DNAAF9

Summary

DNAAF9 (dynein axonemal assembly factor 9, HGNC:17721) is a protein-coding gene on chromosome 20p13, encoding Dynein axonemal assembly factor 9 (Q5TEA3). Dynein axonemal assembly factor that regulates the transport and activation of ciliary outer dynein arms (ODAs), which are the main force generators in cilia.

This gene encodes an uncharacterized protein with a C-terminal coiled-coil region. The gene is located on chromosome 20p13 in a 1.8 Mb region linked to a spinocerebellar ataxia phenotype, but this gene does not appear to be a disease candidate.

Source: NCBI Gene 25943 — RefSeq curated summary.

At a glance

• GWAS associations: 4
• Clinical variants (ClinVar): 45 total — 1 pathogenic
• MANE Select transcript: NM_001009984

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:17721
Approved symbol	DNAAF9
Name	dynein axonemal assembly factor 9
Location	20p13
Locus type	gene with protein product
Status	Approved
Aliases	DKFZp434N061
Ensembl gene	ENSG00000088854
Ensembl biotype	protein_coding
OMIM	614146
Entrez	25943

Gene structure

Transcript identifiers

Ensembl transcripts: 8 — 7 protein_coding, 1 protein_coding_CDS_not_defined

ENST00000252032, ENST00000619760, ENST00000851200, ENST00000851201, ENST00000851202, ENST00000953494, ENST00000953495, ENST00000953496

RefSeq mRNA: 1 — MANE Select: NM_001009984 NM_001009984

CCDS: CCDS42851

Canonical transcript exons

ENST00000252032 — 37 exons

Exon	Start	End
ENSE00000656736	3296861	3296949
ENSE00000656767	3359516	3359593
ENSE00000656768	3374048	3374154
ENSE00000656769	3375030	3375126
ENSE00000858757	3315735	3315785
ENSE00000858762	3324892	3324968
ENSE00000858771	3376178	3376302
ENSE00000858772	3381379	3381498
ENSE00000858773	3382427	3382506
ENSE00000906706	3407475	3407669
ENSE00000990617	3348525	3348623
ENSE00000990618	3343676	3343731
ENSE00001163074	3294139	3294256
ENSE00001163083	3294528	3294629
ENSE00001163097	3316723	3316793
ENSE00001163109	3322652	3322696
ENSE00001163114	3326197	3326284
ENSE00001190891	3330646	3330682
ENSE00001252015	3290129	3290217
ENSE00001252088	3318289	3318400
ENSE00001252094	3322217	3322262
ENSE00001350232	3340504	3340639
ENSE00001374832	3332280	3332361
ENSE00001719525	3249306	3252684
ENSE00003463291	3298029	3298175
ENSE00003480722	3287632	3287790
ENSE00003496338	3264438	3264524
ENSE00003506270	3259922	3260028
ENSE00003513653	3304440	3304543
ENSE00003526206	3253726	3253819
ENSE00003547623	3281641	3281766
ENSE00003593551	3270427	3270562
ENSE00003629388	3259480	3259554
ENSE00003645340	3278912	3278949
ENSE00003654348	3256006	3256211
ENSE00003659296	3315033	3315120
ENSE00003668520	3255219	3255284

Expression profiles

Bgee: expression breadth ubiquitous, 259 present calls, max score 96.35.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 15.0166 / max 189.3626, expressed in 1766 samples.

FANTOM5 promoters (5 alternative TSS)

Promoter ID	TPM avg	Samples expressed
186154	6.5744	1668
186155	4.7097	1512
186153	1.9764	1009
186156	1.6668	903
186152	0.0894	38

Top tissues by expression

259 total, by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
secondary oocyte	CL:0000655	96.35	gold quality
left ventricle myocardium	UBERON:0006566	94.37	gold quality
inferior vagus X ganglion	UBERON:0005363	94.36	gold quality
subthalamic nucleus	UBERON:0001906	94.29	gold quality
medulla oblongata	UBERON:0001896	94.15	gold quality
superior vestibular nucleus	UBERON:0007227	93.89	gold quality
middle temporal gyrus	UBERON:0002771	93.80	gold quality
deltoid	UBERON:0001476	93.64	gold quality
substantia nigra pars reticulata	UBERON:0001966	93.54	gold quality
kidney epithelium	UBERON:0004819	93.51	gold quality
substantia nigra pars compacta	UBERON:0001965	93.28	gold quality
dorsal plus ventral thalamus	UBERON:0001897	93.22	gold quality
cerebellar vermis	UBERON:0004720	93.19	gold quality
ventral tegmental area	UBERON:0002691	93.16	gold quality
lateral globus pallidus	UBERON:0002476	93.13	gold quality
entorhinal cortex	UBERON:0002728	93.01	gold quality
quadriceps femoris	UBERON:0001377	92.96	gold quality
tibialis anterior	UBERON:0001385	92.63	gold quality
vastus lateralis	UBERON:0001379	92.62	gold quality
globus pallidus	UBERON:0001875	92.46	gold quality
parietal lobe	UBERON:0001872	92.39	gold quality
pons	UBERON:0000988	92.38	gold quality
cardiac muscle of right atrium	UBERON:0003379	92.30	gold quality
postcentral gyrus	UBERON:0002581	92.27	gold quality
endothelial cell	CL:0000115	92.20	gold quality
medial globus pallidus	UBERON:0002477	92.18	gold quality
renal medulla	UBERON:0000362	92.03	gold quality
biceps brachii	UBERON:0001507	91.97	gold quality
oocyte	CL:0000023	91.82	gold quality
Brodmann (1909) area 46	UBERON:0006483	91.75	gold quality

Single-cell (SCXA)

Detected in 3 experiment(s), a significant marker in 2.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	9.51
E-GEOD-137537	yes	4.30
E-MTAB-8060	no	46.23

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

188 targeting DNAAF9, top 30 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific):

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-3163	100.00	77.23	8605
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-5692A	100.00	74.40	6850
HSA-MIR-5692B	100.00	71.32	2622
HSA-MIR-5692C	100.00	71.32	2622
HSA-MIR-1252-5P	100.00	69.80	2774
HSA-MIR-4673	100.00	66.64	1490
HSA-MIR-4692	100.00	67.32	2066
HSA-MIR-1277-5P	100.00	73.95	5056
HSA-MIR-4500	99.99	72.72	2367
HSA-MIR-548AW	99.99	72.57	3559
HSA-MIR-548C-3P	99.99	74.01	7587
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-1184	99.99	68.19	1458
HSA-MIR-27A-3P	99.98	72.13	2955
HSA-MIR-27B-3P	99.98	72.13	2955
HSA-MIR-9985	99.98	72.11	2939
HSA-MIR-25-3P	99.98	74.60	1817
HSA-MIR-363-3P	99.98	74.72	1821
HSA-MIR-367-3P	99.98	74.83	1819
HSA-MIR-32-5P	99.98	75.21	1964
HSA-MIR-92A-3P	99.98	75.21	1960
HSA-MIR-92B-3P	99.98	75.25	1955
HSA-LET-7G-5P	99.98	72.37	1784
HSA-LET-7I-5P	99.98	72.37	1788
HSA-LET-7A-5P	99.98	72.29	1790
HSA-LET-7B-5P	99.98	72.31	1790
HSA-LET-7C-5P	99.98	72.29	1790
HSA-LET-7E-5P	99.98	72.29	1790
HSA-LET-7F-5P	99.98	72.56	1784

Cross-species orthologs

3 orthologs

Organism	Symbol	Gene ID
danio_rerio	dnaaf9	ENSDARG00000079056
mus_musculus	Dnaaf9	ENSMUSG00000027309
rattus_norvegicus	Dnaaf9	ENSRNOG00000021237

Protein

Protein identifiers

Dynein axonemal assembly factor 9 — Q5TEA3 (reviewed: Q5TEA3)

Alternative names: Shulin

All UniProt accessions (1): Q5TEA3

UniProt curated annotations — full annotation on UniProt →

Function. Dynein axonemal assembly factor that regulates the transport and activation of ciliary outer dynein arms (ODAs), which are the main force generators in cilia. Essential for cilia movement and motility. Inhibits dyneins by reducing the affinity of ODAs for microtubules and hence inactivating the dyneins in the cytoplasm; the inhibition is relieved once dyneins enter the cilia. May act as an effector for ARL3.

Subunit / interactions. Interacts with ciliary outer dynein arms at least consisting of dynein axonemal heavy chains, light chains and intermediate chains; this interaction inactivates the dyneins. Interacts with ARL3.

Similarity. Belongs to the DNAAF9 family.

RefSeq proteins (1): NP_001009984* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR040342	DNAAF9	Family
IPR056414	DAAF9_CobW_C	Domain
IPR056498	DAAF9_N	Domain
IPR057478	DAAF9_2	Domain
IPR058843	PH_DAAF9	Domain
IPR058844	PB_DAAF9	Domain

Pfam: PF23281, PF23319, PF25203, PF25204, PF26246

UniProt features (8 total): sequence variant 4, chain 1, region of interest 1, compositionally biased region 1, sequence conflict 1

Structure

Experimental structures (PDB)

0 structures.

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-Q5TEA3-F1	84.25	0.46

Function

Pathways and Gene Ontology

Reactome pathways

0 pathways

MSigDB gene sets: 117 (showing top): BERTUCCI_MEDULLARY_VS_DUCTAL_BREAST_CANCER_DN, LINDGREN_BLADDER_CANCER_CLUSTER_3_DN, LIAO_METASTASIS, TURASHVILI_BREAST_DUCTAL_CARCINOMA_VS_DUCTAL_NORMAL_DN, DODD_NASOPHARYNGEAL_CARCINOMA_UP, PALOMERO_GSI_SENSITIVITY_DN, MILI_PSEUDOPODIA_CHEMOTAXIS_DN, LIU_PROSTATE_CANCER_DN, BRUINS_UVC_RESPONSE_LATE, GOBERT_OLIGODENDROCYTE_DIFFERENTIATION_DN, IKEDA_MIR30_TARGETS_DN, ZWANG_CLASS_1_TRANSIENTLY_INDUCED_BY_EGF, STK33_NOMO_UP, STK33_UP, NAB2_TARGET_GENES

GO Biological Process (0):

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (0):

GO top-level categories

Rollup of top GO terms by namespace:

Category	Terms
binding	1

Protein interactions and networks

STRING

366 interactions, top by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
DNAAF9	TBC1D19	Q8N5T2	616
DNAAF9	FEZ2	Q9UHY8	580
DNAAF9	TTBK2	Q6IQ55	537
DNAAF9	ITPA	Q9BY32	507
DNAAF9	SENP7	Q9BQF6	495
DNAAF9	CFAP36	Q96G28	480
DNAAF9	TTBK1	Q5TCY1	472
DNAAF9	RAB11FIP2	Q7L804	427
DNAAF9	MAP3K14	Q99558	400
DNAAF9	MNMIP1	A4FU49	399
DNAAF9	PXDC1	Q5TGL8	380
DNAAF9	DSEL	Q8IZU8	371
DNAAF9	ARL3	P36405	365
DNAAF9	IFNL3	Q8IZI9	358
DNAAF9	WWC3	Q9ULE0	348

IntAct

7 interactions, top by confidence:

A	B	Type	Score
ARL3	UNC119B	psi-mi:“MI:0914”(association)	0.730
DNAAF9	HSP90AB1	psi-mi:“MI:0915”(physical association)	0.400
ARL3		psi-mi:“MI:0914”(association)	0.350
HS1BP3	TAF5L	psi-mi:“MI:0914”(association)	0.350
TIAM1	DNAAF9	psi-mi:“MI:0915”(physical association)	0.000

BioGRID (10): C20orf194 (Affinity Capture-RNA), C20orf194 (Affinity Capture-MS), C20orf194 (Affinity Capture-MS), C20orf194 (Co-fractionation), C20orf194 (Co-fractionation), ARPIN (Co-fractionation), C20orf194 (Positive Genetic), C20orf194 (Two-hybrid), C20orf194 (Affinity Capture-RNA), C20orf194 (Affinity Capture-Luminescence)

ESM2 similar proteins: A0A1P8AUY4, A6ZZL8, B3LQZ6, B5VM60, C5E1C0, C7GVL2, C8ZC77, E7BQV0, F4HX15, F4I240, F4I9Q5, F4I9T0, F4IV45, F4JLK2, F4KGU4, O22243, O94248, O94536, P0C5E7, P0CE10, P34246, Q0JBY9, Q12019, Q1EHT7, Q3B8D5, Q4DCH3, Q57X81, Q5RDX4, Q5TEA3, Q6P158, Q7TT23, Q7XZU0, Q8CDM1, Q8LLD0, Q8STE5, Q8T5T1, Q8WT44, Q9C104, Q9FIN7, Q9FJ32

Diamond homologs: Q5TEA3, Q7TT23

SIGNOR signaling

0 interactions.

Disease & clinical

Clinical variants and AI predictions

ClinVar

45 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	1
Likely pathogenic	0
Uncertain significance	4
Likely benign	1
Benign	0

Top pathogenic / likely-pathogenic (1)

Variant ID	HGVS	Classification
3248273	NC_000020.10:g.(?3190198)(6760201_?)del	Pathogenic

SpliceAI

6140 predictions. Top by Δscore:

Variant	Effect	Δscore
20:3255217:A:AC	donor_gain	1.0000
20:3255218:C:CC	donor_gain	1.0000
20:3255282:CTT:C	acceptor_gain	1.0000
20:3255283:TT:T	acceptor_gain	1.0000
20:3255285:C:CC	acceptor_gain	1.0000
20:3255863:C:A	donor_gain	1.0000
20:3255938:AGGG:A	donor_gain	1.0000
20:3256013:G:C	donor_gain	1.0000
20:3256031:T:TA	donor_gain	1.0000
20:3256046:T:TA	donor_gain	1.0000
20:3256207:AGAGT:A	acceptor_gain	1.0000
20:3256208:GAGT:G	acceptor_gain	1.0000
20:3256209:AGT:A	acceptor_gain	1.0000
20:3256210:GT:G	acceptor_gain	1.0000
20:3256211:TC:T	acceptor_loss	1.0000
20:3256212:C:CA	acceptor_loss	1.0000
20:3256212:C:CC	acceptor_gain	1.0000
20:3259552:TTG:T	acceptor_gain	1.0000
20:3270421:GATTA:G	donor_loss	1.0000
20:3270422:ATTAC:A	donor_loss	1.0000
20:3270423:TTA:T	donor_loss	1.0000
20:3270424:TA:T	donor_loss	1.0000
20:3270425:ACCTG:A	donor_loss	1.0000
20:3270426:C:A	donor_loss	1.0000
20:3270560:GGC:G	acceptor_gain	1.0000
20:3270563:C:CC	acceptor_gain	1.0000
20:3278907:CTTA:C	donor_loss	1.0000
20:3278950:C:CC	acceptor_gain	1.0000
20:3281637:CTACC:C	donor_loss	1.0000
20:3281638:TACC:T	donor_loss	1.0000

AlphaMissense

7805 scored. Top likely-pathogenic:

Variant	Protein change	am_pathogenicity
20:3374066:A:C	F198L	1.000
20:3374066:A:T	F198L	1.000
20:3374068:A:G	F198L	1.000
20:3374116:A:G	W182R	1.000
20:3374116:A:T	W182R	1.000
20:3253730:G:C	H1139Q	0.999
20:3253730:G:T	H1139Q	0.999
20:3253732:G:C	H1139D	0.999
20:3253763:A:C	F1128L	0.999
20:3253763:A:T	F1128L	0.999
20:3253765:A:G	F1128L	0.999
20:3374064:A:G	F199S	0.999
20:3374102:C:A	Q186H	0.999
20:3374102:C:G	Q186H	0.999
20:3374114:C:A	W182C	0.999
20:3374114:C:G	W182C	0.999
20:3374120:C:A	E180D	0.999
20:3374120:C:G	E180D	0.999
20:3374121:T:A	E180V	0.999
20:3375094:T:A	K147N	0.999
20:3375094:T:G	K147N	0.999
20:3376216:A:G	W124R	0.999
20:3376216:A:T	W124R	0.999
20:3376266:A:G	L107P	0.999
20:3381462:A:G	L67P	0.999
20:3381488:G:C	S58R	0.999
20:3381488:G:T	S58R	0.999
20:3381490:T:G	S58R	0.999
20:3381492:T:A	D57V	0.999
20:3382427:C:G	G55R	0.999

dbSNP variants (sampled 300 via entrez): RS1000016298 (20:3302745 T>A,C), RS1000027502 (20:3327061 G>T), RS1000029864 (20:3295584 A>G), RS1000038235 (20:3399823 G>A,C), RS1000056561 (20:3263087 G>A), RS1000089971 (20:3336307 C>A,T), RS1000101483 (20:3295330 T>A), RS1000107110 (20:3254028 T>A), RS1000127962 (20:3262840 C>T), RS1000236070 (20:3373586 T>C), RS1000237063 (20:3350899 C>CA), RS1000237668 (20:3337958 GATATATATATATAATATATAAA>G), RS1000239085 (20:3286564 C>T), RS1000243980 (20:3332679 G>T), RS1000268730 (20:3373291 T>C)

Disease associations

OMIM: gene MIM:614146 | disease phenotypes: MIM:613850

GenCC curated gene-disease

Mondo (1): inosine triphosphatase deficiency (MONDO:0013461)

Orphanet (1): NON RARE IN EUROPE: Inosine triphosphate pyrophosphatase deficiency (Orphanet:319684)

HPO phenotypes

0 total (0 of 0 shown, HPO-id order):

GWAS associations

4 associations (top):

Study	Trait	p-value
GCST002875_53	Diisocyanate-induced asthma	1.000000e-06
GCST005212_27	Asthma	7.000000e-06
GCST90000025_627	Appendicular lean mass	1.000000e-15
GCST90002385_523	High light scatter reticulocyte count	1.000000e-09

EFO canonical traits (3, from GWAS)

EFO ID	Trait name
EFO:0006995	response to diisocyanate
EFO:0004980	appendicular lean mass
EFO:0007986	reticulocyte count

MeSH disease descriptors (1)

Descriptor	Name	Tree numbers
C564127	Inosine Triphosphatase Deficiency (supp.)

Drugs & pharmacology

Drug and pharmacology data

Is drug target: no

PharmGKB: 1 entry (VIP=true, CPIC=false)

PharmGKB variants

1 variants.

Variant	Genes	Level	Score	#Clin annots	Drugs
rs6051702	DNAAF9, ITPA	3	3.00	1	peginterferon alfa-2a;ribavirin

CTD chemical–gene interactions

24 total (human), top 24 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
sodium arsenite	decreases expression, increases expression	2
Air Pollutants	decreases expression, increases abundance	2
Benzo(a)pyrene	affects methylation, decreases expression	2
Cyclosporine	increases expression	2
triphenyl phosphate	affects expression	1
afimoxifene	decreases expression	1
benzo(e)pyrene	decreases methylation	1
nickel sulfate	decreases expression	1
exemestane	increases expression	1
K 7174	increases expression	1
Resveratrol	affects cotreatment, increases expression	1
Cadmium	decreases expression, increases abundance	1
Doxorubicin	decreases expression	1
Lead	affects splicing	1
Methapyrilene	decreases methylation	1
Plant Extracts	affects cotreatment, increases expression	1
Dihydrotestosterone	increases expression	1
Tetrachlorodibenzodioxin	increases expression	1
Tobacco Smoke Pollution	decreases expression	1
Valproic Acid	decreases methylation	1
Aflatoxin B1	decreases methylation	1
Antirheumatic Agents	increases expression	1
Cadmium Chloride	decreases expression, increases abundance	1
Particulate Matter	decreases expression, increases abundance	1

Cellosaurus cell lines

1 cell lines: 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_E1SW	HAP1 C20orf194 (-)	Cancer cell line	Male

Clinical trials (associated diseases)

0 trials via MONDO — disease-level, not drug-specific.