DNAJC13

Summary

DNAJC13 (DnaJ heat shock protein family (Hsp40) member C13, HGNC:30343) is a protein-coding gene on chromosome 3q22.1, encoding DnaJ homolog subfamily C member 13 (O75165). Involved in membrane trafficking through early endosomes, such as the early endosome to recycling endosome transport implicated in the recycling of transferrin and the early endosome to late endosome transport implicated in degradation of EGF and EGFR. It is a selective cancer dependency (DepMap: 13.0% of cell lines).

This gene encodes a member of the Dnaj protein family whose members act as co-chaperones of a partner heat-shock protein by binding to the latter and stimulating ATP hydrolysis. The encoded protein associates with the heat-shock protein Hsc70 and plays a role in clathrin-mediated endocytosis. It may also be involved in post-endocytic transport mechanisms via its associations with other proteins, including the sorting nexin SNX1. Mutations in this gene are associated with Parkinson’s disease.

Source: NCBI Gene 23317 — RefSeq curated summary.

At a glance

• Gene–disease (curated): hereditary late onset Parkinson disease (Supportive, GenCC)
• GWAS associations: 31 (top 4% of genes corpus-wide)
• Clinical variants (ClinVar): 496 total (top 7% of genes corpus-wide)
• Regional missense constraint (gnomAD): 1 of 3 regions constrained (≈1% of expected missense variation)
• GTEx eGene: eQTL in 36 tissues, sQTL in 0 (q < 0.05)
• Phenotypes (HPO): 34
• Cancer dependency (DepMap): dependent in 13.0% of screened cell lines
• Constraint (gnomAD): pLI 1.00 (loss-of-function intolerant), LOEUF 0.27 (highly constrained)
• MANE Select transcript: NM_015268
• Notable: 496 clinical variants but no curated precision-oncology (CIViC) evidence yet

Identifiers

Gene identifiers

Field	Value
HGNC ID	HGNC:30343
Approved symbol	DNAJC13
Name	DnaJ heat shock protein family (Hsp40) member C13
Location	3q22.1
Locus type	gene with protein product
Status	Approved
Aliases	RME8, KIAA0678
Ensembl gene	ENSG00000138246
Ensembl biotype	protein_coding
OMIM	614334
Entrez	23317

Gene structure

Transcript identifiers

Ensembl transcripts: 12 — 4 nonsense_mediated_decay, 3 protein_coding, 3 retained_intron, 2 protein_coding_CDS_not_defined

MANE Select: ENST00000260818

Transcript support level (Ensembl TSL; 1 = fully mRNA-supported): TSL 1: 2, TSL 2: 2, TSL 5: 4

ENST00000260818, ENST00000463038, ENST00000464766, ENST00000471925, ENST00000486798, ENST00000506813, ENST00000509279, ENST00000513822, ENST00000650455, ENST00001079863, ENST00001109461, ENST00001143923

RefSeq mRNA: 2 — MANE Select: NM_015268 NM_001329126, NM_015268

CCDS: CCDS33857

Canonical transcript exons

ENST00000260818 — 56 exons

Exon	Start	End
ENSE00000933898	132496528	132496663
ENSE00000933899	132499126	132499310
ENSE00000933900	132499734	132499808
ENSE00000933901	132500794	132500913
ENSE00000933902	132502289	132502468
ENSE00000933903	132503214	132503381
ENSE00000933904	132505302	132505415
ENSE00000933905	132507237	132507353
ENSE00000933908	132516422	132516496
ENSE00000933909	132516704	132516816
ENSE00000933910	132522828	132522997
ENSE00000933912	132523540	132523713
ENSE00000933913	132525610	132525789
ENSE00000933914	132526141	132526281
ENSE00000933915	132528189	132528332
ENSE00000933916	132530998	132531097
ENSE00001078094	132514571	132514670
ENSE00001078099	132538176	132539032
ENSE00001078100	132511067	132511244
ENSE00001078101	132490897	132491051
ENSE00001372117	132488976	132489021
ENSE00001376225	132473145	132473227
ENSE00001379471	132483375	132483577
ENSE00001388031	132488298	132488452
ENSE00001390898	132482226	132482330
ENSE00001391379	132467170	132467313
ENSE00001514394	132417502	132417760
ENSE00002325288	132494144	132494259
ENSE00002362931	132492414	132492615
ENSE00002378319	132495088	132495166
ENSE00003466493	132453599	132453694
ENSE00003472549	132465995	132466070
ENSE00003479535	132480369	132480470
ENSE00003481357	132484588	132484672
ENSE00003489655	132477981	132478140
ENSE00003498192	132462467	132462523
ENSE00003500582	132466299	132466394
ENSE00003507842	132447898	132447939
ENSE00003509717	132461050	132461205
ENSE00003512376	132460250	132460357
ENSE00003524228	132474932	132475085
ENSE00003527082	132463696	132463817
ENSE00003529575	132513008	132513099
ENSE00003540048	132453298	132453504
ENSE00003554680	132454066	132454157
ENSE00003555934	132457269	132457368
ENSE00003560350	132450647	132450847
ENSE00003576768	132479227	132479289
ENSE00003598644	132456501	132456580
ENSE00003600583	132456663	132456832
ENSE00003608910	132523157	132523199
ENSE00003613837	132434538	132434618
ENSE00003639439	132456235	132456401
ENSE00003652338	132447321	132447470
ENSE00003653196	132477789	132477892
ENSE00003664252	132446475	132446550

Expression profiles

Bgee: expression breadth ubiquitous, 297 present calls, max score 93.98.

FANTOM5 (CAGE): breadth ubiquitous, TPM avg 22.7933 / max 391.4940, expressed in 1789 samples.

Highest expression (Bgee): calcaneal tendon, buccal mucosa cell, saphenous vein, trabecular bone tissue, superficial temporal artery.

Genetic regulation across tissues (GTEx eQTL / sQTL)

DNAJC13 is an eGene in GTEx v10 — its expression is genetically regulated (eQTL) in 36 tissues and its splicing (sQTL) in 0 (q < 0.05). Strongest associations first; slope = normalized effect of the lead variant’s alternative allele.

showing 20 of 36 significant tissue × QTL associations:

Tissue	QTL	q-value	Slope	Lead variant
Skin Sun Exposed Lower leg	eqtl	4.5e-45	+0.82	3:132469319:A:G
Skin Not Sun Exposed Suprapubic	eqtl	2.5e-41	+0.89	3:132469319:A:G
Thyroid	eqtl	3.0e-33	+0.92	3:132469319:A:G
Adipose Subcutaneous	eqtl	4.5e-24	+0.56	3:132469319:A:G
Pancreas	eqtl	2.7e-20	+0.92	3:132469319:A:G
Breast Mammary Tissue	eqtl	1.5e-18	+0.47	3:132498859:G:A
Nerve Tibial	eqtl	4.2e-18	+0.67	3:132498859:G:A
Esophagus Mucosa	eqtl	1.1e-17	+0.42	3:132569653:C:A
Testis	eqtl	2.2e-15	-0.20	3:132515073:G:T
Lung	eqtl	4.8e-15	+0.52	3:132469319:A:G
Spleen	eqtl	1.7e-14	+1.04	3:132569653:C:A
Adipose Visceral Omentum	eqtl	3.7e-13	+0.45	3:132569653:C:A
Colon Transverse	eqtl	3.1e-12	+0.42	3:132462976:G:T
Cells Cultured fibroblasts	eqtl	2.1e-11	+0.35	3:132498859:G:A
Stomach	eqtl	1.2e-10	+0.46	3:132498859:G:A
Muscle Skeletal	eqtl	5.1e-10	+0.14	3:132417187:ACGCCGGAGGGGCGTGGTCATGGGCACC:A
Heart Atrial Appendage	eqtl	3.9e-09	+0.38	3:132469319:A:G
Esophagus Muscularis	eqtl	5.2e-09	-0.14	3:132550917:A:G
Small Intestine Terminal Ileum	eqtl	6.2e-08	+0.78	3:132498859:G:A
Adrenal Gland	eqtl	1.6e-07	+0.25	3:132417187:ACGCCGGAGGGGCGTGGTCATGGGCACC:A

FANTOM5 promoters

3 alternative TSS:

Promoter ID	TPM avg	Samples expressed
38627	20.1599	1786
38629	1.9301	400
38630	0.7033	132

Top tissues by expression

showing 100 of 299 tissues by Bgee expression score (0-100, higher = more expressed):

Tissue	Anatomy ID	Expression score	Quality
calcaneal tendon	UBERON:0003701	93.98	gold quality
buccal mucosa cell	CL:0002336	93.50	gold quality
saphenous vein	UBERON:0007318	93.19	gold quality
trabecular bone tissue	UBERON:0002483	93.12	gold quality
superficial temporal artery	UBERON:0001614	92.91	gold quality
parietal pleura	UBERON:0002400	92.62	gold quality
trigeminal ganglion	UBERON:0001675	92.50	gold quality
epithelium of nasopharynx	UBERON:0001951	92.48	gold quality
cauda epididymis	UBERON:0004360	92.29	gold quality
pleura	UBERON:0000977	92.17	gold quality
tibia	UBERON:0000979	92.11	gold quality
adrenal tissue	UBERON:0018303	92.06	gold quality
visceral pleura	UBERON:0002401	91.83	gold quality
stromal cell of endometrium	CL:0002255	91.78	gold quality
endometrium	UBERON:0001295	91.69	gold quality
colonic epithelium	UBERON:0000397	91.54	gold quality
germinal epithelium of ovary	UBERON:0001304	91.50	gold quality
bone marrow cell	CL:0002092	91.36	gold quality
jejunal mucosa	UBERON:0000399	91.26	gold quality
corpus epididymis	UBERON:0004359	91.22	gold quality
monocyte	CL:0000576	91.19	gold quality
jejunum	UBERON:0002115	91.19	gold quality
mononuclear cell	CL:0000842	91.16	gold quality
leukocyte	CL:0000738	90.97	gold quality
palpebral conjunctiva	UBERON:0001812	90.84	gold quality
seminal vesicle	UBERON:0000998	90.70	gold quality
myometrium	UBERON:0001296	90.67	gold quality
dorsal root ganglion	UBERON:0000044	90.64	gold quality
urethra	UBERON:0000057	90.63	gold quality
pericardium	UBERON:0002407	90.61	gold quality
uterus	UBERON:0000995	90.52	gold quality
blood vessel layer	UBERON:0004797	90.52	gold quality
oviduct epithelium	UBERON:0004804	90.51	gold quality
bone marrow	UBERON:0002371	90.50	gold quality
skeletal muscle tissue of rectus abdominis	UBERON:0004511	90.38	gold quality
decidua	UBERON:0002450	90.32	gold quality
synovial joint	UBERON:0002217	90.21	gold quality
amniotic fluid	UBERON:0000173	90.15	gold quality
corpus callosum	UBERON:0002336	89.93	gold quality
secondary oocyte	CL:0000655	89.89	gold quality
caput epididymis	UBERON:0004358	89.89	gold quality
oral cavity	UBERON:0000167	89.80	gold quality
eye	UBERON:0000970	89.79	gold quality
tendon	UBERON:0000043	89.78	gold quality
urinary bladder	UBERON:0001255	89.49	gold quality
primordial germ cell in gonad	CL:0000670 ∩ UBERON:0000991	89.38	gold quality
cardia of stomach	UBERON:0001162	89.38	gold quality
nephron tubule	UBERON:0001231	89.37	gold quality
female reproductive system	UBERON:0000474	89.12	gold quality
aorta	UBERON:0000947	89.04	gold quality
popliteal artery	UBERON:0002250	89.04	gold quality
tibial artery	UBERON:0007610	89.04	gold quality
ascending aorta	UBERON:0001496	88.99	gold quality
thoracic aorta	UBERON:0001515	88.99	gold quality
mucosa of paranasal sinus	UBERON:0005030	88.99	gold quality
artery	UBERON:0001637	88.95	gold quality
descending thoracic aorta	UBERON:0002345	88.95	gold quality
right coronary artery	UBERON:0001625	88.87	gold quality
renal glomerulus	UBERON:0000074	88.86	gold quality
body of uterus	UBERON:0009853	88.66	gold quality
middle temporal gyrus	UBERON:0002771	88.62	gold quality
Brodmann (1909) area 23	UBERON:0013554	88.60	gold quality
uterine cervix	UBERON:0000002	88.57	gold quality
metanephric glomerulus	UBERON:0004736	88.53	gold quality
muscle layer of sigmoid colon	UBERON:0035805	88.51	gold quality
mammary duct	UBERON:0001765	88.37	gold quality
skin of hip	UBERON:0001554	88.35	gold quality
smooth muscle tissue	UBERON:0001135	88.29	gold quality
superior surface of tongue	UBERON:0007371	88.28	gold quality
metanephros	UBERON:0000081	88.27	gold quality
male germ line stem cell (sensu Vertebrata) in testis	CL:0000089 ∩ UBERON:0000473	88.26	gold quality
large intestine	UBERON:0000059	88.25	gold quality
kidney epithelium	UBERON:0004819	88.25	gold quality
vagina	UBERON:0000996	88.19	gold quality
colon	UBERON:0001155	88.16	gold quality
sigmoid colon	UBERON:0001159	88.11	gold quality
rectum	UBERON:0001052	88.10	gold quality
coronary artery	UBERON:0001621	88.10	gold quality
left ventricle myocardium	UBERON:0006566	88.10	gold quality
placenta	UBERON:0001987	88.08	gold quality
penis	UBERON:0000989	88.05	gold quality
tibial nerve	UBERON:0001323	88.05	gold quality
left coronary artery	UBERON:0001626	88.05	gold quality
fallopian tube	UBERON:0003889	88.05	gold quality
subcutaneous adipose tissue	UBERON:0002190	88.02	gold quality
renal medulla	UBERON:0000362	88.01	gold quality
transverse colon	UBERON:0001157	88.00	gold quality
thoracic mammary gland	UBERON:0005200	87.97	gold quality
cortical plate	UBERON:0005343	87.97	gold quality
lower esophagus muscularis layer	UBERON:0035833	87.97	gold quality
epithelium of mammary gland	UBERON:0003244	87.96	gold quality
lower esophagus	UBERON:0013473	87.96	gold quality
mammary gland	UBERON:0001911	87.95	gold quality
cortex of kidney	UBERON:0001225	87.94	gold quality
hair follicle	UBERON:0002073	87.82	gold quality
connective tissue	UBERON:0002384	87.80	gold quality
intestine	UBERON:0000160	87.74	gold quality
adipose tissue	UBERON:0001013	87.69	gold quality
oocyte	CL:0000023	87.66	gold quality
endocervix	UBERON:0000458	87.66	gold quality

Single-cell (SCXA)

Detected in 1 experiment(s), a significant marker in 1.

Experiment	Marker?	Max mean expression
E-ANND-3	yes	5.53

HPA expression

RNA tissue specificity: Low tissue specificity

showing 60 of 80 HPA tissues / cells by nTPM:

Tissue / cell	Axis	nTPM	Protein (IHC)
Caudate putamen	tissue	25.7
Frontal cortex	tissue	24.3
Midbrain	tissue	21.7
Pons	tissue	20.9
Corpus callosum	tissue	20.3
Choroid plexus	tissue	20.1
Spinal cord	tissue	20.1
Substantia nigra	tissue	19.9
Thalamus	tissue	19.8
Superior colliculi	tissue	19.7
Medulla oblongata	tissue	19.1
Locus coeruleus	tissue	17.9
Cerebellum	tissue	17.7	high
Cerebral cortex	tissue	17.2	medium
Hypothalamus	tissue	17.2
Somatosensory cortex	tissue	17.2
Putamen	tissue	17.1
Hippocampal formation	tissue	16.8
Septum	tissue	16.6
Entorhinal cortex	tissue	16.4
Periaqueductal gray	tissue	16.4
Olfactory bulb	tissue	16.4
Occipital cortex	tissue	16.4
Motor cortex	tissue	16.2
Retrosplenial and cingulate cortex	tissue	16.2
Temporal cortex	tissue	16.1
Amygdala	tissue	15.8
Retrosplenial cortex	tissue	15.8
Smooth muscle	tissue	15.6	low
Ventral forebrain	tissue	15.5
Prefrontal cortex	tissue	15.4
Insular cortex	tissue	15.4
Kidney	tissue	14.9	high
Thyroid gland	tissue	14.7	medium
Bone marrow	tissue	14.7	high
Placenta	tissue	14.5	medium
Hippocampus	tissue	14.4	medium
Nucleus accumbens	tissue	14.3
Postcentral gyrus	tissue	14.0
Basal ganglia	tissue	13.6	medium
Rectum	tissue	13.4	high
Tongue	tissue	13.3
Colon	tissue	12.6	high
Endometrium 1	tissue	12.3	medium
Cervix	tissue	12.1	medium
Heart muscle	tissue	12.1	high
Parathyroid gland	tissue	11.8	medium
Appendix	tissue	11.7	high
Spleen	tissue	11.5	medium
Seminal vesicle	tissue	11.4	high
Urinary bladder	tissue	11.2	medium
Thymus	tissue	11.2
Epididymis	tissue	11.0	high
Ovary	tissue	10.9	high
Breast	tissue	10.7	medium
Skeletal muscle	tissue	10.6	high
Lung	tissue	10.6	medium
Adipose tissue	tissue	10.5	medium
Lymph node	tissue	10.3	high
Duodenum	tissue	10.2	high

Brain sub-regions (HPA Brain Atlas): detected in 192; highest nTPM — White matter (20.3), Dorsal spinal cord (20.1), Ventral spinal cord (20.0), Nucleus raphe pallidus (19.4), Anterior thalamic nucleus, ventral (19.1).

Regulation

Is transcription factor: no

miRNA regulators (miRDB)

Targeting DNAJC13 by miRDB confidence (max_score; target_count = how many genes the miRNA targets in total — lower means more specific).

showing 30 of 93 miRNAs:

miRNA	Max score	Avg score	miRNA target_count
HSA-MIR-4262	100.00	73.26	3931
HSA-MIR-3613-3P	100.00	76.36	7965
HSA-MIR-190A-3P	100.00	80.35	5520
HSA-MIR-30A-5P	100.00	76.31	3233
HSA-MIR-30B-5P	100.00	76.29	3248
HSA-MIR-30C-5P	100.00	76.29	3248
HSA-MIR-30D-5P	100.00	76.32	3233
HSA-MIR-30E-5P	100.00	76.32	3242
HSA-MIR-513A-5P	100.00	69.77	2465
HSA-MIR-5011-5P	100.00	83.46	5820
HSA-MIR-3924	100.00	72.09	2394
HSA-MIR-4476	100.00	68.18	2030
HSA-MIR-6876-5P	100.00	67.68	2126
HSA-MIR-181A-5P	99.99	72.96	2995
HSA-MIR-181B-5P	99.99	72.97	2996
HSA-MIR-181C-5P	99.99	72.95	2996
HSA-MIR-181D-5P	99.99	73.04	2997
HSA-MIR-4282	99.99	75.36	6408
HSA-MIR-4789-3P	99.99	70.75	2484
HSA-MIR-27A-3P	99.98	72.13	2955
HSA-MIR-27B-3P	99.98	72.13	2955
HSA-MIR-9985	99.98	72.11	2939
HSA-MIR-507	99.97	70.11	1915
HSA-MIR-548AN	99.97	70.91	2817
HSA-MIR-493-5P	99.96	72.47	2382
HSA-MIR-3605-5P	99.96	67.12	932
HSA-MIR-557	99.96	70.01	1640
HSA-MIR-128-3P	99.95	71.17	2484
HSA-MIR-216A-3P	99.95	71.19	2505
HSA-MIR-141-3P	99.94	72.79	2421

Functional genomics

gnomAD constraint: pLI 1, LOEUF 0.267, missense Z 3.39 — population loss-of-function intolerance (pLI ≥ 0.9 = LoF-intolerant; lower LOEUF = more constrained). gnomAD

Regional missense constraint (gnomAD)

ENST00000260818 splits into 3 regions with different missense tolerance; 1 is missense-constrained (≈1% of the expected missense variation). Missense variants in a constrained region (low observed/expected) are more likely to be pathogenic. gnomAD

Region (GRCh38)	Missense obs / exp	o/e	Constrained
3:132,434,551–132,475,075	762 / 964.1	0.79	no
3:132,475,076–132,477,823	4 / 16.7	0.24	yes (p 1.9e-03)
3:132,477,824–132,538,279	1494 / 1693.7	0.88	no
DepMap (CRISPR cell-line fitness): dependent in 13.0% of screened cell lines.

Most-dependent cell lines (DepMap gene-effect, lower = stronger; ≤ −0.5 shown): Hs 936.T (-1.946), IGR-1 (-1.783), MM473 (-1.73), ONE58 (-1.635), COLO 792 (-1.478), C-4 I (-1.464), NCI-H661 (-1.435), Hep G2 (-1.382), UM-HACC-2A (-1.349), HuH-6 (-1.313), NCI-H2052 (-1.303), HKA-1 (-1.271), WM88 (-1.236), UPCI-SCC-074 (-1.2), LNZ308 (-1.194).

Literature-anchored findings (GeneRIF, showing 18)

• RME-8 functions in intracellular trafficking and provides the first evidence of a functional role for a DnaJ domain-bearing co-chaperone on endosomes (PMID:16179350)
• hRME is primarily involved in membrane trafficking through early endosomes, but not through degradative organelles, such as multivesicular bodies and late endosomes. (PMID:18256511)
• These data implicate RME-8 in sorting decisions influencing EGFR at the level of endosomes and point to RME-8 as a potential regulatory target in ErbB2-positive breast cancers. (PMID:18307993)
• Found DNAJC13 A2057S variant is probably a rare cause of Tourette syndrome/chronic tic phenotype in Chinese Han patients. (PMID:22507240)
• Missense mutations in DNAJC13 does not play a major role in PD in the Chinese population. (PMID:24126164)
• a pathogenic mutation in DNAJC13, a component of the endosomal recycling system, helps to emphasize the role of endosomal recycling rather than endolysosomal protein degradation in the biology of late-onset Parkinson disease. (PMID:24218364)
• Data propose that the interaction between RME-8 and the WASH complex provides a means to coordinate the activity of the WASH complex with the membrane-tubulating function of the sorting. (PMID:24643499)
• DNAJC13 c.2564A>G (p.(N855S)) was identified in two patients with essential tremor. (PMID:25118025)
• PD associated with a DNAJC13 p.N855S parkinsonism mutation presents as late-onset, often slowly progressive, usually dopamine-responsive typical Parkinsonism. (PMID:25186792)
• Although the contribution of rare genetic variation in DNAJC13 to parkinsonisms remains to be further elucidated, this study suggests that, in addition to p.N855S, other rare variants might affect disease susceptibility (PMID:25393719)
• Re-expression of miR-193b in breast cancer cell lines decreased DNAJC13 (HPS40) and RAB22A expression, providing a mechanism by which mir193-b acts as a tumor suppressor. (PMID:25550792)
• These results further highlight the critical role for phosphatidylinositol 3-phosphate in the RME-8-mediated organizational control of various endosomal activities, including retrograde transport. (PMID:26134565)
• Mutations in exon 24 of DNAJC13 are not a common cause of Parkinson or Lewy body disease among Caucasian populations. (PMID:26278106)
• There is a possibility that specific DNAJC13 variants may play a minor role in PD susceptibility. (PMID:27236598)
• Parkinson’s disease-linked DNAJC13 mutation perturbs multi-directional endosomal trafficking, resulting in the aberrant endosomal retention of alpha-synuclein, which might predispose to the neurodegenerative process that leads to Parkinson’s disease. (PMID:29309590)
• This study showed the DNAJC13 mutation screening in patients with Parkinson’s disease. (PMID:29887357)
• Receptor-mediated endocytosis 8 (RME-8)/DNAJC13 is a novel positive modulator of autophagy and stabilizes cellular protein homeostasis. (PMID:32322926)
• Association study of DNAJC13, UCHL1, HTRA2, GIGYF2, and EIF4G1 with Parkinson’s disease. (PMID:33239198)

Cross-species orthologs

4 orthologs

Organism	Symbol	Gene ID
mus_musculus	Dnajc13	ENSMUSG00000032560
rattus_norvegicus	Dnajc13	ENSRNOG00000011491
drosophila_melanogaster	Rme-8	FBGN0015477
caenorhabditis_elegans	rme-8	WBGENE00004378

Paralogs (20): DNAJC11 (ENSG00000007923), DNAJC25 (ENSG00000059769), DNAJC10 (ENSG00000077232), DNAJC5 (ENSG00000101152), DNAJC3 (ENSG00000102580), DNAJC17 (ENSG00000104129), DNAJC2 (ENSG00000105821), DNAJC12 (ENSG00000108176), DNAJC4 (ENSG00000110011), DNAJC16 (ENSG00000116138), DNAJC14 (ENSG00000135392), DNAJC1 (ENSG00000136770), DNAJC5B (ENSG00000147570), DNAJC5G (ENSG00000163793), DNAJC7 (ENSG00000168259), DNAJC21 (ENSG00000168724), DNAJC18 (ENSG00000170464), DNAJC24 (ENSG00000170946), DNAJC30 (ENSG00000176410), DNAJC9 (ENSG00000213551)

Mouse-model phenotypes

Observed phenotypes of the mouse ortholog (MGI:2676368) from MGI (Alliance of Genome Resources) — knockout/mutant phenotypes, ranked by annotation count. 7 distinct phenotype terms.

Mouse phenotype (MP)	Records
abnormal digit morphology	1
decreased mean corpuscular volume	1
decreased heart rate	1
increased circulating bilirubin level	1
decreased mean corpuscular hemoglobin	1
embryonic lethality between implantation and somite formation, complete penetrance	1
preweaning lethality, complete penetrance	1

Genomic neighbors (locus context)

Genes flanking this one on the chromosome (NCBI/Entrez gene neighborhood). Positional context only — some neighbors share regulatory elements (bidirectional promoters, antisense/overlapping transcripts), but chromosomal adjacency is not itself a functional relationship (see Interactions for that).

Symbol	Type	Entrez
ACP3	protein-coding	55
TMEM108-AS1	ncRNA	101927455
NPHP3	protein-coding	27031
NPHP3-AS1	ncRNA	348808
ACKR4	protein-coding	51554
TMEM108	protein-coding	66000
UBA5	protein-coding	79876
ACAD11	protein-coding	84129
NPHP3-ACAD11	ncRNA	100532724

Protein

Protein identifiers

DnaJ homolog subfamily C member 13 — O75165 (reviewed: O75165)

Alternative names: Required for receptor-mediated endocytosis 8

All UniProt accessions (4): A0A3B3IRM0, H0Y8Q2, H0YA63, O75165

UniProt curated annotations — full annotation on UniProt →

Function. Involved in membrane trafficking through early endosomes, such as the early endosome to recycling endosome transport implicated in the recycling of transferrin and the early endosome to late endosome transport implicated in degradation of EGF and EGFR. Involved in the regulation of endosomal membrane tubulation and regulates the dynamics of SNX1 on the endosomal membrane; via association with WASHC2 may link the WASH complex to the retromer SNX-BAR subcomplex.

Subunit / interactions. Interacts with WASHC2C; mediates the association with the WASH complex.

Subcellular location. Early endosome. Early endosome membrane. Endosome membrane.

Disease relevance. Parkinson disease (PARK) [MIM:168600] A complex neurodegenerative disorder characterized by bradykinesia, resting tremor, muscular rigidity and postural instability. Additional features are characteristic postural abnormalities, dysautonomia, dystonic cramps, and dementia. The pathology of Parkinson disease involves the loss of dopaminergic neurons in the substantia nigra and the presence of Lewy bodies (intraneuronal accumulations of aggregated proteins), in surviving neurons in various areas of the brain. The disease is progressive and usually manifests after the age of 50 years, although early-onset cases (before 50 years) are known. The majority of the cases are sporadic suggesting a multifactorial etiology based on environmental and genetic factors. However, some patients present with a positive family history for the disease. Familial forms of the disease usually begin at earlier ages and are associated with atypical clinical features. The gene represented in this entry may be involved in disease pathogenesis. Genetic variants in DNAJC13 and TMEM230 have been found in the same large multigenerational family with adult-onset Parkinson disease. The pathological role of each gene and therefore the exact molecular basis of the disease is unclear.

RefSeq proteins (2): NP_001316055, NP_056083* (*=MANE)

Domains & families (InterPro)

ID	Name	Type
IPR001623	DnaJ_domain	Domain
IPR011989	ARM-like	Homologous_superfamily
IPR016024	ARM-type_fold	Homologous_superfamily
IPR025640	GYF_2	Domain
IPR035445	GYF-like_dom_sf	Homologous_superfamily
IPR036869	J_dom_sf	Homologous_superfamily
IPR044978	GRV2/DNAJC13	Family
IPR045802	GRV2/DNAJC13_N	Domain

Pfam: PF00226, PF14237, PF19432

UniProt features (34 total): sequence variant 21, sequence conflict 9, chain 1, domain 1, region of interest 1, modified residue 1

Structure

Predicted structure (AlphaFold)

Model	pLDDT	Fraction very-high
AF-O75165-F1	82.91	0.35

Human Protein Atlas

Protein class: Predicted membrane proteins, Disease related genes, Human disease related genes

Protein evidence: Evidence at protein level

Subcellular location (HPA, imaging): vesicles; cytosol

Antibody reliability (HPA): IH approved · IF supported

Functional residue map

Curated UniProt residues grouped by drug-discovery relevance — catalytic, ligand-binding, modification, and mutation-validated positions. Source: UniProtKB sequence features.

Post-translational modifications (1)

Type	Positions
N6-acetyllysine	84

Function

Pathways and Gene Ontology

Reactome pathways

1 curated (TAS) of 3; 0 disease pathways. Curated-first; evidence = TAS (manually curated) vs IEA (electronic inference).

3 pathways:

ID	Pathway	Evidence
R-HSA-6798695	Neutrophil degranulation	curated
R-HSA-168256	Immune System	—
R-HSA-168249	Innate Immune System	—

MSigDB gene sets: 265 (showing top): RODRIGUES_THYROID_CARCINOMA_ANAPLASTIC_UP, REACTOME_INNATE_IMMUNE_SYSTEM, GOBP_ENDOSOME_ORGANIZATION, GOCC_VACUOLAR_MEMBRANE, PAL_PRMT5_TARGETS_UP, GOCC_SECRETORY_GRANULE, GOBP_VESICLE_ORGANIZATION, GRAESSMANN_APOPTOSIS_BY_DOXORUBICIN_DN, GOBP_OSTEOBLAST_DIFFERENTIATION, GOBP_VESICLE_MEDIATED_TRANSPORT, GOBP_REGULATION_OF_VESICLE_MEDIATED_TRANSPORT, ONKEN_UVEAL_MELANOMA_UP, GOBP_REGULATION_OF_CELLULAR_LOCALIZATION, GOBP_REGULATION_OF_EARLY_ENDOSOME_TO_LATE_ENDOSOME_TRANSPORT, MODULE_206

GO Biological Process (5): osteoblast differentiation (GO:0001649), receptor-mediated endocytosis (GO:0006898), endosome organization (GO:0007032), protein transport (GO:0015031), regulation of early endosome to late endosome transport (GO:2000641)

GO Molecular Function (1): protein binding (GO:0005515)

GO Cellular Component (10): lysosomal membrane (GO:0005765), plasma membrane (GO:0005886), endosome membrane (GO:0010008), membrane (GO:0016020), secretory granule membrane (GO:0030667), early endosome membrane (GO:0031901), azurophil granule membrane (GO:0035577), extracellular exosome (GO:0070062), early endosome (GO:0005769), WASH complex (GO:0071203)

Reactome top-level categories

2 top-level categories:

Category	Pathways
Innate Immune System	1
Immune System	1

GO top-level categories

30 GO namespaces:

Category	Terms
endosome	2
cytoplasmic vesicle membrane	2
bounding membrane of organelle	2
ossification	1
cell differentiation	1
endocytosis	1
vesicle-mediated transport	1
endomembrane system organization	1
vesicle organization	1
transport	1
intracellular protein localization	1
establishment of protein localization	1
regulation of intracellular transport	1
early endosome to late endosome transport	1
regulation of vesicle-mediated transport	1
binding	1
lysosome	1
lytic vacuole membrane	1
membrane	1
cell periphery	1
cellular anatomical structure	1
secretory granule	1
early endosome	1
endosome membrane	1
lysosomal membrane	1
secretory granule membrane	1
azurophil granule	1
extracellular vesicle	1
cytoplasm	1
protein-containing complex	1

Experimentally-supported GO annotations

GO terms backed by direct experimental evidence (ECO experimental codes) — 8 of 17 annotations. The rest are phylogenetic / computational / electronic (IEA).

8 experimentally-supported GO terms:

GO term	NS	Evidence
endosome organization	BP	mutant phenotype
osteoblast differentiation	BP	high-throughput assay
regulation of early endosome to late endosome transport	BP	mutant phenotype
early endosome membrane	CC	direct assay
endosome membrane	CC	direct assay
extracellular exosome	CC	high-throughput assay
lysosomal membrane	CC	high-throughput assay
membrane	CC	high-throughput assay

Protein interactions and networks

STRING

showing 15 of 1,226 interactions by confidence (×1000):

Protein A	Protein B	Partner UniProt	Score
DNAJC13	VPS35	Q96QK1	832
DNAJC13	DNAJC6	O75061	815
DNAJC13	TMEM230	Q96A57	752
DNAJC13	SYNJ1	O43426	729
DNAJC13	ATP13A2	Q9NQ11	706
DNAJC13	VPS13C	Q709C8	697
DNAJC13	PLA2G6	O60733	695
DNAJC13	CHCHD2	Q9Y6H1	695
DNAJC13	EIF4G1	Q04637	691
DNAJC13	PINK1	Q9BXM7	683
DNAJC13	PRKN	O60260	675
DNAJC13	GBA1	P04062	673
DNAJC13	DNAJB2	P25686	666
DNAJC13	RIC3	Q7Z5B4	665
DNAJC13	FBXO7	Q9Y3I1	665

IntAct

Human interaction partners of DNAJC13 in IntAct, one row per partner (best MIscore; records = supporting IntAct interaction records).

showing 30 of 31 partners by confidence:

Partner	Interaction type	MIscore	Records
TMEM9B	association	0.640	1
SCAMP1	physical association	0.620	2
OCLN	association	0.530	3
BAG4	association	0.530	2
HSPA9	association	0.530	2
STUB1	association	0.530	2
HSPA2	association	0.530	1
CCT3	physical association	0.400	1
H2BC21	physical association	0.400	1
DNAJB11	physical association	0.370	1
GADD45A	physical association	0.370	1
GSK3B	physical association	0.370	1
RPS6KA6	physical association	0.370	1
MUSK	association	0.350	2
PRKAR1B	association	0.350	2
ARL8A	association	0.350	1
BAG5	association	0.350	1
CCT5	association	0.350	1
DHX40	association	0.350	1
LRRC73	association	0.350	1
PHF1	association	0.350	1
TBC1D4	association	0.350	1
VPS35	association	0.350	1
EGFR	colocalization	0.270	2
PTPRR	proximity	0.270	1
EDRF1	physical association	0.000	1
FYB2	physical association	0.000	1
IRF2BP1	physical association	0.000	1
MLF1	physical association	0.000	1
NMT1	physical association	0.000	1

BioGRID (210 interactions; top human partners by supporting records): HSPA8 (Co-fractionation; 6 records), BAG5 (Affinity Capture-MS; 3 records), BSCL2 (Affinity Capture-MS; 3 records), FCN1 (Affinity Capture-MS; 3 records), BAG2 (Affinity Capture-MS; 2 records), BAG4 (Affinity Capture-MS; 2 records), CUL3 (Affinity Capture-MS; 2 records), FGFR1 (Affinity Capture-MS; 2 records), HSPA1A (Proximity Label-MS; 2 records), HSPA9 (Affinity Capture-MS; 2 records), HSPBP1 (Affinity Capture-MS; 2 records), JPH4 (Affinity Capture-MS; 2 records), KLHL2 (Affinity Capture-MS; 2 records), LGALS3BP (Affinity Capture-MS; 2 records), LIPG (Affinity Capture-MS; 2 records)

Enriched among interaction partners

Reactome pathways and GO biological processes over-represented among this gene’s 31 IntAct physical interaction partners (hypergeometric vs the genome-wide background, BH-FDR, gene-set size 15–500, ranked by fold). A functional readout of the neighbourhood — distinct from this gene’s own memberships above, and biased toward well-studied / hub proteins, so read it as themes rather than proof.

Reactome pathways:

Pathway	Partners	Fold	FDR
Regulation of HSF1-mediated heat shock response	5	30.3×	1e-04

GO biological processes:

GO term	Partners	Fold	FDR
protein folding	6	20.7×	1e-04
protein stabilization	5	11.2×	9e-03

Disease & clinical

Genetic variants

Variant evidence for DNAJC13: 496 ClinVar records (0 pathogenic / likely pathogenic); 31 GWAS associations.

ClinVar

496 variants total. Per-class counts are floors (≥ shown; pagination cap):

Classification	Count (floor)
Pathogenic	0
Likely pathogenic	0
Uncertain significance	237
Likely benign	59
Benign	122

SpliceAI

Top 10 splice-impact sites by Δscore (adjacent positions with the same effect merged into one range; 34 predictions of 4,369):

Position(s)	Effect	Δscore	Sites
3:132447319	acceptor_gain	1.0000
3:132447471–132447472	donor_loss	1.0000	5
3:132450645–132450646	acceptor_loss	1.0000	4
3:132453594	acceptor_gain	1.0000
3:132453695–132453696	donor_loss	1.0000	5
3:132454064–132454065	acceptor_loss	1.0000	5
3:132454158–132454159	donor_loss	1.0000	5
3:132456586	donor_gain	1.0000
3:132456661–132456662	acceptor_loss	1.0000	6
3:132456833	donor_loss	1.0000

AlphaMissense

6,100 missense substitutions predicted likely pathogenic (of 14,827 scored), across 1,490 residues. Top 20 hotspot residues, ranked by the number of likely-pathogenic substitutions (of those reachable by a single-nucleotide change), then by mean score:

Residue	Likely-pathogenic substitutions	Mean am_pathogenicity	Max am_pathogenicity
M1207	9	0.973	0.995
M600	9	0.868	0.994
M869	9	0.834	0.969
D1334	8	0.997	0.999
H1332	8	0.995	1.000
F1343	8	0.991	1.000
D1555	8	0.991	0.997
F396	8	0.990	0.999
D911	8	0.990	0.998
D893	8	0.988	0.997
H1218	8	0.987	0.997
N1436	8	0.986	0.999
F552	8	0.985	1.000
F891	8	0.985	0.998
N47	8	0.984	0.999
H859	8	0.984	0.999
N497	8	0.983	0.999
F85	8	0.982	1.000
F853	8	0.981	0.999
D320	8	0.980	0.994

HPA cancer prognostics

RNA cancer specificity: Low cancer specificity

Human Protein Atlas survival analysis — favorable = higher expression predicts better survival.

3 prognostic cancer types:

Cancer	Prognostic	p-value
Kidney Renal Clear Cell Carcinoma (TCGA)	favorable	2.55e-05
Kidney Chromophobe (TCGA)	unfavorable	0.000344
Pancreatic Adenocarcinoma (validation)	unfavorable	0.000635

Disease associations

OMIM: gene MIM:614334 | disease phenotypes:

GenCC curated gene-disease

1 curated gene-disease records:

Disease	Classification	Inheritance	Records
hereditary late onset Parkinson disease	Supportive	Autosomal dominant

Genomics England panels (PanelApp)

Clinical diagnostic gene panels including this gene (2 panels, 0 green/diagnostic-grade). Confidence: green = diagnostic, amber = moderate.

2 panels:

Panel	Rating
Adult-onset neurological disorders	amber
Neurodegenerative disorders, adult onset	amber

Mondo (1): (MONDO:0018466)

HPO phenotypes

34 phenotypes (HPO-id order):

HPO	Term
HP:0000338	Hypomimic face
HP:0000651	Diplopia
HP:0000713	Agitation
HP:0000716	Depression
HP:0000726	Dementia
HP:0000741	Apathy
HP:0000744	Low frustration tolerance
HP:0001268	Mental deterioration
HP:0001300	Parkinsonism
HP:0001332	Dystonia
HP:0001824	Weight loss
HP:0002015	Dysphagia
HP:0002063	Rigidity
HP:0002067	Bradykinesia
HP:0002120	Cerebral cortical atrophy
HP:0002171	Gliosis
HP:0002172	Postural instability
HP:0002304	Akinesia
HP:0002322	Resting tremor
HP:0002359	Frequent falls
HP:0002360	Sleep disturbance
HP:0002362	Shuffling gait
HP:0002367	Visual hallucination
HP:0002548	Parkinsonism with favorable response to dopaminergic medication
HP:0003394	Muscle spasm
HP:0004409	Hyposmia
HP:0004926	Orthostatic hypotension due to autonomic dysfunction
HP:0005340	Spastic/hyperactive bladder
HP:0012450	Chronic constipation
HP:0031435	Monotonic speech
HP:0100315	Lewy bodies
HP:0100660	Dyskinesia
HP:0100710	Impulsivity
HP:0100753	Schizophrenia

GWAS associations

showing 30 of 31 associations:

Study	Trait	p-value
GCST90002404_477	Red cell distribution width	1e-33
GCST90002390_599	Mean corpuscular hemoglobin	2e-33
GCST90002392_332	Mean corpuscular volume	2e-27
GCST90013406_24	Liver enzyme levels (alkaline phosphatase)	9e-23
GCST010204_182	Low density lipoprotein cholesterol levels	8e-20
GCST90000025_575	Appendicular lean mass	8e-20
GCST010243_139	Apolipoprotein B levels	9e-19
GCST010245_186	LDL cholesterol levels	1e-18
GCST90002391_36	Mean corpuscular hemoglobin concentration	4e-14
GCST90011899_31	Aspartate aminotransferase levels	3e-13
GCST010702_110	Subcortical volume (MOSTest)	6e-12
GCST90002384_455	Hemoglobin	2e-11
GCST90002398_151	Neutrophil count	6e-11
GCST004621_188	Red cell distribution width	1e-10
GCST010083_109	Hemoglobin levels	1e-10
GCST006612_96	LDL cholesterol	2e-10
GCST006614_103	Total cholesterol levels	2e-10
GCST90002407_52	White blood cell count	2e-10
GCST006804_126	Red cell distribution width	3e-10
GCST010703_105	Brain morphology (MOSTest)	9e-10
GCST005951_87	Body mass index	1e-9
GCST008972_126	Urate levels	1e-9
GCST008971_15	Urate levels	2e-9
GCST005195_118	Coronary artery disease	3e-9
GCST010002_440	Refractive error	5e-9
GCST010701_111	Cortical surface area (MOSTest)	5e-9
GCST90002383_322	Hematocrit	5e-9
GCST005196_238	Coronary artery disease	2e-8
GCST010699_59	Brain morphology (min-P)	5e-8
GCST004571_1	Iron status biomarkers (total iron binding capacity)	8e-7

EFO canonical traits (from GWAS)

16 canonical traits:

EFO ID	Trait name
EFO:0006334	total iron binding capacity
EFO:0009188	Red cell distribution width
EFO:0004340	body mass index
EFO:0004611	low density lipoprotein cholesterol measurement
EFO:0004574	total cholesterol measurement
EFO:0004531	urate measurement
EFO:0004509	hemoglobin measurement
EFO:0004615	apolipoprotein B measurement
EFO:0004346	neuroimaging measurement
EFO:0004980	appendicular lean mass
EFO:0004348	hematocrit
EFO:0004527	mean corpuscular hemoglobin
EFO:0004528	mean corpuscular hemoglobin concentration
EFO:0004833	neutrophil count
EFO:0004736	aspartate aminotransferase measurement
EFO:0004533	alkaline phosphatase measurement

Drugs & pharmacology

Drug and pharmacology data

Is drug target: yes

ChEMBL targets (1): CHEMBL6067017 (SINGLE PROTEIN)

PharmGKB: 1 entry (CPIC guideline: no)

CTD chemical–gene interactions

39 total (human), top 30 by PubMed support.

Chemical	Actions (top 5)	PubMed papers
bisphenol A	decreases expression, increases expression	2
Cadmium Chloride	decreases reaction, increases abundance, increases palmitoylation, decreases expression	2
bisphenol F	increases expression	1
geldanamycin	increases expression	1
triphenyl phosphate	affects expression	1
alpha-pinene	affects cotreatment, increases oxidation, increases abundance	1
salinomycin	decreases expression	1
decabromobiphenyl ether	decreases expression	1
arsenite	affects binding, decreases reaction	1
sodium arsenite	decreases expression, increases abundance	1
tetrabromobisphenol A	decreases expression	1
2-bromopalmitate	decreases reaction, increases abundance, increases palmitoylation	1
potassium chromate(VI)	affects cotreatment, decreases expression	1
methacrylaldehyde	increases abundance, affects cotreatment, increases oxidation	1
epigallocatechin gallate	affects cotreatment, decreases expression	1
perfluorooctane sulfonic acid	decreases expression	1
CGP 52608	affects binding, increases reaction	1
torcetrapib	increases expression	1
abrine	decreases expression	1
2,2’,4,4’-tetrabromodiphenyl ether	decreases expression	1
pentabrominated diphenyl ether 100	decreases expression	1
hexabrominated diphenyl ether 153	decreases expression	1
bisphenol AF	increases expression	1
Temozolomide	decreases expression	1
Sunitinib	increases expression	1
Acetaminophen	decreases expression	1
Acrolein	affects cotreatment, increases oxidation, increases abundance	1
Air Pollutants	affects cotreatment, increases abundance, increases oxidation	1
Arsenic	decreases expression, increases abundance	1
Cadmium	decreases reaction, increases abundance, increases palmitoylation	1

ChEMBL screening assays

1 unique, capped per target: 1 binding

Representative assays (with source publication via chembl_document):

Assay ID	Type	Description	Source paper
CHEMBL5652895	Binding	Binding affinity to human DNAJC13 incubated for 45 mins by Kinobead based pull down assay	NVP-BHG712: Effects of Regioisomers on the Affinity and Selectivity toward the EPHrin Family. — *ChemMedChem*

Cellosaurus cell lines

1 cell lines: 1 cancer cell line

First 10 cell lines (id-ordered, not curated):

Cellosaurus	Name	Category	Sex
CVCL_B1Q9	Abcam HeLa DNAJC13 KO	Cancer cell line	Female

Clinical trials (associated diseases)

Via MONDO — disease-level, not drug-specific.

showing 60 of 300 trials:

NCT	Phase	Status	Title
NCT00165763	Phase 4	COMPLETED	Efficacy and Safety of Donepezil Hydrochloride (Aricept) in Vascular Dementia
NCT00847860	Phase 4	COMPLETED	Cilostazol Verse Asprin for Vascular Dementia in Poststroke Patients With White Matter Lesions
NCT00947531	Phase 4	COMPLETED	A Clinical Trial to Evaluate the Safety and Efficacy of 20 ml Cerebrolysin in Patients With Vascular Dementia
NCT00950430	Phase 4	ENROLLING_BY_INVITATION	Imaging of Brain Amyloid Plaques in the Aging Population
NCT00455143	Phase 4	TERMINATED	Cognitive Protection - Dexmedetomidine and Cognitive Reserve
NCT00561678	Phase 4	COMPLETED	Perioperative Cognitive Function - Dexmedetomidine and Cognitive Reserve
NCT01807481	Phase 4	UNKNOWN	Phase IV Study to Evaluate the Efficacy and Safety of Mircera in PD
NCT00439699	Phase 4	COMPLETED	A Pilot Clinical Trial Of Memantine for Essential Tremor
NCT00584376	Phase 4	COMPLETED	Pregabalin (Lyrica) for the Treatment of Essential Tremor
NCT00998660	Phase 4	COMPLETED	RECHARGE Sub-Study to the Implantable Systems Performance Registry (ISPR)
NCT02111369	Phase 4	COMPLETED	Propranolol and Botulinum Toxin for Essential Vocal Tremor
NCT02495883	Phase 4	COMPLETED	Functional Imaging of Tremor Circuits and Mechanisms of Treatment Response
NCT00099216	Phase 3	COMPLETED	Efficacy and Safety of Rivastigmine Capsules in Patients With Probable Vascular Dementia
NCT00130338	Phase 3	COMPLETED	Rivastigmine Capsules in Patients With Probable Vascular Dementia
NCT00209456	Phase 3	COMPLETED	Dopamine Transporter Scintigraphy Imaging (DAT-Imaging) in Patients With Lewy Body Dementia
NCT00249158	Phase 3	COMPLETED	A Study of the Effectiveness and Safety of Risperidone in the Treatment of Behavioral Disturbances in Patients With Dementia
NCT00261573	Phase 3	COMPLETED	A Study of the Safety and Effectiveness of Galantamine Versus Placebo in the Treatment of Patients With Vascular Dementia or Mixed Dementia
NCT00621647	Phase 3	COMPLETED	Seroquel- Agitation Associated With Dementia
NCT02453932	Phase 3	COMPLETED	Efficacy and Safety of Tianzhi Granule in Mild to Moderate Vascular Dementia
NCT03682185	Phase 3	COMPLETED	The Healthy Patterns Sleep Study
NCT03789760	Phase 3	COMPLETED	The Clinical Trial of Chinese Herbal Medicine (SaiLuoTong) Capsule
NCT03804229	Phase 3	ACTIVE_NOT_RECRUITING	Efficacy and Safety of Butylphthalide Soft Capsule for the Treatment of Vascular Dementia
NCT03986424	Phase 3	COMPLETED	Local Study of Akatinol Memantine in VaD in Russia
NCT04552041	Phase 3	COMPLETED	Prospekta in the Treatment of Cognitive, Behavioral and Psychiatric Disorders in Patients With Vascular Dementia.
NCT07015671	Phase 3	COMPLETED	Bioavailability and Bioequivalence Study of ER Torsemide and Spironolactone FDC Tablet in Healthy Subjects
NCT00018564	Phase 3	COMPLETED	Novel Therapies for Essential Tremor
NCT00236496	Phase 3	COMPLETED	A Comparison of the Efficacy and Safety of Topiramate Versus Placebo in Treating Tremor of Unknown Cause.
NCT01441284	Phase 3	WITHDRAWN	Efficacy of Pramipexole Extended Release in the Treatment of Essential Tremor
NCT04193527	Phase 3	COMPLETED	A Study to Evaluate the Diagnostic Efficacy of DaTSCAN™ Ioflupane (123I) Injection in Single Photon Emission Computed Tomography (SPECT) for the Diagnosis of Parkinsonian Syndrome (PS) in Chinese Patients
NCT04265209	Phase 3	COMPLETED	[18F] LBT-999 PET Compared to [123I]-FP/CIT SPECT to Distinguish Between Parkinson’s Diseases and Essential Tremor
NCT06087276	Phase 3	ACTIVE_NOT_RECRUITING	Essential 3 - Decentralized, Phase 3 Study Evaluating the Safety and Efficacy of Ulixacaltamide in Essential Tremor (ET)
NCT01466543	Phase 2	UNKNOWN	Effect of Zydena (Udenafil) on Cerebral Blood Flow and Peripheral Blood Viscosity
NCT01475578	Phase 2	COMPLETED	Study of STA-1 Capsule in Patients With Vascular Dementia (Marrow-Sea Deficiency)
NCT01608217	Phase 2	COMPLETED	Delta-THC in Dementia
NCT01761227	Phase 2	COMPLETED	Efficacy and Safety of Fufangdanshen Tablets in Mild to Moderate Vascular Dementia
NCT01953705	Phase 2	UNKNOWN	n-3 PUFA for Vascular Cognitive Aging
NCT01965756	Phase 2	COMPLETED	Effect of Insulin Sensitizer Metformin on AD Biomarkers
NCT01978730	Phase 2	UNKNOWN	The Clinical Trial of Chinese Herbal Medicine SaiLuoTong Capsule
NCT02467413	Phase 2	WITHDRAWN	BAC in Patient With Alzheimer’s Disease or Vascular Dementia
NCT03230071	Phase 2	COMPLETED	Efficacy and Safety of TMBCZG in Mild to Moderate Vascular Dementia
NCT04109963	Phase 2	UNKNOWN	Trial of Remote Ischemic Pre-conditioning in Vascular Cognitive Impairment
NCT05371639	Phase 2	UNKNOWN	Efficacy and Safety of Tian Ma Bian Chun Zhi Gan Tablets in Mild to Moderate Vascular Dementia
NCT00080366	Phase 2	COMPLETED	Octanol to Treat Essential Tremor
NCT00102596	Phase 2	COMPLETED	Clinical Trial Characterizing the Bioavailability of 1-Octanol in Adults With Ethanol-responsive Essential Tremor
NCT00223743	Phase 2	COMPLETED	A Safety/Efficacy Trial of Zonisamide for Essential Tremor
NCT00321087	Phase 2	TERMINATED	A Study of T2000 in Essential Tremor
NCT00598078	Phase 2	COMPLETED	Multiple-dose,Double-blind,Placebo-controlled Study of Sodium Oxybate in Patients With Essential Tremor
NCT00655278	Phase 2	TERMINATED	T2000 in Essential Tremor - Open Label Continuation
NCT01332695	Phase 2	COMPLETED	A Pilot Efficacy and Safety Study of ST101 in Essential Tremor
NCT02277106	Phase 2	COMPLETED	Evaluate SAGE-547 in Participants With Essential Tremor
NCT02551848	Phase 2	UNKNOWN	Kinematic-based BoNT-A Injections for Bilateral ET
NCT02668146	Phase 2	UNKNOWN	An Efficacy/Safety Study of Perampanel for Reducing Essential Tremor
NCT02978781	Phase 2	COMPLETED	A Study to Evaluate SAGE-217 in Participants With Essential Tremor
NCT03101241	Phase 2	COMPLETED	A Phase 2 RCT Study of CX-8998 for Essential Tremor
NCT03688685	Phase 2	COMPLETED	A Clinical Study to Evaluate CAD-1883 in Essential Tremor
NCT03780426	Phase 2	COMPLETED	tSMS in Essential Tremor
NCT04305275	Phase 2	COMPLETED	A Study to Evaluate the Efficacy, Safety, and Tolerability of SAGE-324 in Participants With Essential Tremor
NCT04727658	Phase 2	TERMINATED	Linac FRACtionated Radiosurgical THALamotomie in Tremors (FRACTHAL)
NCT04880616	Phase 2	COMPLETED	Safety, Efficacy, and Tolerability of NBI-827104 for the Treatment of Essential Tremor
NCT05021978	Phase 2	COMPLETED	A Clinical Trial of PRAX-944 in Participants With Essential Tremor

Predicted chemistry — Sugi Predict

The predicted patent-compound landscape for DNAJC13 across ~30M SureChEMBL compounds — explore on Sugi Predict.