DLX6

Summary

DLX6 (distal-less homeobox 6, HGNC:2919) is a protein-coding gene on chromosome 7q21.3, encoding Homeobox protein DLX-6 (P56179).

This gene encodes a member of a homeobox transcription factor gene family similiar to the Drosophila distal-less gene. This family is comprised of at least 6 different members that encode proteins with roles in forebrain and craniofacial development. This gene is in a tail-to-tail configuration with another member of the family on the long arm of chromosome 7.

Source: NCBI Gene 1750 — RefSeq curated summary.

At a glance

• Gene–disease (curated): split hand-foot malformation (Supportive, GenCC) — +1 more curated relationship
• GWAS associations: 6
• Clinical variants (ClinVar): 112 total
• Phenotypes (HPO): 8
• Dosage sensitivity (ClinGen): haploinsufficiency no evidence, triplosensitivity no evidence
• MANE Select transcript: NM_005222

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:2919
Approved symbol	DLX6
Name	distal-less homeobox 6
Location	7q21.3
Locus type	gene with protein product
Status	Approved
Ensembl gene	ENSG00000006377
Ensembl biotype	protein_coding
OMIM	600030
Entrez	1750

Gene structure

Transcript identifiers

Ensembl transcripts: 3 — 2 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000493273, ENST00000518156, ENST00000555308

RefSeq mRNA: 1 — MANE Select: NM_005222 NM_005222

CCDS: CCDS47647

Canonical transcript exons

ENST00000518156 — 3 exons

Exon	Start	End
ENSE00001230080	97009796	97011040
ENSE00001613985	97005553	97006413
ENSE00003553134	97007638	97007831

Expression profiles

Bgee: expression breadth ubiquitous, 144 present calls, max score 93.70.

FANTOM5 (CAGE): breadth broad, TPM avg 4.3388 / max 491.0346, expressed in 430 samples.

FANTOM5 promoters (9 alternative TSS)

Promoter ID	TPM avg	Samples expressed
79783	1.1290	254
79785	1.0464	249
79782	0.6453	207
79784	0.5489	194
79788	0.3795	170
79790	0.2414	115
79786	0.1718	101
79789	0.0936	54
79787	0.0829	35

Top tissues by expression

258 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
buccal mucosa cell	CL:0002336	93.70	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	84.97	gold quality
endometrium	UBERON:0001295	81.10	gold quality
nucleus accumbens	UBERON:0001882	79.50	gold quality
caudate nucleus	UBERON:0001873	78.61	gold quality
putamen	UBERON:0001874	77.81	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	76.43	gold quality
oocyte	CL:0000023	73.52	gold quality
sperm	CL:0000019	72.10	gold quality
endothelial cell	CL:0000115	71.83	silver quality
male germ cell	CL:0000015	70.80	gold quality
placenta	UBERON:0001987	70.34	gold quality
left testis	UBERON:0004533	69.16	gold quality
right testis	UBERON:0004534	68.17	gold quality
testis	UBERON:0000473	68.14	gold quality
calcaneal tendon	UBERON:0003701	67.19	gold quality
lateral globus pallidus	UBERON:0002476	66.77	gold quality
secondary oocyte	CL:0000655	66.40	gold quality
prefrontal cortex	UBERON:0000451	65.71	gold quality
ganglionic eminence	UBERON:0004023	64.83	gold quality
tendon	UBERON:0000043	64.81	gold quality
anterior cingulate cortex	UBERON:0009835	64.43	gold quality
cingulate cortex	UBERON:0003027	64.39	gold quality
tibia	UBERON:0000979	63.56	gold quality
telencephalon	UBERON:0001893	62.10	gold quality
uterus	UBERON:0000995	62.09	gold quality
skin of leg	UBERON:0001511	61.58	gold quality
dorsolateral prefrontal cortex	UBERON:0009834	60.85	gold quality
lower lobe of lung	UBERON:0008949	60.67	silver quality
neocortex	UBERON:0001950	60.32	gold quality

Single-cell (SCXA)

Detected in 4 experiment(s), a significant marker in 3.

Experiment	Marker?	Max mean expression
E-HCAD-5	yes	16.69
E-GEOD-93593	yes	7.19
E-ANND-3	yes	4.75
E-CURD-112	no	216.46

Regulation

Is transcription factor: yes

Downstream targets (CollecTRI)

2 targets.

Target	Regulation
DLX5
RASSF1

JASPAR motifs

Motif	Name	Family
MA0882.1	DLX6	NK
MA0882.2	DLX6	NK

JASPAR matrix evidence (PMIDs): PMID:9889271

Upstream regulators (CollecTRI, top): DLX1, DLX2, DLX5, MEF2C, TP63

miRNA regulators (miRDB)

92 targeting DLX6, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-7110-3P	100.00	73.18	2486
HSA-MIR-4510	100.00	66.60	2050
HSA-MIR-6127	100.00	66.76	2188
HSA-MIR-6129	100.00	66.46	2080
HSA-MIR-6130	100.00	66.69	2012
HSA-MIR-6133	100.00	66.48	2064
HSA-MIR-6873-3P	100.00	71.42	2626
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-6833-3P	100.00	70.63	3197
HSA-MIR-150-5P	99.99	66.69	1976
HSA-MIR-3185	99.99	68.12	1959
HSA-LET-7F-2-3P	99.98	70.98	2588
HSA-MIR-1185-1-3P	99.98	71.04	2593
HSA-MIR-1185-2-3P	99.98	71.04	2593
HSA-MIR-4715-3P	99.98	66.03	670
HSA-MIR-103A-3P	99.98	69.14	1595
HSA-MIR-107	99.98	69.14	1595
HSA-MIR-520D-5P	99.98	73.34	4883
HSA-MIR-524-5P	99.98	73.43	4882
HSA-MIR-548AN	99.97	70.91	2817
HSA-LET-7C-3P	99.95	73.42	2862
HSA-MIR-651-3P	99.94	73.48	5177
HSA-MIR-145-5P	99.92	71.13	1836
HSA-MIR-5195-3P	99.92	70.92	1877
HSA-MIR-338-5P	99.92	72.34	2951
HSA-MIR-3119	99.92	71.34	2390
HSA-MIR-4753-3P	99.90	71.03	3786
HSA-MIR-130B-5P	99.83	68.50	1888

Functional genomics

ClinGen dosage: haploinsufficiency 0 (no evidence), triplosensitivity 0 (no evidence). ClinGen Gene Dosage Map

Literature-anchored findings (GeneRIF, showing 19)

• In mice, Dlx6 acts as an intermediary between endothelin-1 signaling and transcription of the basic helix-loop-helix transcription factor dHAND during craniofacial morphogenesis. (PMID:11711438)
• In mice, deletion of Dlx5 and Dlx6 results in skull repatterning, including a homeotic transformation of the lower jaw into an upper jaw, and supports a model of patterning within branchial arches that relies on a nested pattern of Dlx gene expression. (PMID:12193642)
• single nucleotide polymorphisms in intron 1 of the DLX6 gene and in exon 4 of the PCLO gene are not in linkage disequilibrium with autism. (PMID:12707945)
• DLX5 and DLX6 are not imprinted in humans and are not likely to be direct targets of MeCP2 modulation. (PMID:17701895)
• Results describe the expression of DLX5 and DLX6 in autistic spectrum disorder patients in an attempt to identify potential abnormality of expression. (PMID:19195802)
• p63 binds to an enhancer element in the SHFM1 locus and this element controls expression of DLX6 and DLX5 which are important for limb development. (PMID:20808887)
• MDA-MB-231 breast neoplasms did not express DLX6 but the resulting bone/lung metastases did. (PMID:21108812)
• Two patients that have in common a p63-Dlx5/Dlx6 pathway dysregulation. (PMID:22342398)
• The duplicated region harbors only DLX5 and DLX6, which are known for their role in SHFM1. (PMID:23169702)
• Genome sequencing of the deletion breakpoints showed that the DLX5 and DLX6 genes are disomic but the putative DYNC1I1 exon 15 and 17 enhancers are deleted. (PMID:24459211)
• Absent expression of the osteoblast-specific maternally imprinted genes, DLX5 and DLX6, causes split hand/split foot malformation type I. (PMID:25332435)
• The potential DLX6-AS1/miR-203a/MMP-2 pathway. (PMID:29145165)
• DLX6AS1 acting as a sponge for miR199a may serve a critical role in the development and progression of cervical cancer. (PMID:30535431)
• Knockdown of DLX6-AS1 inhibited cell proliferation, migration, invasion and promoted apoptosis by downregulating PRR11 expression and upregulating miR-144 in NSCLC. (PMID:30551440)
• The up-regulated lncRNA DLX6-AS1 in colorectal cancer promotes cell proliferation, invasion and migration via modulating PI3K/AKT/mTOR pathway. (PMID:31646562)
• DLX6 Antisense RNA 1 Modulates Glucose Metabolism and Cell Growth in Gastric Cancer by Targeting microRNA-4290. (PMID:32239379)
• Long non-coding RNA DLX6-AS1 mediates proliferation, invasion and apoptosis of endometrial cancer cells by recruiting p300/E2F1 in DLX6 promoter region. (PMID:32951317)
• DLX6 promotes cell proliferation and survival in oral squamous cell carcinoma. (PMID:33215805)
• Research progress of DLX6-AS1 in human cancers. (PMID:34508305)

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	dlx6a	ENSDARG00000042291
mus_musculus	Dlx6	ENSMUSG00000029754
rattus_norvegicus	Dlx6	ENSRNOG00000063630

Paralogs (9): DLX3 (ENSG00000064195), DLX5 (ENSG00000105880), DLX4 (ENSG00000108813), NANOG (ENSG00000111704), DLX2 (ENSG00000115844), DLX1 (ENSG00000144355), VENTX (ENSG00000151650), BSX (ENSG00000188909), NANOGP8 (ENSG00000255192)

Protein

Protein identifiers

Homeobox protein DLX-6 — P56179 (reviewed: P56179)

All UniProt accessions (2): P56179, G3V471

UniProt curated annotations — full annotation on UniProt →

Subcellular location. Nucleus.

Similarity. Belongs to the distal-less homeobox family.

Isoforms (3)

UniProt ID	Names	Canonical?
P56179-1	1	yes
P56179-2	2
P56179-3	3

RefSeq proteins (1): NP_005213* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR000047	HTH_motif	Conserved_site
IPR001356	HD	Domain
IPR009057	Homeodomain-like_sf	Homologous_superfamily
IPR017970	Homeobox_CS	Conserved_site
IPR020479	HD_metazoa	Domain
IPR050460	Distal-less_Homeobox_TF	Family

Pfam: PF00046

UniProt features (7 total): region of interest 2, splice variant 2, chain 1, DNA-binding region 1, compositionally biased region 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-P56179-F1	69.64	0.34

Function

Pathways and Gene Ontology

Reactome pathways

1 pathways

ID	Pathway
R-HSA-8939902	Regulation of RUNX2 expression and activity

MSigDB gene sets: 134 (showing top): GOBP_EMBRYO_DEVELOPMENT_ENDING_IN_BIRTH_OR_EGG_HATCHING, GOBP_EPITHELIUM_DEVELOPMENT, GOBP_SKELETAL_SYSTEM_DEVELOPMENT, GOBP_EMBRYONIC_SKELETAL_SYSTEM_DEVELOPMENT, GOBP_ANIMAL_ORGAN_MORPHOGENESIS, GOBP_EAR_DEVELOPMENT, GOBP_EMBRYONIC_ORGAN_MORPHOGENESIS, GOBP_APPENDAGE_DEVELOPMENT, GOBP_EAR_MORPHOGENESIS, GOBP_HEAD_DEVELOPMENT, GOBP_EMBRYO_DEVELOPMENT, KANG_IMMORTALIZED_BY_TERT_DN, GOBP_SENSORY_ORGAN_DEVELOPMENT, GOBP_SENSORY_ORGAN_MORPHOGENESIS, GOBP_EPITHELIAL_CELL_PROLIFERATION

GO Biological Process (13): skeletal system development (GO:0001501), regulation of transcription by RNA polymerase II (GO:0006357), nervous system development (GO:0007399), cell differentiation (GO:0030154), embryonic limb morphogenesis (GO:0030326), epithelial cell differentiation (GO:0030855), inner ear morphogenesis (GO:0042472), anatomical structure formation involved in morphogenesis (GO:0048646), embryonic skeletal system development (GO:0048706), positive regulation of epithelial cell proliferation (GO:0050679), roof of mouth development (GO:0060021), head development (GO:0060322), regulation of DNA-templated transcription (GO:0006355)

GO Molecular Function (5): RNA polymerase II cis-regulatory region sequence-specific DNA binding (GO:0000978), DNA-binding transcription factor activity, RNA polymerase II-specific (GO:0000981), DNA-binding transcription factor activity (GO:0003700), sequence-specific double-stranded DNA binding (GO:1990837), DNA binding (GO:0003677)

GO Cellular Component (2): chromatin (GO:0000785), nucleus (GO:0005634)

Reactome top-level categories

Rollup of top-1 pathways:

Category	Pathways
Transcriptional regulation by RUNX2	1

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
system development	2
regulation of DNA-templated transcription	2
anatomical structure development	2
RNA polymerase II transcription regulatory region sequence-specific DNA binding	2
transcription by RNA polymerase II	1
cellular developmental process	1
limb morphogenesis	1
embryonic appendage morphogenesis	1
cell differentiation	1
epithelium development	1
ear morphogenesis	1
embryonic morphogenesis	1
inner ear development	1
anatomical structure morphogenesis	1
developmental process	1
skeletal system development	1
chordate embryonic development	1
positive regulation of cell population proliferation	1
epithelial cell proliferation	1
regulation of epithelial cell proliferation	1
DNA-templated transcription	1
regulation of gene expression	1
regulation of RNA biosynthetic process	1
cis-regulatory region sequence-specific DNA binding	1
chromatin	1
DNA-binding transcription factor activity	1
regulation of transcription by RNA polymerase II	1
transcription cis-regulatory region binding	1
transcription regulator activity	1
double-stranded DNA binding	1
sequence-specific DNA binding	1
nucleic acid binding	1
chromosome	1
cellular anatomical structure	1
intracellular membrane-bounded organelle	1

Protein interactions and networks

STRING

972 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
DLX6	SEM1	Q6ZVN7	822
DLX6	MECP2	P51608	741
DLX6	TP63	Q9H3D4	723
DLX6	HAND2	P61296	672
DLX6	BMP7	P18075	655
DLX6	DYNC1I1	O14576	653
DLX6	PEG10	Q86TG7	633
DLX6	GAD1	Q99259	622
DLX6	FBXW4	P57775	552
DLX6	SLC32A1	Q9H598	519
DLX6	WNT10B	O00744	501
DLX6	PEG3	P78418	496
DLX6	LHX6	Q9UPM6	492
DLX6	WNT3A	P56704	487
DLX6	MEF2C	Q06413	484

IntAct

8 interactions, top by confidence:

A	B	Type	Score
DLX6	GIP	psi-mi:“MI:0915”(physical association)	0.400
DLX6	HSP90AB1	psi-mi:“MI:0915”(physical association)	0.400
CFTR	DLX6	psi-mi:“MI:0915”(physical association)	0.370
GRHL1	POLRMT	psi-mi:“MI:0914”(association)	0.350
DLX6	SCGB2A1	psi-mi:“MI:0914”(association)	0.350
SP7	IGF2BP3	psi-mi:“MI:2364”(proximity)	0.270

BioGRID (37): DLX6 (Affinity Capture-MS), DLX6 (Proximity Label-MS), RNASEH2C (Affinity Capture-MS), ATG7 (Affinity Capture-MS), TTC9C (Affinity Capture-MS), C9orf142 (Affinity Capture-MS), SEMG2 (Affinity Capture-MS), SEMG1 (Affinity Capture-MS), XRCC1 (Affinity Capture-MS), EEF1A2 (Affinity Capture-MS), SUPT16H (Affinity Capture-MS), PARP2 (Affinity Capture-MS), CSTF1 (Affinity Capture-MS), SCGB2A1 (Affinity Capture-MS), CHMP1A (Affinity Capture-MS)

ESM2 similar proteins: A8XJD0, E7FDX5, F1R2J1, G5EC89, G5ECT8, L8E946, O13023, O93590, O97670, P09071, P17488, P20269, P23410, P23459, P26797, P29506, P34326, P42587, P49925, P53544, P53547, P54821, P56179, P63013, P63014, P70397, Q01704, Q03357, Q05437, Q08821, Q09604, Q0P4H6, Q0P4W6, Q22909, Q22910, Q2PYN8, Q503F2, Q504H8, Q623D4, Q6R3Q6

Diamond homologs: A1YF16, A1YG93, A2RU54, A2T764, A6NCS4, A6NHT5, G5EE18, M0R6D8, O02786, O35767, O42230, O57601, O60479, O70218, P10181, P13297, P15857, P19601, P20009, P23410, P28360, P28361, P28362, P35548, P35993, P40764, P42580, P42581, P43687, P43688, P48031, P50219, P50223, P50574, P50575, P50576, P50577, P52953, P53547, P53770

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

112 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	72
Likely benign	28
Benign	11

Top pathogenic / likely-pathogenic (0)

SpliceAI

413 predictions. Top by Δscore:

Variant	Effect	Δscore
7:97007634:ACAG:A	acceptor_loss	1.0000
7:97007635:CA:C	acceptor_loss	1.0000
7:97007636:A:AG	acceptor_gain	1.0000
7:97007636:AG:A	acceptor_loss	1.0000
7:97007637:G:A	acceptor_loss	1.0000
7:97007637:G:GA	acceptor_gain	1.0000
7:97007637:GA:G	acceptor_gain	1.0000
7:97007637:GAT:G	acceptor_gain	1.0000
7:97007637:GATC:G	acceptor_gain	1.0000
7:97007637:GATCA:G	acceptor_gain	1.0000
7:97007829:CAGG:C	donor_loss	1.0000
7:97007830:AGG:A	donor_loss	1.0000
7:97006412:AGG:A	donor_loss	0.9900
7:97006413:GGTGA:G	donor_loss	0.9900
7:97006414:GTG:G	donor_loss	0.9900
7:97006415:T:G	donor_loss	0.9900
7:97007629:T:TA	acceptor_gain	0.9900
7:97009790:TTGCA:T	acceptor_loss	0.9900
7:97009793:CAGGT:C	acceptor_loss	0.9900
7:97009794:A:AG	acceptor_gain	0.9900
7:97009795:G:GA	acceptor_loss	0.9900
7:97009795:G:GG	acceptor_gain	0.9900
7:97007626:ATTT:A	acceptor_gain	0.9800
7:97007634:A:AG	acceptor_gain	0.9800
7:97007635:C:G	acceptor_gain	0.9800
7:97007627:T:G	acceptor_gain	0.9600
7:97009795:GGT:G	acceptor_gain	0.9600
7:97006414:G:GG	donor_gain	0.9500
7:97007626:A:AG	acceptor_gain	0.9500
7:97009791:T:TA	acceptor_gain	0.9400

AlphaMissense

1936 scored. Top likely-pathogenic:

dbSNP variants (sampled 300 via entrez): RS1000787946 (7:97008888 T>C), RS1000842059 (7:97009262 A>G,T), RS1000974937 (7:97004870 A>G,T), RS1001300592 (7:97005043 C>A,G,T), RS1001449923 (7:97003589 G>GA), RS1001603219 (7:97006241 CCACCACCACCAG>C,CCACCACCACCAGCACCACCACCAG), RS1002017487 (7:97010113 A>G,T), RS1002091017 (7:97009910 C>A), RS1002720136 (7:97009554 C>G), RS1003092257 (7:97008320 T>A), RS1003218155 (7:97005370 T>A), RS1003823701 (7:97010967 GAATTT>G), RS1003873160 (7:97005412 G>C,T), RS1004105737 (7:97006748 A>G), RS1004278 (7:97008733 G>A,C,T)

Disease associations

OMIM: gene MIM:600030 | disease phenotypes:

GenCC curated gene-disease

Disease	Classification	Inheritance
split hand-foot malformation	Supportive	Autosomal dominant
autism spectrum disorder	Limited	Autosomal dominant

Mondo (2): autism spectrum disorder (MONDO:0005258), split hand-foot malformation (MONDO:0016576)

Orphanet (0):

HPO phenotypes

8 total (8 of 8 shown, HPO-id order):

HPO	Term
HP:0000407	Sensorineural hearing impairment
HP:0000526	Aniridia
HP:0001171	Split hand
HP:0001839	Split foot
HP:0004050	Absent hand
HP:0004058	Hand monodactyly
HP:0006101	Finger syndactyly
HP:0012165	Oligodactyly

GWAS associations

6 associations (top):

Study	Trait	p-value
GCST006479_63	Diverticular disease	5.000000e-07
GCST007327_5	Smoking status (ever vs never smokers)	3.000000e-10
GCST007565_128	Morning person	1.000000e-13
GCST007565_156	Morning person	4.000000e-29
GCST007576_9	Chronotype	4.000000e-29
GCST007989_10	Facial morphology traits (63 three-dimensional facial segments)	1.000000e-22

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0009959	diverticular disease
EFO:0004318	smoking behavior
EFO:0008328	chronotype measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

CTD chemical–gene interactions

26 total (human), top 26 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
Valproic Acid	affects expression, decreases expression, increases expression	5
mercuric bromide	increases expression, affects cotreatment	2
p-Chloromercuribenzoic Acid	affects cotreatment, increases expression	2
FR900359	increases phosphorylation	1
methylmercuric chloride	increases expression	1
trichostatin A	decreases expression	1
sodium arsenite	increases expression	1
butyraldehyde	increases expression	1
pentanal	increases expression	1
entinostat	decreases expression	1
4-(5-benzo(1,3)dioxol-5-yl-4-pyridin-2-yl-1H-imidazol-2-yl)benzamide	affects cotreatment, increases expression	1
dorsomorphin	affects cotreatment, increases expression	1
Resveratrol	affects cotreatment, decreases expression	1
Leflunomide	decreases expression	1
Panobinostat	decreases expression	1
Acetaminophen	increases expression	1
Azacitidine	increases expression	1
Benzo(a)pyrene	increases methylation	1
Carbamazepine	affects expression	1
Enzyme Inhibitors	decreases activity, increases O-linked glycosylation	1
Nickel	decreases expression	1
Plant Extracts	affects cotreatment, decreases expression	1
Quercetin	decreases expression	1
Cyclosporine	decreases expression	1
Aflatoxin B1	decreases methylation	1
Copper Sulfate	decreases expression	1

Cellosaurus cell lines

3 cell lines: 3 embryonic stem cell

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_A0Z2	SEES3-1V human DLX6, clone1	Embryonic stem cell	Male
CVCL_A0Z3	SEES3-1V human DLX6, clone2	Embryonic stem cell	Male
CVCL_A0Z4	SEES3-1V human DLX6, clone3	Embryonic stem cell	Male

Clinical trials (associated diseases)

300 trials via MONDO — disease-level, not drug-specific.

Trial	Phase	Status	Title
NCT00391261	PHASE4	COMPLETED	An Open-label Trial of Metformin for Weight Control of Pediatric Patients on Antipsychotic Medications.
NCT01028820	PHASE4	COMPLETED	FMRI Brain Activation of Aripiprazole Treatment in Autism Spectrum Disorders
NCT01333865	PHASE4	COMPLETED	A Study of Memantine Hydrochloride (Namenda®) for Cognitive and Behavioral Impairment in Adults With Autism Spectrum Disorders
NCT01337700	PHASE4	COMPLETED	Milnacipran in Autism and the Functional Locus Coeruleus and Noradrenergic Model of Autism
NCT01695200	PHASE4	COMPLETED	Omega-3 Fatty Acids in Autism Spectrum Disorders
NCT02096952	PHASE4	COMPLETED	Methylphenidate ER Liquid Formulation in Adults With ASD and ADHD
NCT02235467	PHASE4	COMPLETED	Multisite Study: Parental Training Using Video Modelling to Develop Social Skills in Children With Autism
NCT02940574	PHASE4	COMPLETED	Neural and Behavioral Effects of Oxytocin in Autism Spectrum Disorders
NCT03333629	PHASE4	COMPLETED	Promoting Positive Outcomes for Individuals With ASD: Linking Early Detection, Treatment, and Long-term Outcomes
NCT03337646	PHASE4	COMPLETED	Evaluation of the Effect and Safety of Lisdexamfetamine in Children Aged 6-12 With ADHD and Autism
NCT03538431	PHASE4	COMPLETED	Improving Driving in Young People With Autism Spectrum Disorders
NCT03757585	PHASE4	COMPLETED	Natural Treatments for the Management of Emotional Dysregulation in Youth With Non-verbal Learning Disability (NVLD) and/or Autism Spectrum Disorders (ASD)
NCT04903353	PHASE4	COMPLETED	Pragmatic Trial Comparing Weight Gain in Children With Autism Taking Risperidone Versus Aripiprazole
NCT05063656	PHASE4	COMPLETED	Biomarker-Driven Pharmacological Treatment of Adolescents With Autism Spectrum Disorder With Gabapentin
NCT05146245	PHASE4	UNKNOWN	Safety and Pharmacokinetics of Antipsychotics in Children 2: Studying TDM in an RCT
NCT05916339	PHASE4	RECRUITING	AWARE: Management of ADHD in Autism Spectrum Disorder
NCT05954052	PHASE4	TERMINATED	A Study of Glutathione in Children With Autism Spectrum Disorder
NCT06853665	PHASE4	RECRUITING	The TEAM Study - Treatment Efficacy for Autism/Attention Using Mixed Amphetamine
NCT07054697	PHASE4	COMPLETED	Pilot-RCT With Individualized Homeopathic Treatment in the Children With Autism Spectrum Disorder
NCT07161804	PHASE4	COMPLETED	Pilot RCT Using Homeopathic Medicines in ASD
NCT07439042	PHASE4	NOT_YET_RECRUITING	Buspirone for Anxiety in Autistic Youth
NCT01302964	PHASE3	COMPLETED	Mirtazapine Treatment of Anxiety in Children and Adolescents With Pervasive Developmental Disorders
NCT01706523	PHASE3	TERMINATED	Open Label Extension Study of STX209 (Arbaclofen) in Autism Spectrum Disorders
NCT01825798	PHASE3	COMPLETED	Treatment of Overweight Induced by Antipsychotic Medication in Young People With Autism Spectrum Disorders (ASD)
NCT01972074	PHASE3	COMPLETED	Behavioral and Neural Response to Memantine in Adolescents With Autism Spectrum Disorder
NCT02985749	PHASE3	COMPLETED	A Study of Oxytocin for the Treatment of Social Impairment in Individuals With High Functioning Autism Spectrum Disorder
NCT03197922	PHASE3	COMPLETED	Treatment of Encopresis in Children With Autism Spectrum Disorders
NCT03504917	PHASE3	TERMINATED	A Study of Balovaptan in Adults With Autism Spectrum Disorder With a 2-Year Open-Label Extension
NCT03553875	PHASE3	TERMINATED	Memantine for the Treatment of Social Deficits in Youth With Disorders of Impaired Social Interactions
NCT03640156	PHASE3	COMPLETED	Modulating Socially Adaptive Mirror System Functioning in Autism by Oxytocin
NCT03715153	PHASE3	TERMINATED	Efficacy and Safety of Bumetanide Oral Liquid Formulation in Children Aged From 2 to Less Than 7 Years Old With Autism Spectrum Disorder.
NCT03715166	PHASE3	TERMINATED	Efficacy and Safety of Bumetanide Oral Liquid Formulation in Children and Adolescents Aged From 7 to Less Than 18 Years Old With Autism Spectrum Disorder
NCT04233502	PHASE3	WITHDRAWN	Efficacy and Safety of Slenyto for Insomnia in Children With ASD
NCT04578756	PHASE3	COMPLETED	Open-Label, Flexible-dose Study to Evaluate the Long-Term Safety and Tolerability of Cariprazine in the Treatment of Pediatric Participants With Schizophrenia, Bipolar I Disorder, or Autism Spectrum Disorder
NCT04623398	PHASE3	COMPLETED	Effect of Lithium in Patients With Autism Spectrum Disorder and Phelan-McDermid Syndrome (SHANK3 Haploinsufficiency)
NCT04725383	PHASE3	TERMINATED	Amitriptyline for Repetitive Behaviors in Autism Spectrum Disorders
NCT05212493	PHASE3	COMPLETED	The Effects of Medical Cannabis in Children With Autistic Spectrum Disorder
NCT05361707	PHASE3	UNKNOWN	Evaluating the Effects of Tasimelteon in Individuals With Autism Spectrum Disorder (ASD) and Sleep Disturbances
NCT05439616	PHASE3	COMPLETED	Study of Cariprazine Oral Capsules or Solution to Assess Adverse Events and Change in Irritability Due to Autism Spectrum Disorder (ASD) in Participants Aged 5-17 Years With ASD
NCT06229210	PHASE3	RECRUITING	Safety and Tolerability Trial of Lumateperone in Pediatric Patients With Schizophrenia, Bipolar Disorder or Autism Spectrum Disorder