DLGAP2

Summary

DLGAP2 (DLG associated protein 2, HGNC:2906) is a protein-coding gene on chromosome 8p23.3, encoding Disks large-associated protein 2 (Q9P1A6). May play a role in the molecular organization of synapses and neuronal cell signaling.

The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified.

Source: NCBI Gene 9228 — RefSeq curated summary.

At a glance

• Gene–disease (curated): complex neurodevelopmental disorder (Limited, ClinGen)
• GWAS associations: 20
• Clinical variants (ClinVar): 260 total — 4 pathogenic, 1 likely-pathogenic
• Phenotypes (HPO): 1
• Dosage sensitivity (ClinGen): haploinsufficiency no evidence, triplosensitivity no evidence
• MANE Select transcript: NM_001346810

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2906
Approved symbol	DLGAP2
Name	DLG associated protein 2
Location	8p23.3
Locus type	gene with protein product
Status	Approved
Aliases	DAP-2
Ensembl gene	ENSG00000198010
Ensembl biotype	protein_coding
OMIM	605438
Entrez	9228

Gene structure

Transcript identifiers

Ensembl transcripts: 15 — 8 protein_coding_CDS_not_defined, 6 protein_coding, 1 retained_intron

ENST00000421627, ENST00000518530, ENST00000520524, ENST00000520816, ENST00000520901, ENST00000522092, ENST00000522499, ENST00000522626, ENST00000522989, ENST00000524065, ENST00000524139, ENST00000577187, ENST00000578889, ENST00000612087, ENST00000637795

RefSeq mRNA: 1 — MANE Select: NM_001346810 NM_001346810

CCDS: CCDS87572

Canonical transcript exons

ENST00000620101 — 0 exons

Expression profiles

Bgee: expression breadth ubiquitous, 113 present calls, max score 90.26.

FANTOM5 (CAGE): breadth tissue_specific, TPM avg 0.9616 / max 110.0647, expressed in 117 samples.

FANTOM5 promoters (6 alternative TSS)

Promoter ID	TPM avg	Samples expressed
87141	0.5651	89
87142	0.3210	81
87143	0.0378	3
87144	0.0225	3
87161	0.0093	3
87162	0.0059	3

Top tissues by expression

125 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
left testis	UBERON:0004533	90.26	gold quality
right testis	UBERON:0004534	89.40	gold quality
testis	UBERON:0000473	89.23	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	85.09	gold quality
superior frontal gyrus	UBERON:0002661	83.94	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	82.03	gold quality
primary visual cortex	UBERON:0002436	81.75	gold quality
corpus callosum	UBERON:0002336	78.57	gold quality
prefrontal cortex	UBERON:0000451	77.95	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	77.64	gold quality
frontal cortex	UBERON:0001870	77.56	gold quality
Brodmann (1909) area 9	UBERON:0013540	77.23	gold quality
right frontal lobe	UBERON:0002810	76.39	gold quality
cerebral cortex	UBERON:0000956	76.06	gold quality
anterior cingulate cortex	UBERON:0009835	75.52	gold quality
nucleus accumbens	UBERON:0001882	73.62	gold quality
putamen	UBERON:0001874	72.30	gold quality
Ammon’s horn	UBERON:0001954	71.33	gold quality
caudate nucleus	UBERON:0001873	71.32	gold quality
temporal lobe	UBERON:0001871	70.04	gold quality
amygdala	UBERON:0001876	69.82	gold quality
cortical plate	UBERON:0005343	69.53	gold quality
brain	UBERON:0000955	68.83	gold quality
pituitary gland	UBERON:0000007	68.80	gold quality
adenohypophysis	UBERON:0002196	66.78	gold quality
hypothalamus	UBERON:0001898	63.45	gold quality
adult mammalian kidney	UBERON:0000082	58.62	gold quality
thyroid gland	UBERON:0002046	57.73	gold quality
left lobe of thyroid gland	UBERON:0001120	57.53	gold quality
right lobe of thyroid gland	UBERON:0001119	56.73	gold quality

Single-cell (SCXA)

Detected in 5 experiment(s), a significant marker in 4.

Experiment	Marker?	Max mean expression
E-GEOD-180759	yes	1517.76
E-HCAD-30	yes	1449.47
E-HCAD-25	yes	1417.30
E-HCAD-35	yes	104.19
E-ANND-3	no	1.56

Regulation

Is transcription factor: no

Functional genomics

ClinGen dosage: haploinsufficiency 0 (no evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 10)

• Increased expression of PSD-25 and its coassembly with NMDA-receptor subunits NR1 and MR2B in resected epileptic cortical tissue suggest a possible functional role of the complex in in situ epileptogenicity of focal cortical dysplasia. (PMID:15030493)
• DLGAP2 gene is imprinted, with preferential expression from the paternal allele in testis. (PMID:18055845)
• this study demonistrated that two SNPs in DLGAP2 (rs6558484 and rs7014992) and prefrontal cortex white matter volume. (PMID:23154099)
• DLGAP2 is a susceptible gene of schizophrenia. (PMID:24416398)
• The Gene-based analyses revealed four significant associations in the WT1, ZC3H12C, DLGAP2, and GPR1 genes at p < 0.05. in this study. (PMID:25391383)
• Results show that RP11-397D12.4, AC007403.1, and ERICH1-AS1 LncRNA expression are up-regulated in non-small-cell lung cancer (NSCLC) and may be potential biomarkers for predicting the tumorigenesis of NSCLC in the future. (PMID:26393913)
• This study showed increased DNA methylation levels of the DLGAP2 gene in both TD and NTD patients compared to control individuals. (PMID:30504779)
• Cannabis use is associated with potentially heritable widespread changes in autism candidate gene DLGAP2 DNA methylation in sperm. (PMID:31451081)
• Cross-Species Analyses Identify Dlgap2 as a Regulator of Age-Related Cognitive Decline and Alzheimer’s Dementia. (PMID:32877673)
• DNA Methylation Near DLGAP2 May Mediate the Relationship between Family History of Type 1 Diabetes and Type 1 Diabetes Risk. (PMID:38765731)

Cross-species orthologs

5 orthologs

Organism	Symbol	Gene ID
danio_rerio	dlgap2a	ENSDARG00000059340
danio_rerio	DLGAP2	ENSDARG00000076070
danio_rerio	dlgap2b	ENSDARG00000092376
mus_musculus	Dlgap2	ENSMUSG00000047495
rattus_norvegicus	Dlgap2	ENSRNOG00000012573

Paralogs (4): DLGAP4 (ENSG00000080845), DLGAP3 (ENSG00000116544), DLGAP5 (ENSG00000126787), DLGAP1 (ENSG00000170579)

Protein

Protein identifiers

Disks large-associated protein 2 — Q9P1A6 (reviewed: Q9P1A6)

Alternative names: PSD-95/SAP90-binding protein 2, SAP90/PSD-95-associated protein 2

All UniProt accessions (6): A0A0J9YWL8, A0A0J9YY16, A0A1B0GTN4, A0A1B0GXK6, Q9P1A6, H0YBY6

UniProt curated annotations — full annotation on UniProt →

Function. May play a role in the molecular organization of synapses and neuronal cell signaling. Could be an adapter protein linking ion channel to the subsynaptic cytoskeleton. May induce enrichment of PSD-95/SAP90 at the plasma membrane.

Subunit / interactions. Interacts with DLG1 and DLG4/PSD-95.

Subcellular location. Cell membrane. Postsynaptic density. Synapse.

Tissue specificity. Expressed in brain and kidney.

Similarity. Belongs to the SAPAP family.

Isoforms (3)

UniProt ID	Names	Canonical?
Q9P1A6-1	1	yes
Q9P1A6-2	2
Q9P1A6-3	3

RefSeq proteins (1): NP_001333739* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR005026	SAPAP	Family

Pfam: PF03359

UniProt features (32 total): modified residue 14, region of interest 6, compositionally biased region 6, splice variant 2, sequence variant 2, chain 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q9P1A6-F1	48.83	0.10

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (14): 298, 304, 386, 452, 662, 665, 668, 715, 738, 740, 771, 806, 978, 1007

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-6794361	Neurexins and neuroligins

MSigDB gene sets: 87 (showing top): AAGCCAT_MIR135A_MIR135B, ATGCAGT_MIR217, CTATGCA_MIR153, GOBP_CELL_CELL_SIGNALING, GOBP_NEURON_NEURON_SYNAPTIC_TRANSMISSION, GOBP_SYNAPTIC_SIGNALING, CCCAGAG_MIR326, MODULE_207, MODULE_95, ACEVEDO_METHYLATED_IN_LIVER_CANCER_DN, GOCC_POSTSYNAPSE, GOCC_SYNAPSE, GOCC_INTERMEDIATE_FILAMENT_CYTOSKELETON, BLALOCK_ALZHEIMERS_DISEASE_DN, GCACTTT_MIR175P_MIR20A_MIR106A_MIR106B_MIR20B_MIR519D

GO Biological Process (3): neuron-neuron synaptic transmission (GO:0007270), modulation of chemical synaptic transmission (GO:0050804), signaling (GO:0023052)

GO Molecular Function (2): molecular adaptor activity (GO:0060090), protein binding (GO:0005515)

GO Cellular Component (7): neurofilament (GO:0005883), plasma membrane (GO:0005886), postsynaptic density (GO:0014069), glutamatergic synapse (GO:0098978), postsynaptic specialization (GO:0099572), membrane (GO:0016020), synapse (GO:0045202)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Protein-protein interactions at synapses	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
chemical synaptic transmission	2
binding	2
regulation of trans-synaptic signaling	1
regulation of biological process	1
molecular_function	1
cytoplasm	1
intermediate filament	1
membrane	1
cell periphery	1
asymmetric synapse	1
postsynaptic specialization	1
synapse	1
organelle	1
postsynapse	1
cellular anatomical structure	1
cell junction	1

Protein interactions and networks

STRING

2126 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
DLGAP2	SHANK2	Q9UPX8	915
DLGAP2	SHANK3	Q9BYB0	846
DLGAP2	PTCHD1	Q96NR3	842
DLGAP2	SYNGAP1	Q96PV0	818
DLGAP2	DDX53	Q86TM3	694
DLGAP2	DLG4	P78352	662
DLGAP2	NLGN4X	Q8N0W4	661
DLGAP2	NLGN3	Q9NZ94	648
DLGAP2	ASTN2	O75129	648
DLGAP2	NLGN1	Q8N2Q7	601
DLGAP2	VLDLR	P98155	596
DLGAP2	KCNA4	P22459	588
DLGAP2	CNTN4	Q8IWV2	564
DLGAP2	CDH9	Q9ULB4	563
DLGAP2	NRXN1	Q9ULB1	531

IntAct

20 interactions, top by confidence:

A	B	Type	Score
DLGAP2	KRT40	psi-mi:“MI:0915”(physical association)	0.670
KRT40	DLGAP2	psi-mi:“MI:0915”(physical association)	0.670
DLGAP2	KRTAP4-2	psi-mi:“MI:0915”(physical association)	0.560
KRTAP4-2	DLGAP2	psi-mi:“MI:0915”(physical association)	0.560
DLGAP2	ABL1	psi-mi:“MI:0915”(physical association)	0.400
DLGAP2	CRK	psi-mi:“MI:0915”(physical association)	0.400
SRC	DLGAP2	psi-mi:“MI:0915”(physical association)	0.400
FYN	DLGAP2	psi-mi:“MI:0915”(physical association)	0.400
DLGAP2	GRB2	psi-mi:“MI:0915”(physical association)	0.400
DLGAP2	NCK1	psi-mi:“MI:0915”(physical association)	0.400
PIK3R1	DLGAP2	psi-mi:“MI:0915”(physical association)	0.400
DLGAP2	SHANK3	psi-mi:“MI:0915”(physical association)	0.370

BioGRID (25): KRTAP4-2 (Two-hybrid), KRT40 (Two-hybrid), KRT40 (Two-hybrid), DLGAP2 (Two-hybrid), DLGAP2 (Two-hybrid), DLGAP2 (Two-hybrid), DLGAP2 (Two-hybrid), DLGAP2 (Two-hybrid), DLGAP2 (Two-hybrid), DLGAP2 (Two-hybrid), DLG4 (Reconstituted Complex), DLGAP2 (Two-hybrid), DLGAP2 (Two-hybrid), DLGAP2 (Two-hybrid), DLG1 (Affinity Capture-MS)

ESM2 similar proteins: A0A1L8ER70, A1L253, A2AHC3, A5WUN7, B1AZP2, D4AEC2, O14490, P28290, P62024, P97836, P97839, Q148W8, Q14CH0, Q2KI52, Q2M3X8, Q3ZBW7, Q4KM62, Q4R2Y2, Q4R707, Q52KF3, Q5PQL8, Q5R3Z9, Q5RD34, Q5RJX2, Q5VUB5, Q5VZP5, Q5XII9, Q6GLU8, Q6NSV7, Q6P995, Q6PEI3, Q6RFY2, Q7T3E8, Q8BJ42, Q8BYK5, Q8C1B1, Q922B9, Q95X94, Q96BN6, Q96KR7

Diamond homologs: B1AZP2, O14490, O95886, P97836, P97837, P97838, P97839, Q15398, Q6PFD5, Q7K3L1, Q7ZYZ6, Q8BJ42, Q8K4R9, Q9D415, Q9P1A6, Q9Y2H0

SIGNOR signaling

4 interactions.

A	Effect	B	Mechanism
DLGAP2	“up-regulates activity”	DLG4	binding
DLGAP2	“up-regulates activity”	SHANK1	relocalization
DLGAP2	“up-regulates activity”	SHANK2	relocalization
DLGAP2	“up-regulates activity”	SHANK3	relocalization

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 10 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

GO biological processes:

GO term	Partners	Fold	FDR
ephrin receptor signaling pathway	5	172.0×	1e-08

Disease & clinical

Clinical variants and AI predictions

ClinVar

260 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	4
Likely pathogenic	1
Uncertain significance	205
Likely benign	27
Benign	11

Top pathogenic / likely-pathogenic (5)

Variant ID	HGVS	Classification
2685280	GRCh37/hg19 8p23.3-23.1(chr8:158049-8093066)x1	Pathogenic
563521	GRCh37/hg19 8p23.3(chr8:158048-1554662)x1	Pathogenic
57012	GRCh38/hg38 8p23.3(chr8:241530-764384)x1	Pathogenic
57311	GRCh38/hg38 8p23.3(chr8:241530-1371695)x1	Pathogenic
545353	NC_000008.11:g.(?1050516)(1327901_?)del	Likely pathogenic

SpliceAI

0 predictions. Top by Δscore:

AlphaMissense

0 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000001731 (8:1161546 C>G), RS1000003675 (8:910576 T>C), RS1000005061 (8:1620883 C>G), RS1000005934 (8:1648274 C>G), RS1000005990 (8:740480 C>G,T), RS1000007201 (8:1146555 GTGTGTGTGCACATGTGTGTGTATGCACA>G,GTGTGTGTGCACATGTGTGTGTATGCACATGTGTGTGCACATGTGTGTGTATGCACA), RS1000007513 (8:1522425 C>A,G), RS1000010423 (8:1686916 C>T), RS1000012305 (8:1024732 G>A), RS1000014835 (8:1380305 C>T), RS1000015633 (8:999129 A>G), RS1000015898 (8:1516371 G>A), RS1000015987 (8:1640699 T>C), RS1000018159 (8:1688229 C>T), RS1000021293 (8:970657 G>A)

Disease associations

OMIM: gene MIM:605438 | disease phenotypes: MIM:181500

GenCC curated gene-disease

ClinGen Gene-Disease Validity (1)

Expert-panel classifications — Definitive > Strong > Moderate > Limited > Disputed > Refuted.

Disease	Classification	Inheritance
complex neurodevelopmental disorder	Limited	AD

Mondo (1): schizophrenia (MONDO:0005090)

Orphanet (1): NON RARE IN EUROPE: Schizophrenia (Orphanet:3140)

HPO phenotypes

1 total (1 of 1 shown, HPO-id order):

HPO	Term
HP:0100753	Schizophrenia

GWAS associations

20 associations (top):

Study	Trait	p-value
GCST001973_8	Menarche (age at onset)	6.000000e-07
GCST002468_2	Triglycerides	7.000000e-09
GCST002777_5	Clozapine-induced cytotoxicity	6.000000e-06
GCST003264_93	Post bronchodilator FEV1/FVC ratio	2.000000e-06
GCST003264_936	Post bronchodilator FEV1/FVC ratio	5.000000e-06
GCST004748_129	Lung cancer	7.000000e-06
GCST004992_1	White matter microstructure in first episode schizophrenia (right posterior cingulate cortex)	6.000000e-07
GCST006105_3	Eye morphology	8.000000e-08
GCST006814_3	End-stage renal disease	1.000000e-06
GCST006943_44	Feeling miserable	2.000000e-08
GCST007160_18	Refractive astigmatism	4.000000e-06
GCST008103_140	Bipolar disorder	3.000000e-06
GCST008360_2	Response to cognitive-behavioural therapy in anxiety disorder	4.000000e-06
GCST008513_16	Health literacy	9.000000e-06
GCST008829_10	Neuritic plaque	9.000000e-06
GCST011176_12	Stroke	4.000000e-07
GCST011494_39	Daytime nap	3.000000e-13
GCST011624_9	Tau burden	7.000000e-07
GCST012490_269	Femur bone mineral density x serum urate levels interaction	2.000000e-09
GCST012490_32	Femur bone mineral density x serum urate levels interaction	2.000000e-12

EFO canonical traits (12, from GWAS)

EFO ID	Trait name
EFO:0004703	age at menarche
EFO:0004530	triglyceride measurement
EFO:0006952	cytotoxicity measurement
EFO:0004713	FEV/FVC ratio
EFO:0005674	white matter microstructure measurement
EFO:0009598	feeling miserable measurement
EFO:0007820	cognitive behavioural therapy
EFO:0010104	health literacy measurement
EFO:0006798	neuritic plaque measurement
EFO:0007828	daytime rest measurement
EFO:0004760	t-tau measurement
EFO:0004531	urate measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

25 total (human), top 25 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	affects methylation, increases expression	3
Benzo(a)pyrene	affects methylation, decreases expression	3
bisphenol A	affects methylation, affects cotreatment, decreases methylation	1
testosterone undecanoate	increases expression, affects cotreatment	1
trichostatin A	decreases expression	1
11-nor-delta(9)-tetrahydrocannabinol-9-carboxylic acid	affects methylation, increases abundance	1
benzo(e)pyrene	affects methylation	1
aflatoxin B2	affects methylation	1
CGP 52608	affects binding, increases reaction	1
bisphenol S	decreases methylation	1
Resveratrol	affects cotreatment, decreases expression	1
Fulvestrant	affects cotreatment, decreases methylation	1
Acetaminophen	decreases expression	1
Air Pollutants	affects methylation, increases abundance	1
Arsenic	affects methylation	1
Cannabinoids	affects methylation, increases abundance	1
Copper	affects cotreatment, decreases expression	1
Cotinine	affects methylation, increases abundance	1
Methapyrilene	affects methylation	1
N-Nitrosopyrrolidine	decreases expression	1
Tobacco Smoke Pollution	affects methylation, increases abundance	1
Aflatoxin B1	affects methylation	1
Levonorgestrel	affects cotreatment, increases expression	1
Sodium Selenite	decreases expression	1
Particulate Matter	affects methylation, increases abundance	1

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00000374	PHASE4	COMPLETED	Treatment for First-Episode Schizophrenia
NCT00001656	PHASE4	COMPLETED	Comparison of Clozapine vs Olanzapine in Childhood-Onset Psychotic Disorders
NCT00007774	PHASE4	COMPLETED	To Determine if Olanzapine is More Cost Effective Than Haloperidol for the Treatment of Schizophrenia
NCT00014001	PHASE4	COMPLETED	CATIE- Schizophrenia Trial
NCT00018668	PHASE4	COMPLETED	Antipsychotic Response in Schizophrenia
NCT00034801	PHASE4	COMPLETED	Olanzapine Versus Active Comparator in the Treatment of Depression in Patients With Schizophrenia
NCT00034905	PHASE4	COMPLETED	A Comparison of Seroquel vs. Risperidone in Schizophrenia
NCT00036088	PHASE4	COMPLETED	Olanzapine Versus An Active Comparator in the Treatment of Schizophrenia
NCT00044187	PHASE4	COMPLETED	The Assessment of a Weight-Gain Agent for the Treatment of Olanzapine-Associated Anti-Obesity Agent in Patients With Schizophrenia, Schizophreniform Disorder, Schizoaffective Disorder, and Bipolar I Disorder
NCT00044655	PHASE4	COMPLETED	Switching Medication to Treat Schizophrenia
NCT00048828	PHASE4	COMPLETED	Treating Drug-Resistant Childhood Schizophrenia
NCT00053703	PHASE4	COMPLETED	Treatment of Early Onset Schizophrenia Spectrum Disorders (TEOSS)
NCT00056498	PHASE4	COMPLETED	Risperidone Treatment in Schizophrenia Patients Who Are Currently Taking Clozapine
NCT00061802	PHASE4	COMPLETED	Efficacy and Safety of Two Atypical Antipsychotics vs. Placebo in Patients With an Acute Exacerbation of Either Schizophrenia or Schizoaffective Disorder
NCT00080327	PHASE4	COMPLETED	Study of Three Doses of Aripiprazole in Patients With Acute Schizophrenia
NCT00088049	PHASE4	COMPLETED	Study of Olanzapine vs. Aripiprazole in the Treatment of Schizophrenia
NCT00090012	PHASE4	COMPLETED	Comparison of Continuing Olanzapine to Switching to Quetiapine in Overweight or Obese Patients With Schizophrenia and Schizoaffective Disorder
NCT00100776	PHASE4	COMPLETED	Efficacy of High Dose Olanzapine for the Treatment of Schizophrenia and Schizoaffective Disorder
NCT00103571	PHASE4	COMPLETED	Olanzapine Versus Aripiprazole in the Treatment of Acutely Ill Patients With Schizophrenia
NCT00108368	PHASE4	COMPLETED	The Effects of Risperidone and Olanzapine on Thinking
NCT00114595	PHASE4	COMPLETED	Ethyl-Eicosapentaenoic Acid and Tardive Dyskinesia
NCT00130923	PHASE4	COMPLETED	Risperidone Long-acting Versus Oral Risperidone in Patients With Schizophrenia and Alcohol Use Disorder
NCT00137020	PHASE4	COMPLETED	Clinical Effect Of Cross Titration Of Antipsychotics With Ziprasidone In Schizophrenia Or Schizoaffective Disorder
NCT00140166	PHASE4	COMPLETED	Treatment of Acute Schizophrenia With Vitamin Therapy
NCT00145847	PHASE4	COMPLETED	Naltrexone Treatment of Alcohol Abuse in Schizophrenia
NCT00148564	PHASE4	COMPLETED	Energy Homeostasis Under Treatment With Atypical Antipsychotics
NCT00156715	PHASE4	COMPLETED	Efficacy of Quetiapine in the Treatment of Patients With Schizophrenia and a Comorbid Substance Use Disorder
NCT00158223	PHASE4	COMPLETED	Effectiveness of Pimozide in Augmenting the Effects of Clozapine in the Treatment of Schizophrenia
NCT00159081	PHASE4	COMPLETED	One Year Drug Treatment in First-Episode Schizophrenia
NCT00159120	PHASE4	COMPLETED	Maintenance Treatment vs. Stepwise Drug Discontinuation in First-Episode Schizophrenia
NCT00159133	PHASE4	COMPLETED	Prodrome-Based Early Intervention With Antipsychotics vs. Benzodiazepines in First-Episode Schizophrenia
NCT00159757	PHASE4	TERMINATED	12 Week Open, Non-Comparative Switch Study Of Oral Ziprazidone In Previously Treated Schizophrenic Patients
NCT00167817	PHASE4	COMPLETED	Effect of Switch to Aripiprazole on Health and Smoking Parameters in Patients With Schizophrenia: A Pilot Study
NCT00169026	PHASE4	TERMINATED	Alcoholism and Schizophrenia: Effects of Clozapine
NCT00169039	PHASE4	TERMINATED	Clozapine Versus Chlorpromazine for Treatment-Unresponsive Schizophrenia
NCT00169065	PHASE4	COMPLETED	Effectiveness of Clozapine Versus Olanzapine for Treatment-resistant Schizophrenia
NCT00169091	PHASE4	TERMINATED	Clozapine Versus Haloperidol for Treating the First Episode of Schizophrenia
NCT00176423	PHASE4	COMPLETED	Efficacy Study of Galantamine for Cognitive Impairments in Schizophrenia
NCT00176436	PHASE4	COMPLETED	Atomoxetine for Treatment of Weight Gain in Olanzapine or Clozapine Patients
NCT00177008	PHASE4	COMPLETED	Aripiprazole for the Treatment of Schizophrenia With Co-Morbid Social Anxiety