0.0992	45
23527	0.0715	32
23528	0.0662	29
23533	0.0653	15

Top tissues by expression

278 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
nasal cavity epithelium	UBERON:0005384	99.20	gold quality
epithelium of nasopharynx	UBERON:0001951	98.85	gold quality
epithelium of bronchus	UBERON:0002031	98.76	gold quality
bronchial epithelial cell	CL:0002328	98.67	gold quality
palpebral conjunctiva	UBERON:0001812	98.50	gold quality
mucosa of transverse colon	UBERON:0004991	98.50	gold quality
bronchus	UBERON:0002185	98.41	gold quality
colonic mucosa	UBERON:0000317	97.44	gold quality
mucosa of sigmoid colon	UBERON:0004993	97.20	gold quality
ileal mucosa	UBERON:0000331	97.02	gold quality
nasal cavity mucosa	UBERON:0001826	95.46	gold quality
esophagus squamous epithelium	UBERON:0006920	94.97	gold quality
olfactory segment of nasal mucosa	UBERON:0005386	94.83	gold quality
epithelium of esophagus	UBERON:0001976	94.25	gold quality
sperm	CL:0000019	94.11	gold quality
rectum	UBERON:0001052	93.43	gold quality
oral cavity	UBERON:0000167	92.97	gold quality
tongue squamous epithelium	UBERON:0006919	91.48	gold quality
male germ cell	CL:0000015	91.37	gold quality
right atrium auricular region	UBERON:0006631	91.29	gold quality
mucosa of paranasal sinus	UBERON:0005030	90.75	gold quality
cardiac atrium	UBERON:0002081	90.71	gold quality
squamous epithelium	UBERON:0006914	90.66	gold quality
pancreatic ductal cell	CL:0002079	89.87	silver quality
trachea	UBERON:0003126	89.80	gold quality
cardiac muscle of right atrium	UBERON:0003379	89.55	silver quality
transverse colon	UBERON:0001157	88.71	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	88.49	gold quality
periodontal ligament	UBERON:0008266	88.27	gold quality
amniotic fluid	UBERON:0000173	87.26	gold quality

Single-cell (SCXA)

Detected in 7 experiment(s), a significant marker in 7.

Experiment	Marker?	Max mean expression
E-GEOD-86618	yes	1732.50
E-MTAB-8530	yes	720.55
E-MTAB-6075	yes	580.80
E-CURD-114	yes	309.62
E-GEOD-125970	yes	16.93
E-ANND-3	yes	9.15
E-CURD-112	yes	5.90

Regulation

Is transcription factor: no

Upstream regulators (CollecTRI, top): NR3C1

Literature-anchored findings (GeneRIF, showing 9)

• expression of retinol dehydrogenase L is regulated by APC and CDX2 (PMID:15190067)
• Dehydrogenase/reductase SDR family member 9 is a moonlighting protein that functions as both a metabolic enzyme and as a transcriptional repressor. (PMID:16691198)
• retinoic acid-responsive genes are induced by Epstein-Barr virus lytic infection through induction of a retinol-metabolizing enzyme, DHRS9 (PMID:17244623)
• decreased expression of DHRS9 correlates with tumor progression and may serve as a potential prognostic biomarker in colorectal cancer (PMID:26254099)
• Even at early stages of malignant transformation, a significant decrease in ADH1B, ADH3, RDHL, and RALDH1 mRNA levels was observed in 82, 79, 73, and 64% of tumor specimens, respectively (PMID:27239845)
• DHRS9 is a specific and stable marker of human regulatory macrophages. (PMID:28594751)
• The study findings suggest that DHRS9 might be a useful diagnostic and prognostic marker for oral squamous cell carcinoma (PMID:30149992)
• Are Mutations in the DHRS9 Gene Causally Linked to Epilepsy? A Case Report. (PMID:32752300)
• Transcription Factor FXR Activates DHRS9 to Inhibit the Cell Oxidative Phosphorylation and Suppress Colon Cancer Progression. (PMID:36340269)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	dhrs9	ENSDARG00000019260
mus_musculus	Dhrs9	ENSMUSG00000027068
rattus_norvegicus	Dhrs9	ENSRNOG00000065735

Paralogs (25): HSD17B6 (ENSG00000025423), RDH11 (ENSG00000072042), HSD17B10 (ENSG00000072506), HSD17B2 (ENSG00000086696), HSD17B14 (ENSG00000087076), DHRS12 (ENSG00000102796), HSDL1 (ENSG00000103160), HSD17B1 (ENSG00000108786), RDH10 (ENSG00000121039), HSD17B3 (ENSG00000130948), HSD17B7 (ENSG00000132196), HSD17B4 (ENSG00000133835), RDH5 (ENSG00000135437), RDH16 (ENSG00000139547), RDH12 (ENSG00000139988), HSD17B12 (ENSG00000149084), BDH1 (ENSG00000161267), DHRS3 (ENSG00000162496), SDR9C7 (ENSG00000170426), HSD17B13 (ENSG00000170509), SDR16C5 (ENSG00000170786), HSD11B2 (ENSG00000176387), WWOX (ENSG00000186153), HSD17B11 (ENSG00000198189), HSD17B8 (ENSG00000204228)

Protein

Protein identifiers

Dehydrogenase/reductase SDR family member 9 — Q9BPW9 (reviewed: Q9BPW9)

Alternative names: 3-alpha hydroxysteroid dehydrogenase, NADP-dependent retinol dehydrogenase/reductase, RDH-E2, RDHL, Retinol dehydrogenase 15, Short chain dehydrogenase/reductase family 9C member 4, Short-chain dehydrogenase/reductase retSDR8, Tracheobronchial epithelial cell-specific retinol dehydrogenase

All UniProt accessions (2): Q9BPW9, C9J430

UniProt curated annotations — full annotation on UniProt →

Function. 3-alpha-hydroxysteroid dehydrogenase that converts 3-alpha-tetrahydroprogesterone (allopregnanolone) to dihydroxyprogesterone and 3-alpha-androstanediol to dihydroxyprogesterone. Also plays a role in the biosynthesis of retinoic acid from retinaldehyde. Can utilize both NADH and NADPH.

Subunit / interactions. Homotetramer.

Subcellular location. Microsome membrane. Endoplasmic reticulum membrane.

Tissue specificity. Highly expressed in trachea and epidermis. Detected at lower levels in spinal cord, bone marrow, brain, tongue, esophagus, heart, colon, testis, placenta, lung, skeletal muscle and lymph node.

Similarity. Belongs to the short-chain dehydrogenases/reductases (SDR) family.

Isoforms (4)

UniProt ID	Names	Canonical?
Q9BPW9-1	1	yes
Q9BPW9-2	2, Retinol dehydrogenase homolog isoform-2
Q9BPW9-3	3, Retinol dehydrogenase homolog isoform-1
Q9BPW9-4	4

RefSeq proteins (5): NP_001135742, NP_001135743, NP_001276692, NP_001363853, NP_954674 (=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR002347	SDR_fam	Family
IPR036291	NAD(P)-bd_dom_sf	Homologous_superfamily

Pfam: PF00106

Catalyzed reactions (Rhea), 6 shown:

• androsterone + NAD(+) = 5alpha-androstan-3,17-dione + NADH + H(+) (RHEA:20381)
• all-trans-retinol + NAD(+) = all-trans-retinal + NADH + H(+) (RHEA:21284)
• 3alpha-hydroxy-5alpha-pregnan-20-one + NAD(+) = 5alpha-pregnane-3,20-dione + NADH + H(+) (RHEA:41980)
• 3beta-hydroxy-5alpha-pregnane-20-one + NAD(+) = 5alpha-pregnane-3,20-dione + NADH + H(+) (RHEA:41988)
• 17beta-hydroxy-5alpha-androstan-3-one + NAD(+) = 5alpha-androstan-3,17-dione + NADH + H(+) (RHEA:41992)
• 5alpha-androstane-3alpha,17beta-diol + NAD(+) = 17beta-hydroxy-5alpha-androstan-3-one + NADH + H(+) (RHEA:42004)

UniProt features (15 total): binding site 4, splice variant 3, mutagenesis site 2, sequence conflict 2, signal peptide 1, chain 1, sequence variant 1, active site 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9BPW9-F1	94.55	0.84

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Catalytic / active sites (1): 176 (proton acceptor)

Ligand- & substrate-binding residues (4): 34–58; 83; 164; 180

Mutagenesis-validated functional residues (2):

Position	Phenotype
176	decreases androsterone dehydrogenase activity; when associated with r-180.
180	decreases androsterone dehydrogenase activity; when associated with f-176.

Function

Pathways and Gene Ontology

Reactome pathways

2 pathways

ID	Pathway
R-HSA-2453902	The canonical retinoid cycle in rods (twilight vision)
R-HSA-5365859	RA biosynthesis pathway

MSigDB gene sets: 191 (showing top): TONKS_TARGETS_OF_RUNX1_RUNX1T1_FUSION_MONOCYTE_UP, GOBP_EPITHELIUM_DEVELOPMENT, MODULE_169, GOBP_C21_STEROID_HORMONE_METABOLIC_PROCESS, GOBP_REGULATION_OF_HORMONE_LEVELS, GOBP_RETINOL_METABOLIC_PROCESS, GOBP_MONOCARBOXYLIC_ACID_METABOLIC_PROCESS, GOBP_KETONE_METABOLIC_PROCESS, GOBP_ORGANIC_ACID_BIOSYNTHETIC_PROCESS, TONKS_TARGETS_OF_RUNX1_RUNX1T1_FUSION_ERYTHROCYTE_UP, GOMF_STEROID_DEHYDROGENASE_ACTIVITY_ACTING_ON_THE_CH_OH_GROUP_OF_DONORS_NAD_OR_NADP_AS_ACCEPTOR, GOBP_SMALL_MOLECULE_BIOSYNTHETIC_PROCESS, OSWALD_HEMATOPOIETIC_STEM_CELL_IN_COLLAGEN_GEL_UP, BLALOCK_ALZHEIMERS_DISEASE_UP, GROSS_HYPOXIA_VIA_ELK3_DN

GO Biological Process (8): steroid metabolic process (GO:0008202), androgen metabolic process (GO:0008209), epithelial cell differentiation (GO:0030855), progesterone metabolic process (GO:0042448), retinol metabolic process (GO:0042572), 9-cis-retinoic acid biosynthetic process (GO:0042904), retinoic acid biosynthetic process (GO:0002138), lipid metabolic process (GO:0006629)

GO Molecular Function (9): alcohol dehydrogenase (NAD+) activity (GO:0004022), all-trans-retinol dehydrogenase (NAD+) activity (GO:0004745), oxidoreductase activity (GO:0016491), racemase and epimerase activity (GO:0016854), androsterone dehydrogenase [NAD(P)+] activity (GO:0047023), testosterone dehydrogenase (NAD+) activity (GO:0047035), androstan-3-alpha,17-beta-diol dehydrogenase (NAD+) activity (GO:0047044), protein binding (GO:0005515), oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)

GO Cellular Component (3): endoplasmic reticulum membrane (GO:0005789), endoplasmic reticulum (GO:0005783), membrane (GO:0016020)

Reactome top-level categories

Rollup of top-2 pathways:

Category	Pathways
Visual phototransduction	1
Signaling by Retinoic Acid	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
hormone metabolic process	2
olefinic compound metabolic process	2
steroid dehydrogenase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor	2
lipid metabolic process	1
steroid metabolic process	1
cell differentiation	1
epithelium development	1
C21-steroid hormone metabolic process	1
ketone metabolic process	1
retinoid metabolic process	1
primary alcohol metabolic process	1
retinoic acid biosynthetic process	1
9-cis-retinoic acid metabolic process	1
diterpenoid biosynthetic process	1
retinoic acid metabolic process	1
monocarboxylic acid biosynthetic process	1
primary metabolic process	1
alcohol dehydrogenase [NAD(P)+] activity	1
alcohol dehydrogenase (NAD+) activity	1
catalytic activity	1
isomerase activity	1
17-beta-hydroxysteroid dehydrogenase (NAD+) activity	1
binding	1
oxidoreductase activity, acting on CH-OH group of donors	1
organelle membrane	1
nuclear outer membrane-endoplasmic reticulum membrane network	1
endoplasmic reticulum subcompartment	1
cytoplasm	1
endomembrane system	1
intracellular membrane-bounded organelle	1
cellular anatomical structure	1

Protein interactions and networks

STRING

1010 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
DHRS9	AKR1C4	P17516	945
DHRS9	AKR1C2	P52895	930
DHRS9	AKR1C3	P42330	926
DHRS9	AKR1C1	P52896	913
DHRS9	DHDH	Q9UQ10	834
DHRS9	AKR1B10	O60218	765
DHRS9	AKR1A1	P14550	724
DHRS9	SDAD1	Q9NVU7	571
DHRS9	AKR1B1	P15121	559
DHRS9	HSD3B1	P14060	534
DHRS9	DHRS3	O75911	527
DHRS9	CDX2	Q99626	523
DHRS9	RBP1	P09455	517
DHRS9	SRD5A1	P18405	510
DHRS9	CYP11A1	P05108	493

IntAct

16 interactions, top by confidence:

A	B	Type	Score
DHRS9	MFSD4B	psi-mi:“MI:0914”(association)	0.530
TFDP3	E2F3	psi-mi:“MI:0914”(association)	0.530
DHRS9	HNRNPAB	psi-mi:“MI:0915”(physical association)	0.400
DHRS9	ATP2B2	psi-mi:“MI:0914”(association)	0.350
TULP3	PPM1G	psi-mi:“MI:0914”(association)	0.350
ATG16L1	ESYT2	psi-mi:“MI:0914”(association)	0.350
ATG16L1		psi-mi:“MI:0914”(association)	0.350
OR2A4	A2ML1	psi-mi:“MI:0914”(association)	0.350
PPP2R2B	A2ML1	psi-mi:“MI:0914”(association)	0.350
CCR1	UBA6	psi-mi:“MI:0914”(association)	0.350
SSUH2	IGLC7	psi-mi:“MI:0914”(association)	0.350
PINK1	A2ML1	psi-mi:“MI:0914”(association)	0.350
DHRS9	SLAMF1	psi-mi:“MI:0914”(association)	0.350
ZSCAN26	TRIM11	psi-mi:“MI:0914”(association)	0.350
SMPD2	A2ML1	psi-mi:“MI:0914”(association)	0.350

BioGRID (40): TTYH3 (Affinity Capture-MS), ATP2B2 (Affinity Capture-MS), C1orf85 (Affinity Capture-MS), CHIC2 (Affinity Capture-MS), GALNT11 (Affinity Capture-MS), KIAA1919 (Affinity Capture-MS), MAVS (Affinity Capture-MS), EMB (Affinity Capture-MS), SLC2A8 (Affinity Capture-MS), CHIC2 (Affinity Capture-MS), EMB (Affinity Capture-MS), SLC16A10 (Affinity Capture-MS), KIAA1919 (Affinity Capture-MS), GALNT11 (Affinity Capture-MS), C1orf85 (Affinity Capture-MS)

ESM2 similar proteins: A2ADU8, A2ADU9, A6QP72, F6ZFR0, O74850, O94361, P51658, Q08650, Q16635, Q22267, Q32LS6, Q3UN02, Q41745, Q4V8A1, Q4V9F0, Q502J0, Q54GC1, Q58HT5, Q58NB6, Q5F3X0, Q62730, Q6CF02, Q6E1M8, Q6E213, Q6IV76, Q6IV77, Q6IV78, Q6IV82, Q6IV83, Q6IV84, Q6IWY1, Q6P342, Q6PAZ3, Q6ZPD8, Q7TQA3, Q8LG50, Q8N3Y7, Q8TC12, Q8VD48, Q91WF0

Diamond homologs: A0A017SE81, A0A0E3D8L9, A0A0U1LQE2, A0A140JWS5, A0A2G0QDN4, A0A3R5XUE6, A0A5B8YU68, A0A8F5XX49, A6SSW9, A7LB60, D2WKD9, F1QLP1, G4N286, G9N4A9, N4WE73, O05730, O14756, O16881, O54753, O54909, O55240, O74628, O75452, P0AFP4, P0AFP5, P0CU71, P0DKC5, P0DKC6, P15047, P25970, P29147, P37059, P37959, P39577, P40471, P50170, P54554, P66778, P69166, P71079

SIGNOR signaling

2 interactions.

A	Effect	B	Mechanism
DHRS9	“down-regulates quantity”	retinol	“chemical modification”
DHRS9	“up-regulates quantity”	retinal	“chemical modification”

Disease & clinical

Clinical variants and AI predictions

ClinVar

74 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	1
Uncertain significance	60
Likely benign	4
Benign	0

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
187824	GRCh37/hg19 2q24.3-31.1(chr2:167996718-170671886)x1	Likely pathogenic

SpliceAI

911 predictions. Top by Δscore:

Variant	Effect	Δscore
2:169072660:G:GT	donor_gain	1.0000
2:169081891:AAAG:A	donor_loss	1.0000
2:169081895:GT:G	donor_loss	1.0000
2:169083321:T:TA	acceptor_gain	1.0000
2:169083323:TTCTA:T	acceptor_loss	1.0000
2:169083324:TCTA:T	acceptor_loss	1.0000
2:169083325:CTAG:C	acceptor_loss	1.0000
2:169083326:TA:T	acceptor_loss	1.0000
2:169083327:A:AG	acceptor_gain	1.0000
2:169083328:G:GG	acceptor_gain	1.0000
2:169083328:GGTC:G	acceptor_gain	1.0000
2:169083328:GGTCT:G	acceptor_gain	1.0000
2:169083583:TTAAG:T	donor_loss	1.0000
2:169083584:TAAG:T	donor_loss	1.0000
2:169083585:AAG:A	donor_loss	1.0000
2:169083586:AGG:A	donor_loss	1.0000
2:169083587:GGTA:G	donor_loss	1.0000
2:169083588:GTA:G	donor_loss	1.0000
2:169083589:T:A	donor_loss	1.0000
2:169081890:GAAAG:G	donor_gain	0.9900
2:169081896:T:G	donor_loss	0.9900
2:169083327:AG:A	acceptor_gain	0.9900
2:169083328:GG:G	acceptor_gain	0.9900
2:169083328:GGT:G	acceptor_gain	0.9900
2:169083570:TTTC:T	donor_gain	0.9900
2:169091954:G:GG	donor_gain	0.9900
2:169072661:C:T	donor_gain	0.9800
2:169081686:T:TA	acceptor_gain	0.9800
2:169083487:A:T	donor_gain	0.9800
2:169083565:G:GT	donor_gain	0.9800

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000154418 (2:169087702 GTAATGAATTTTGCTAGGAC>G), RS1000237067 (2:169088087 G>T), RS1000253814 (2:169069907 C>T), RS1000332330 (2:169082476 T>A), RS1000392200 (2:169085543 C>A,T), RS1000557867 (2:169093760 G>A), RS1000708505 (2:169088164 G>A), RS1000837900 (2:169076188 G>T), RS1000852948 (2:169072033 C>A), RS1000853741 (2:169082230 A>G), RS1000934028 (2:169088382 G>A,C), RS1001062067 (2:169092859 C>G), RS1001244226 (2:169083880 G>C), RS1001259331 (2:169089723 T>C), RS1001294169 (2:169086967 T>C)

Disease associations

OMIM: gene MIM:612131 | disease phenotypes:

GenCC curated gene-disease

Mondo (0):

Orphanet (0):

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

7 associations (top):

Study	Trait	p-value
GCST006993_3	Hippocampal volume in Alzheimer’s disease dementia	1.000000e-06
GCST009652_7	Serum alkaline phosphatase levels	6.000000e-10
GCST010241_213	Apolipoprotein A1 levels	1.000000e-09
GCST010396_67	Gut microbiota (bacterial taxa, hurdle binary method)	8.000000e-06
GCST90011900_173	Serum alkaline phosphatase levels	1.000000e-48
GCST90013405_14	Liver enzyme levels (alanine transaminase)	4.000000e-22
GCST90013407_195	Liver enzyme levels (gamma-glutamyl transferase)	1.000000e-27

EFO canonical traits (5, from GWAS)

EFO ID	Trait name
EFO:0005035	hippocampal volume
EFO:0004533	alkaline phosphatase measurement
EFO:0004614	apolipoprotein A 1 measurement
EFO:0007874	gut microbiome measurement
EFO:0004532	serum gamma-glutamyl transferase measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL5974 (SINGLE PROTEIN)

Molecules with ChEMBL bioactivity

1 molecules (phase ≥1), by development phase (incl. off-target/promiscuous compounds). Patent mentions across the top 20 by phase: 156,366 (via chembl_molecule»patent_compound — counts attach to the compound, not the gene–compound relationship, so off-target/promiscuous molecules can dominate).

Molecule	Name	Phase	Patents
CHEMBL6	INDOMETHACIN	4	156,366

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

85 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	affects cotreatment, increases abundance, increases expression, decreases expression	3
Benzo(a)pyrene	affects methylation, decreases expression, increases expression	3
Tobacco Smoke Pollution	affects expression, decreases expression, increases expression	3
Tretinoin	affects cotreatment, increases expression	3
propionaldehyde	increases expression	2
butyraldehyde	increases expression	2
pentanal	increases expression	2
Rosiglitazone	increases expression	2
Troglitazone	increases expression	2
Acetaminophen	increases expression, affects cotreatment	2
Arsenic	increases abundance, affects cotreatment, increases expression, decreases expression	2
Copper	affects cotreatment, decreases expression, affects binding, increases expression	2
Phenobarbital	affects expression, increases expression	2
Silicon Dioxide	increases expression	2
Triclosan	increases expression, decreases expression, affects cotreatment	2
Isotretinoin	decreases expression, affects cotreatment, increases expression	2
Aflatoxin B1	increases expression	2
Particulate Matter	increases expression, decreases expression, increases abundance	2
methyleugenol	increases expression	1
triphenyl phosphate	affects expression	1
senecionine	increases expression	1
senkirkine	increases expression	1
sodium arsenate	decreases expression, increases abundance	1
heliotrine	increases expression	1
n-hexanal	increases expression	1
2-methyl-4-isothiazolin-3-one	increases expression	1
ascorbate-2-phosphate	affects binding, affects cotreatment, increases expression	1
2,3-pentanedione	increases expression	1
arsenite	decreases expression, increases abundance	1
3,4,5,3’,4’-pentachlorobiphenyl	affects expression	1

ChEMBL screening assays

2 unique, capped per target: 2 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL1031472	Binding	Inhibition of 3alpha-HSD	Synthesis and pharmacological activities of some sesquiterpene quinones and hydroquinones. — Bioorg Med Chem

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.